Resveratrol Ameliorates Fibrosis in Rheumatoid Arthritis-Associated Interstitial Lung Disease via the Autophagy–Lysosome Pathway
Abstract
1. Introduction
2. Results
2.1. An Animal Model of Rheumatoid Arthritis-Related Interstitial Lung (RA-ILD) Was Established
2.2. Related Proteins in the Lungs of the CIA+BLM Group Were Changed
2.3. Resveratrol Improved the Progression of CIA+BLM, but Had Less Effect on Lung Inflammation
2.4. Resveratrol Attenuated Fibrosis in Lung Tissue
2.5. Resveratrol Regulated Autophagy in CIA+BLM and Affected Oxidative Stress-Related Proteins
2.6. Resveratrol Reversed Disruption of Autophagosome–Lysosome Fusion In Vitro to Improve Fibrosis
3. Methods
3.1. Animal Experiments
3.1.1. Animal Experiments
3.1.2. Lung Hydroxyproline Content
3.1.3. Lung Dry Weight and Wet Weight
3.1.4. Hematoxylin–Eosin (H&E) and Masson’s Staining
3.1.5. Western Blotting
3.1.6. Quantitative RT-PCR
3.2. Cell Experiments
3.2.1. Cell Culture and Reagents
3.2.2. Cell Transfection
3.3. Statistical Analysis
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
| RA-ILD | interstitial lung disease associated with rheumatoid arthritis |
| RA | rheumatoid arthritis |
| ILD | interstitial lung disease |
| Res | resveratrol |
| UIP | usual interstitial pneumonitis |
| LEF | leflunomide |
| ECM | extracellular matrix |
| COPD | chronic obstructive pulmonary disease |
| CFA | complete Freund’s adjuvant |
| BLM | bleomycin |
| H&E | hematoxylin–eosin |
| ROS | reactive oxygen species |
| Ctrl | control |
| CIA | collagen-induced arthritis models |
| CIA+BLM | CIA- and bleomycin-treated models |
| CB+Res | CIA+BLM- and resveratrol-treated models |
References
- McInnes, I.B.; Schett, G. Pathogenetic insights from the treatment of rheumatoid arthritis. Lancet 2017, 389, 2328–2337. [Google Scholar] [CrossRef] [PubMed]
- Dai, Y.J.; Wang, W.; Yu, Y.; Hu, S. Rheumatoid arthritis-associated interstitial lung disease: An overview of epidemiology, pathogenesis and management. Clin. Rheumatol. 2021, 40, 1211–1220. [Google Scholar] [CrossRef] [PubMed]
- Assayag, D.; Lee, J.S.; King, T.E. Rheumatoid arthritis associated interstitial lung disease: A review. Medicina 2014, 74, 158–165. [Google Scholar] [PubMed]
- Suda, T. Up-to-date information on rheumatoid arthritis-associated interstitial lung disease. Clin. Med. Insights Circ. Respir. Pulm. Med. 2015, 9 (Suppl. S1), 155–162. [Google Scholar] [CrossRef] [PubMed]
- Wu, E.K.; Ambrosini, R.D.; Kottmann, R.M.; Ritchlin, C.T.; Schwarz, E.M.; Rahimi, H. Reinterpreting Evidence of Rheumatoid Arthritis-Associated Interstitial Lung Disease to Understand Etiology. Curr. Rheumatol. Rev. 2019, 15, 277–289. [Google Scholar] [CrossRef]
- Yamakawa, H.; Ogura, T.; Kameda, H.; Kishaba, T.; Iwasawa, T.; Takemura, T.; Kuwano, K. Decision-Making Strategy for the Treatment of Rheumatoid Arthritis-Associated Interstitial Lung Disease (RA-ILD). J. Clin. Med. 2021, 10, 3806. [Google Scholar] [CrossRef]
- Iqbal, K.; Kelly, C. Treatment of rheumatoid arthritis-associated interstitial lung disease: A perspective review. Ther. Adv. Musculoskelet. Dis. 2015, 7, 247–267. [Google Scholar] [CrossRef]
- Yuan, H.; Jiao, L.; Yu, N.; Duan, H.; Yu, Y.; Bai, Y. Histone Deacetylase 3-Mediated Inhibition of microRNA-19a-3p Facilitates the Development of Rheumatoid Arthritis-Associated Interstitial Lung Disease. Front. Physiol. 2020, 11, 549656. [Google Scholar] [CrossRef]
- England, B.R.; Hershberger, D. Management issues in rheumatoid arthritis-associated interstitial lung disease. Curr. Opin. Rheumatol. 2020, 32, 255–263. [Google Scholar] [CrossRef]
- Galluzzi, L.; Green, D.R. Autophagy-independent functions of the autophagy machinery. Cell 2019, 177, 1682–1699. [Google Scholar] [CrossRef]
- Feng, Y.; He, D.; Yao, Z.; Klionsky, D.J. The machinery of macroautophagy. Cell Res. 2014, 24, 24–41. [Google Scholar] [CrossRef]
- Levine, B.; Kroemer, G. Biological functions of autophagy genes: A disease perspective. Cell 2019, 176, 11–42. [Google Scholar] [CrossRef]
- Klionsky, D.J.; Petroni, G.; Amaravadi, R.K.; Baehrecke, E.H.; Ballabio, A.; Boya, P.; Bravo-San Pedro, J.M.; Cadwell, K.; Cecconi, F.; Choi, A.M.K.; et al. Autophagy in major human diseases. EMBO J. 2021, 40, e108863. [Google Scholar] [CrossRef]
- Levine, B.; Kroemer, G. Autophagy in the pathogenesis of disease. Cell 2008, 132, 27–42. [Google Scholar] [CrossRef]
- Li, X.; Zhao, F.; Wang, A.; Cheng, P.; Chen, H. Role and mechanisms of autophagy in lung metabolism and repair. Cell. Mol. Life Sci. 2021, 78, 5051–5068. [Google Scholar] [CrossRef]
- Migneault, F.; Hébert, M.-J. Autophagy, tissue repair, and fibrosis: A delicate balance. Matrix Biol. 2021, 100, 182–196. [Google Scholar] [CrossRef]
- Kota, A.; Deshpande, D.A.; Haghi, M.; Oliver, B.; Sharma, P. Autophagy and airway fibrosis: Is there a link? F1000Research 2017, 6, 409. [Google Scholar] [CrossRef]
- Mizushima, N.; Komatsu, M. Autophagy: Renovation of cells and tissues. Cell 2011, 147, 728–741. [Google Scholar] [CrossRef]
- Levine, B.; Mizushima, N.; Virgin, H.W. Autophagy in immunity and inflammation. Nature 2011, 469, 323–335. [Google Scholar] [CrossRef]
- Søreng, K.; Neufeld, T.P.; Simonsen, A. Membrane trafficking in autophagy. Int. Rev. Cell Mol. Biol. 2018, 336, 1–92. [Google Scholar]
- Nakatogawa, H. Mechanisms governing autophagosome biogenesis. Nat. Rev. Mol. Cell Biol. 2020, 21, 439–458. [Google Scholar] [CrossRef] [PubMed]
- Jeong, S.J.; Zhang, X.; Rodriguez-Velez, A.; Evans, T.D.; Razani, B. p62/ and selective autophagy in cardiometabolic diseases. Antioxid. Redox Signal. 2019, 31, 458–471. [Google Scholar] [CrossRef] [PubMed]
- Chu, C.T. Mechanisms of selective autophagy and mitophagy: Implications for neurodegenerative diseases. Neurobiol. Dis. 2019, 122, 23–34. [Google Scholar] [CrossRef] [PubMed]
- Fernández-Rodríguez, J.A.; Almonte-Becerril, M.; Ramil-Gómez, O.; Hermida-Carballo, L.; Viñas-Diz, S.; Vela-Anero, Á.; Concha, Á.; Camacho-Encina, M.; Blanco, F.J.; López-Armada, M.J. Autophagy Activation by Resveratrol Reduces Severity of Experimental Rheumatoid Arthritis. Mol. Nutr. Food Res. 2021, 65, e2000377. [Google Scholar] [CrossRef] [PubMed]
- Malaguarnera, L. Influence of resveratrol on the immune response. Nutrients 2019, 11, 946. [Google Scholar] [CrossRef]
- Oh, W.Y.; Shahidi, F. Antioxidant activity of resveratrol ester derivatives in food and biological model systems. Food Chem. 2018, 261, 267–273. [Google Scholar] [CrossRef]
- Riveiro-Naveira, R.R.; Valcarcel-Ares, M.N.; Almonte-Becerril, M.; Vaamonde-García, C.; Loureiro, J.; Hermida-Carballo, L.; López-Peláez, E.; Blanco, F.J.; Lopez-Armada, M.J. Resveratrol lowers synovial hyperplasia, inflammatory markers and oxidative damage in an acute antigen-induced arthritis model. Rheumatology 2016, 55, 1889–1900. [Google Scholar] [CrossRef]
- Ren, J.; Zhang, Y. Targeting autophagy in aging and aging-related cardiovascular diseases. Trends Pharmacol. Sci. 2018, 39, 1064–1076. [Google Scholar] [CrossRef]
- Deng, S.; Shanmugam, M.K.; Kumar, A.P.; Yap, C.T.; Sethi, G.; Bishayee, A. Targeting autophagy using natural compounds for cancer prevention and therapy. Cancer 2019, 125, 1228–1246. [Google Scholar] [CrossRef]
- Fu, Y.; Rong, M.; Zhu, P.; Chen, L.; Fan, C.; Wang, Y.; Li, J.; Fu, X. The circulating fibrocytes are associated with the lung inflammation and fibrosis of mice with interstitial lung disease. Xi Bao Yu Fen Zi Mian Yi Xue Za Zhi= Chin. J. Cell. Mol. Immunol. 2014, 30, 814–818. [Google Scholar]
- Kolb, P.; Upagupta, C.; Vierhout, m.; Ayaub, E.; Bellaye, P.S.; Gauldie, J.; Shimbori, C.; Inman, M.; Ask, K.; Kolb, M.R.J. The importance of interventional timing in the bleomycin model of pulmonary fibrosis. Eur. Respir. J. 2020, 55, 1901105. [Google Scholar] [CrossRef]
- Wang, J.; He, F.; Chen, L.; Li, Q.; Jin, S.; Zheng, H.; Lin, J.; Zhang, H.; Ma, S.; Mei, J.; et al. Resveratrol inhibits pulmonary fibrosis by regulating miR-21 through MAPK/AP-1 pathways. Biomed. Pharmacother. 2018, 105, 37–44. [Google Scholar] [CrossRef]
- Kim, H.S.; Yoo, H.J.; Lee, K.M.; Song, H.E.; Kim, S.J.; Lee, J.O.; Hwang, J.J.; Woo Song, J. Stearic acid attenuates profibrotic signalling in idiopathic pulmonary fibrosis. Respirology 2021, 26, 255–263. [Google Scholar] [CrossRef]
- Xiong, L.; Xiong, L.; Ye, H.; Ma, W. Animal models of rheumatoid arthritis-associated interstitial lung disease. Immun. Inflamm. Dis. 2021, 9, 37–47. [Google Scholar] [CrossRef]
- Akgedik, R.; Akgedik, Ş.; Karamanlı, H.; Uysal, S.; Bozkurt, B.; Ozol, D.; Armutcu, F.; Yildirim, Z. Effect of resveratrol on treatment of bleomycin-induced pulmonary fibrosis in rats. Inflammation 2012, 35, 1732–1741. [Google Scholar] [CrossRef]
- Alabarse, P.V.G.; Lora, P.S.; Silva, J.M.S.; Santo, R.C.E.; Freitas, E.C.; Oliveira, M.S.d.; Almeida, A.S.; Immig, M.; Teixeira, V.O.N.; Filippin, L.I.; et al. Collagen-induced arthritis as an animal model of rheumatoid cachexia. J. Cachexia Sarcopenia Muscle 2018, 9, 603–612. [Google Scholar] [CrossRef]
- Lu, H.I.; Chung, S.Y.; Chen, Y.L.; Huang, T.H.; Zhen, Y.Y.; Liu, C.F.; Chang, M.W.; Chen, Y.L.; Sheu, J.J.; Chua, S.; et al. Exendin-4 therapy still offered an additional benefit on reducing transverse aortic constriction-induced cardiac hypertrophy-caused myocardial damage in DPP-4 deficient rats. Am. J. Transl. Res. 2016, 8, 778–798. [Google Scholar]
- Park, S.C.; Kim, H.; Bak, Y.; Shim, D.; Kwon, K.W.; Kim, C.H.; Yoon, J.H.; Shin, S.J. An Alternative Dendritic Cell-Induced Murine Model of Asthma Exhibiting a Robust Th2/Th17-Skewed Response. Allergy Asthma Immunol. Res. 2020, 12, 537–555. [Google Scholar] [CrossRef]
- Shi, X.; Chen, Y.; Liu, Q.; Mei, X.; Liu, J.; Tang, Y.; Luo, R.; Sun, D.; Ma, Y.; Wu, W.; et al. LDLR dysfunction induces LDL accumulation and promotes pulmonary fibrosis. Clin. Transl. Med. 2022, 12, e711. [Google Scholar] [CrossRef]
- Kadura, S.; Raghu, G. Rheumatoid arthritis-interstitial lung disease: Manifestations and current concepts in pathogenesis and management. Eur. Respir. Rev. 2021, 30, 210011. [Google Scholar] [CrossRef]
- Doyle, T.J.; Lee, J.S.; Dellaripa, P.F.; Lederer, J.A.; Matteson, E.L.; Fischer, A.; Ascherman, D.P.; Glassberg, M.K.; Ryu, J.H.; Danoff, S.K.; et al. A roadmap to promote clinical and translational research in rheumatoid arthritis-associated interstitial lung disease. Chest 2014, 145, 454–463. [Google Scholar] [CrossRef] [PubMed]
- Darby, I.A.; Hewitson, T.D. Hypoxia in tissue repair and fibrosis. Cell Tissue Res. 2016, 365, 553–562. [Google Scholar] [CrossRef] [PubMed]
- Garza-Lomb, C.; Pappa, A.; Panayiotidis, M.I.; Franco, R. Redox homeostasis, oxidative stress and mitophagy. Mitochondrion 2020, 51, 105–117. [Google Scholar] [CrossRef] [PubMed]
- Bellot, G.; Garcia-Medina, R.; Gounon, P.; Chiche, J.; Roux, D.; Pouysségur, J.; Mazure, N.M. Hypoxia-induced autophagy is mediated through hypoxia-inducible factor induction of BNIP3 and BNIP3L via their BH3 domains. Mol. Cell. Biol. 2009, 29, 2570–2581. [Google Scholar] [CrossRef] [PubMed]
- Levy, J.M.M.; Towers, C.G.; Thorburn, A. Targeting autophagy in cancer. Nat. Rev. Cancer 2017, 17, 528–542. [Google Scholar] [CrossRef]
- Filomeni, G.; De Zio, D.; Cecconi, F. Oxidative stress and autophagy: The clash between damage and metabolic needs. Cell Death Differ. 2015, 22, 377–388. [Google Scholar] [CrossRef]
- Mauthe, M.; Orhon, I.; Rocchi, C.; Zhou, X.; Luhr, M.; Hijlkema, K.J.; Coppes, R.P.; Engedal, N.; Mari, M.; Reggiori, F. Chloroquine inhibits autophagic flux by decreasing autophagosome-lysosome fusion. Autophagy 2018, 14, 1435–1455. [Google Scholar] [CrossRef]
- Wang, P.; Jiang, L.; Zhou, N.; Zhou, H.; Liu, H.; Zhao, W.; Zhang, H.; Zhang, X.; Hu, Z. Resveratrol ameliorates autophagic flux to promote functional recovery in rats after spinal cord injury. Oncotarget 2018, 9, 8427–8440. [Google Scholar] [CrossRef]
- Komatsu, M.; Kurokawa, H.; Waguri, S.; Taguchi, K.; Kobayashi, A.; Ichimura, Y.; Sou, Y.-S.; Ueno, I.; Sakamoto, A.; Tong, K.I.; et al. The selective autophagy substrate p62 activates the stress responsive transcription factor Nrf2 through inactivation of Keap1. Nat. Cell Biol. 2010, 12, 213–223. [Google Scholar] [CrossRef]
- Xuzhu, G.; Komai-Koma, M.; Leung, B.P.; Howe, H.S.; McSharry, C.; McInnes, I.B.; Xu, D. Resveratrol modulates murine collagen-induced arthritis by inhibiting Th17 and B-cell function. Ann. Rheum. Dis. 2012, 71, 129–135. [Google Scholar] [CrossRef]
- Yang, G.; Chang, C.C.; Yang, Y.; Yuan, L.; Xu, L.; Ho, C.T.; Li, S. Resveratrol alleviates rheumatoid arthritis via reducing ROS and inflammation, inhibiting MAPK signaling pathways, and suppressing angiogenesis. J. Agric. Food Chem. 2018, 66, 12953–12960. [Google Scholar] [CrossRef]
- Corrêa, M.G.; Pires, P.R.; Ribeiro, F.V.; Pimentel, S.P.; Cirano, F.R.; Napimoga, M.H.; Casati, M.Z.; Casarin, R.C.V. Systemic treatment with resveratrol reduces the progression of experimental periodontitis and arthritis in rats. PLoS ONE 2018, 13, e0204414. [Google Scholar] [CrossRef]
- Qin, N.; Wei, L.; Li, W.; Yang, W.; Cai, L.; Qian, Z.; Wu, S. Local intra-articular injection of resveratrol delays cartilage degeneration in C57BL/6 mice by inducing autophagy via AMPK/mTOR pathway. J. Pharmacol. Sci. 2017, 134, 166–174. [Google Scholar] [CrossRef]
- Bruyn, G.A.; Tate, G.; Caeiro, F.; Maldonado-Cocco, J.; Westhovens, R.; Tannenbaum, H.; Bell, M.; Forre, O.; Bjorneboe, O.; Tak, P.P.; et al. Everolimus in patients with rheumatoid arthritis receiving concomitant methotrexate: A 3-month, double-blind, randomised, placebo-controlled, parallel-group, proof-of-concept study. Ann. Rheum. Dis. 2008, 67, 1090–1095. [Google Scholar] [CrossRef]
- Yan, H.; Zhou, H.F.; Hu, Y.; Pham, C.T. Suppression of experimental arthritis through AMP-activated protein kinase activation and autophagy modulation. J. Rheum. Dis. Treat. 2015, 1, 5. [Google Scholar] [CrossRef]
- Yin, H.; Wu, H.; Chen, Y.; Zhang, J.; Zheng, M.; Chen, G.; Li, L.; Lu, Q. The therapeutic and pathogenic role of autophagy in autoimmune diseases. Front. Immunol. 2018, 9, 1512. [Google Scholar] [CrossRef]
- Zhu, L.; Wang, H.; Wu, Y.; He, Z.; Qin, Y.; Shen, Q. The autophagy level is increased in the synovial tissues of patients with active rheumatoid arthritis and is correlated with disease severity. Mediat. Inflamm. 2017, 2017, 7623145. [Google Scholar] [CrossRef]
- Espinoza, J.L.; Trung, L.Q.; Inaoka, P.T.; Yamada, K.; An, D.T.; Mizuno, S.; Nakao, S.; Takami, A. The repeated administration of resveratrol has measurable effects on circulating T-cell subsets in humans. Oxidative Med. Cell. Longev. 2017, 2017, 6781872. [Google Scholar] [CrossRef]
- Hou, C.Y.; Tain, Y.L.; Yu, H.R.; Huang, L.T. The effects of resveratrol in the treatment of metabolic syndrome. Int. J. Mol. Sci. 2019, 20, 535. [Google Scholar] [CrossRef]
- Rockel, J.S.; Kapoor, M. Autophagy: Controlling cell fate in rheumatic diseases. Nat. Rev. Rheumatol. 2016, 12, 517–531. [Google Scholar] [CrossRef]






| Gene | Primer Sequence (5′→3′) |
|---|---|
| GAPDH-F | TTCACCACCATGGAGAAGGC |
| GAPDH-R | GGCATGGACTGTGGTCATGA |
| COL3A1-F | CTGAAGATGTCGTTGATGTG |
| COL3A1-R | CTGATCCATATAGGCAATACTG |
| IL1β-F | CTGAACTCAACTGTGAAATGC |
| IL1β-R | TGATGTGCTGCTGCGAGA |
| TGF-β-F | ACAATTCCTGGCGTTACCTT |
| TGF-β-R | AGCCCTGTATTCCGTCTCC |
| BNIP3-F | TCCAGCCTCCGTCTCTATTT |
| BNIP3-R | CGACTTGACCAATCCCATATCC |
| LC3B-F | ATGCCGTCCGAGAAGACCTTCA |
| LC3B-R | CTGTGCCCATTCACCAGGAGGA |
| P62-F | GAACTCGCTATAAGTGCATGT |
| P62-R | AGAGAAGCTATCAGAGAGGTGG |
| FN-1-F | TGGTTTGGTCTGGGATCAATAG |
| FN-1-R | GTGACTTTCCTGCTCAAGGT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bao, L.; Ye, J.; Liu, N.; Shao, Y.; Li, W.; Fan, X.; Zhao, D.; Wang, H.; Chen, X. Resveratrol Ameliorates Fibrosis in Rheumatoid Arthritis-Associated Interstitial Lung Disease via the Autophagy–Lysosome Pathway. Molecules 2022, 27, 8475. https://doi.org/10.3390/molecules27238475
Bao L, Ye J, Liu N, Shao Y, Li W, Fan X, Zhao D, Wang H, Chen X. Resveratrol Ameliorates Fibrosis in Rheumatoid Arthritis-Associated Interstitial Lung Disease via the Autophagy–Lysosome Pathway. Molecules. 2022; 27(23):8475. https://doi.org/10.3390/molecules27238475
Chicago/Turabian StyleBao, Lanxin, Jing Ye, Nannan Liu, Yubao Shao, Wenhao Li, Xuefei Fan, Dahai Zhao, Hongzhi Wang, and Xiaoyu Chen. 2022. "Resveratrol Ameliorates Fibrosis in Rheumatoid Arthritis-Associated Interstitial Lung Disease via the Autophagy–Lysosome Pathway" Molecules 27, no. 23: 8475. https://doi.org/10.3390/molecules27238475
APA StyleBao, L., Ye, J., Liu, N., Shao, Y., Li, W., Fan, X., Zhao, D., Wang, H., & Chen, X. (2022). Resveratrol Ameliorates Fibrosis in Rheumatoid Arthritis-Associated Interstitial Lung Disease via the Autophagy–Lysosome Pathway. Molecules, 27(23), 8475. https://doi.org/10.3390/molecules27238475

