Next Article in Journal
Synergistic Catalytic Performance of Toluene Degradation Based on Non-Thermal Plasma and Mn/Ce-Based Bimetal-Organic Frameworks
Next Article in Special Issue
Progression of Antiviral Agents Targeting Viral Polymerases
Previous Article in Journal
Optimization of the Laminate Structure of a Composite Cylinder Based on the Combination of Response Surface Methodology (RSM) and Finite Element Analysis (FEA)
Previous Article in Special Issue
Antiviral Effect of Bovine Lactoferrin against Enterovirus E
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Honokiol and Alpha-Mangostin Inhibit Mayaro Virus Replication through Different Mechanisms

by
Patricia Valdés-Torres
1,2,†,
Dalkiria Campos
1,†,
Madhvi Bhakta
1,
Paola Elaine Galán-Jurado
1,
Armando A. Durant-Archibold
3 and
José González-Santamaría
1,*
1
Grupo de Biología Celular y Molecular de Arbovirus, Instituto Conmemorativo Gorgas de Estudios de la Salud, Panama City 0816-02593, Panama
2
Programa de Maestría en Microbiología Ambiental, Universidad de Panamá, Panama City 0824-03366, Panama
3
Departamento de Bioquímica, Facultad de Ciencias Naturales, Exactas y Tecnología, Universidad de Panamá, Panama City 0824-03366, Panama
*
Author to whom correspondence should be addressed.
These authors contributed equally to this work.
Molecules 2022, 27(21), 7362; https://doi.org/10.3390/molecules27217362
Submission received: 19 August 2022 / Revised: 26 October 2022 / Accepted: 27 October 2022 / Published: 29 October 2022
(This article belongs to the Special Issue Antiviral Agents for RNA-Virus Infection)

Abstract

Mayaro virus (MAYV) is an emerging arbovirus with an increasing circulation across the Americas. In the present study, we evaluated the potential antiviral activity of the following natural compounds against MAYV and other arboviruses: Sanguinarine, (R)-Shikonin, Fisetin, Honokiol, Tanshinone IIA, and α-Mangostin. Sanguinarine and Shikonin showed significant cytotoxicity, whereas Fisetin, Honokiol, Tanshinone IIA, and α-Mangostin were well tolerated in all the cell lines tested. Honokiol and α-Mangostin treatment protected Vero-E6 cells against MAYV-induced damage and resulted in a dose-dependent reduction in viral progeny yields for each of the MAYV strains and human cell lines assessed. These compounds also reduced MAYV viral RNA replication in HeLa cells. In addition, Honokiol and α-Mangostin disrupted MAYV infection at different stages of the virus life cycle. Moreover, Honokiol and α-Mangostin decreased Una, Chikungunya, and Zika viral titers and downmodulated the expression of E1 and nsP1 viral proteins from MAYV, Una, and Chikungunya. Finally, in Honokiol- and α-Mangostin-treated HeLa cells, we observed an upregulation in the expression of type I interferon and specific interferon-stimulated genes, including IFNα, IFNβ, MxA, ISG15, OAS2, MDA-5, TNFα, and IL-1β, which may promote an antiviral cellular state. Our results indicate that Honokiol and α-Mangostin present potential broad-spectrum activity against different arboviruses through different mechanisms.

1. Introduction

Arthropod-borne viruses (arboviruses) have provoked large epidemics in the Americas, including the Chikungunya (CHIKV) and Zika (ZIKV) viruses in 2013 and 2015, respectively [1,2]. Endemic and emerging arboviruses, such as Mayaro virus (MAYV), show increasing activity across the region [3,4,5,6,7]. MAYV is a neglected arbovirus belonging to the Togaviridae family within the Alphavirus genus [8]. MAYV causes Mayaro fever, a disease with non-specific symptoms similar to those of other arboviruses, including fever, headache, diarrhea, leucopenia, retro-orbital pain, myalgia, joint pain, skin rash, and—in some cases—severe polyarthralgia that can last from months to years [9,10]. Although MAYV is mainly transmitted in a sylvatic cycle through the bites of Haemagogus jantinomys mosquitoes, recent evidence suggests that urban vectors, such as Aedes aegypti or Aedes albopictus, may contribute to the spread of this virus, increasing the risk for future outbreaks [11,12,13,14,15]. Despite MAYV’s potential threat to public health, there are currently no licensed vaccines or treatments to combat this infection. Therefore, there is an urgent need to identify potential anti-MAYV drugs.
Natural products are a rich source of molecules with diverse biological activities; in addition, while some natural compounds have been shown to protect against viruses of specific families, others have demonstrated broad-spectrum antiviral activity [16,17,18]. Drugs derived from natural sources have several advantages over synthetic compounds, among them are lower cost, fewer side effects, more diversity, and complexity of chemical molecules—which may limit viral drug resistance and their cost effectiveness in drug discovery programs [19]. All these characteristics suggest that screening natural compounds is a promising strategy for identifying new potential antivirals. Various studies have explored the antiviral effects of natural compounds on MAYV. For example, flavonoids derived from Bauhinia longifolia, including Quercetin and Quercetin 3-O-glycosides, were shown to inhibit MAYV replication in a dose-dependent manner [20]. In another study, Ferraz and colleagues found that the flavonoid proanthocyanidin isolated from Maytenis imbricata roots demonstrated potent virucidal activity against MAYV [21]. Using a mouse model of MAYV infection, the same research group found that the natural compound, silymarin, prevented liver damage and inflammation, as well as decreased viral load in the liver, spleen, brain, thigh muscle, and footpad [22]. In addition, in our laboratory, Ginkgolic acid isolated from the Ginkgo biloba plant showed a strong virucidal activity against Mayaro, Chikungunya, Una, and Zika viruses [23].
Sanguinarine, (R)-Shikonin, Tanshinone IIA, Honokiol, and α-Mangostin are all natural compounds that have been isolated from the plant species Sanguinaria canadensis, Lithospermum erythrorhizon, Salvia miltiorrhiza, Magnolia officinalis, and Garcinia mangostana, respectively [24,25,26,27,28]. Fisetin is a flavonoid that has been isolated from different plant species in the Fabaceae and Anarcadiaceae families, as well as in several comestible fruits [29]. This compound has demonstrated potent anti-inflammatory, antioxidant, and antitumoral activity [29]. Sanguinarine is a benzophenanthridine alkaloid with anticancer and anti-inflammatory properties [24,30,31]. Shikonin is a naphthoquinone with potential application for the treatment of several types of tumors, inflammation, and wound healing [25,32]. Tanshinone IIA is a diterpene quinone with antioxidant and anti-inflammatory properties [27]. Honokiol is a lignan biphenol, whereas α-Mangostin belongs to a class of molecules know as xanthones. These compounds have all shown multiple pharmacological activities, including anti-inflammatory [33,34,35], antifungal [36,37], antifibrotic [38,39], antibacterial [40,41,42], antitumoral [43,44,45,46], antioxidant [47,48], anti-depressant [26,49], neuro- and cardio-protective properties [50,51,52,53], as well as antiviral activity against certain viruses [54,55,56,57,58]. However, neither Sanguinarine, (R)-Shikonin, Fisetin, Tanshinone IIA, Honokiol, nor α-Mangostin have been studied extensively in the context of arboviruses. Thus, the aim of this work was to evaluate the potential antiviral activity of these natural compounds against MAYV and other arboviruses.

2. Results

2.1. Honokiol and α-Mangostin Prevent MAYV-Induced Cytopathic Effects in Vero-E6 Cells in a Dose-Dependent Manner

To explore the potential antiviral activity of the natural compounds Sanguinarine, (R)-Shikonin, Fisetin, Honokiol, Tanshinone IIA, and α-Mangostin (Figure 1A–F) against MAYV, we first analyzed the cytotoxicity of these compounds in Vero-E6 cells using the MTT method. As shown in Figure 2, Sanguinarine and (R)-Shikonin significantly reduced cell viability at doses of 5 and 10 μM for both incubation times tested (Figure 2A,B). In contrast, with Fisetin, Honokiol, and Tanshinone IIA, cell viability was around 80% or higher, independent of the incubation time (Figure 2C–E). In the case of α-Mangostin, we observed a high toxicity at 10 μM concentration for both incubation times tested, while the 5 μM dose appeared to have no effect (Figure 2F). Thus, we decided not to include Sanguinarine and (R)-Shikonin in further experiments, and we used 10 μM for Fisetin, Honokiol, and Tanshinone IIA, as well as 5 μM for α-Mangostin, as the maximal doses in the subsequent experiments.
Previous studies have determined that MAYV has the capacity to induce strong cytopathic effects in different cell lines, including in Vero and primary human dermal fibroblasts (HDFs) [59,60]. Therefore, we evaluated whether the Fisetin, Honokiol, Tanshinone IIA, or α-Mangostin compounds were able to protect Vero-E6 cells from MAYV-induced damage. Microscopic analysis of MAYV-infected cells revealed that Fisetin did not appear to protect cells from virus-induced cytopathic effects, regardless of the dose tested (Figure 3), while we observed a partial protection when using the higher concentration of Tanshinone IIA that was evaluated (Figure 3). On the other hand, cell protection was evident with Honokiol and α-Mangostin, with the higher dose offering greater protection (Figure 3). Taken together, these results indicate that Honokiol and α-Mangostin block MAYV-induced cytopathic effects in Vero-E6 cells and suggest that these natural compounds may have antiviral activity.

2.2. Honokiol and α-Mangostin Reduce MAYV Replication in Vero-E6 Cells in a Dose-Dependent Manner

To investigate if Fisetin, Honokiol, Tanshinone IIA, or α-Mangostin influence MAYV replication, we assessed viral progeny production in supernatants from infected Vero-E6 cells treated with increasing concentrations of these compounds using plaque-forming assays. While Fisetin did not affect MAYV progeny production, Tanshinone IIA resulted in a small but significant reduction in viral titers (Figure 4A,C). In contrast, Honokiol and α-Mangostin promoted a substantial dose-dependent decrease in viral titers (Figure 4B,D), which reached between 3 and 4 logs at the maximum doses tested (Figure 4B,D). To corroborate these findings, we performed a similar experiment and used an immunofluorescence assay in order to analyze the percentage of E1 protein-positive cells among MAYV infected-cells treated with Honokiol or α-Mangostin. In MAYV-infected cells treated with DMSO, 64.9 ± 6.8% of Vero-E6 cells were positive for E1 protein (Figure 4E,F). Interestingly, in Vero-E6 cells treated with Honokiol or α-Mangostin we found a significant decrease in MAYV-infected cells (37.3 ± 10.7% and 10.8 ± 4.6% for Honokiol; 42.9 ± 8% and 18.5 ± 7.3% for α-Mangostin), and this effect was dose-dependent (Figure 4E,F). These results confirm that Honokiol and α-Mangostin inhibit MAYV replication in Vero-E6 cells.

2.3. Honokiol and α-Mangostin Inhibit MAYV Progeny Production Independent of Virus Strain or Human Cell Line Tested

Up until this point, the infection experiments were performed using the MAYV strain AVR0565 that was isolated in San Martin, Peru. To determine if the antiviral effect of Honokiol and/or α-Mangostin is also present in other MAYV strains from different geographical areas, we tested both compounds on the Guyane (Guyane, French Guiana) and TRVL4675 (Mayaro, Trinidad and Tobago) strains. To this end, we infected Vero-E6 cells with these strains and then treated them with increasing doses of Honokiol or α-Mangostin. Following 24 h of incubation, we quantified MAYV progeny production. This analysis revealed that Honokiol and α-Mangostin reduced MAYV progeny yield regardless of the virus strains being tested (Figure 5A–D). To validate these results, we used two human cell lines, primary HDFs, and HeLa cells, which were previously demonstrated to be susceptible to MAYV infection [60]. We infected both cell lines with the MAYV strain AVR0565 and applied Honokiol or α-Mangostin, as described above. Again, we found that Honokiol and α-Mangostin decreased viral progeny production regardless of the cell line tested (Figure 5E–H). The inhibitory effect of these compounds on the human cell lines we evaluated did not appear to be associated with cell toxicity (Figure 5I–L). These results provide further evidence that Honokiol and α-Mangostin inhibit MAYV replication.

2.4. Pretreating HDFs with α-Mangostin, but Not Honokiol, Affects MAYV Progeny Production

While in all the preceding assays the Honokiol or α-Mangostin treatment was applied after viral adsorption, we decided instead to evaluate whether pretreating HDFs with these compounds has any effect on MAYV replication. To this end, HDFs were pre-treated with Honokiol or α-Mangostin for 2 h and then infected with MAYV as previously described. After viral adsorption, a fresh medium without the compounds was added to the cells. They were then incubated for an additional 24 h and viral titers were assessed as described above. As shown in Figure 6, in HDFs pre-treated with α-Mangostin there was a significant dose-dependent reduction in viral titers, whereas with Honokiol, we did not observe any effect (Figure 6A,B). In order to determine if Honokiol or α-Mangostin act directly on MAYV particles, we performed a virucidal assay. In these experiments, we did not observe a decrease in viral titers in the solutions containing Honokiol or α-Mangostin when compared to control solutions prepared with DMSO, indicating that these compounds do not have a direct effect on MAYV (Figure 6C,D).

2.5. Honokiol and α-Mangostin Treatment Disturb MAYV Infection at Different Stages of the Viral Life Cycle

In an attempt to identify the MAYV cycle stage and how it is affected by Honokiol or α-Mangostin, we treated cells with these compounds at different phases of virus infection. The first step in MAYV infection consists of viral particles attaching to a receptor on the cell membrane of a susceptible host cell [8]. Thus, we completed a binding assay in which HDFs were infected with MAYV in the presence of Honokiol or α-Mangostin at 4 °C for 1 h. At this temperature, the virus is able to attach to cell membrane receptors, but not enter the cells. Then, the cells were incubated at 37 °C in the medium without the compounds for 24 h and the viral titers were then quantified. These experiments revealed that α-Mangostin affected MAYV attachment for both of the doses tested (Figure 7B). In Honokiol-treated cells, we observed a modest effect at the higher concentration we tested (Figure 7A). Next, we wanted to evaluate whether Honokiol or α-Mangostin may affect viral entry into the host cell. To achieve this, we infected HDFs with MAYV at 4 °C; after 1 h, the cells were shifted to 37 °C and incubated with Honokiol or α-Mangostin for 1 h. Then, the compounds were removed and, following 24 h of infection, viral progeny production was evaluated. These assays demonstrated that α-Mangostin partially disturbed the viral entry step, while Honokiol did not appear to affect this process (Figure 7C,D). Finally, we carried out a post-entry assay. We infected the cells using the same procedure as the entry assay, where, after viral adsorption, we incubated the cells at 37 °C for 2 h. Next, we added Honokiol or α-Mangostin, the cells were then incubated until 24 h post infection and viral titers were assessed as described above. As shown in Figure 7E,F both natural compounds were able to reduce viral progeny production, indicating that Honokiol and α-Mangostin also affect a post-entry step in MAYV infection. Collectively, these data suggest that these compounds inhibit MAYV infection at diverse stages of the MAYV life cycle.

2.6. Honokiol and α-Mangostin Downmodulate the Expression of MAYV E1 and nsP1 Proteins and Additionally, Affect Viral RNA Replication

To examine the effect of Honokiol or α-Mangostin on the expression of the MAYV E1 and nsP1 proteins, we completed an infection experiment in cells treated with increasing doses of Honokiol or α-Mangostin and analyzed the results using Western blot. As shown in Figure 8, Honokiol and α-Mangostin promoted a significant dose-dependent decrease in both viral proteins in HeLa cells (Figure 8A,B). Similar results were observed in Vero-E6 cells and HDFs treated with these compounds (Figure S1). To evaluate if these compounds affect viral RNA replication, we performed a RT-PCR in HeLa cells infected with MAYV and treated with Honokiol or α-Mangostin. Our results indicated that treatment with these compounds triggered a potent reduction in viral RNA. Collectively, these results indicate that Honokiol and α-Mangostin affect the expression of MAYV E1 and nsP1 proteins as well as viral RNA replication.

2.7. Honokiol and α-Mangostin Also Inhibit the Una, Chikungunya, and Zika Arboviruses

Given that Honokiol and α-Mangostin have demonstrated significant inhibitory activity with MAYV, we decided to evaluate the effect of these compounds on other emerging and re-emerging arboviruses. For this, Vero-E6 cells were infected with the alphaviruses Una (UNAV), Chikungunya (CHIKV), or the Flavivirus Zika (ZIKV); then, increasing doses of Honokiol or α-Mangostin in fresh medium were added to the cells after 1 h of virus adsorption. Following 24 h of incubation, viral titers and the expression of the E1 and nsP1 proteins were measured in cell supernatants and lysates, respectively. Our results indicate that the treatment with Honokiol or α-Mangostin promoted a substantial reduction in viral titers for all the arboviruses tested (Figure 9A,B,E,F,I,J). Moreover, we observed a downmodulation of E1 and nsP1 protein expression in UNAV- and CHIKV-infected cells treated with these compounds (Figure 9C,D,G,H). Unfortunately, two commercial antibodies against the ZIKV NS1 and E proteins did not function as expected in our experiments. These findings suggest that Honokiol and α-Mangostin may have broad-spectrum antiviral activity.

2.8. Honokiol and α-Mangostin Treatment Elicit the Expression of Type I Interferon and Specific Interferon-Stimulated Genes in HeLa Cells

In order to evaluate another possible mechanism by which Honokiol and α-Mangostin inhibit viral replication, we explored the interferon pathway. Type I interferon (IFN) production is one of the main arms of cell defense used to control viruses and other microbial infections [61]. Type I IFN includes five proteins: IFNα, IFNβ, IFNκ, IFNε, and IFNω. IFNα/β induces the JAK–STAT pathway, which promotes the expression of antiviral genes implicated in the immune response [61]. Previously, Chen and collaborators showed that Honokiol, and its isomere Magnolol, were able to induce type I IFN and IFN-stimulated genes in carp kidney cells, contributing to grass carp reovirus inhibition [62]. Moreover, α-Mangostin has been demonstrated to stimulate IFN synthesis through the TBK1-IRF-3 pathway and act as an agonist of adaptor protein stimulator of interferon genes (STING) in human macrophages [63]. To investigate if the antiviral activity observed for Honokiol or α-Mangostin in HeLa and HDFs may be mediated by IFN in these cell infection models, we assessed the expression of type I IFN and specific IFN-stimulated genes in treated or untreated HeLa cells using quantitative RT-PCR. In these experiments, we found that Honokiol or α-Mangostin treatment promoted a significant increase in mRNA expression for the IFNα, IFNβ, MxA, ISG15, OAS2, and MDA-5 genes (Figure 10A–F). In addition, Honokiol stimulated the expression of inflammatory cytokine genes, such as TNFα and IL-1β (Figure 10G,H). Taken together, these findings indicate that Honokiol and α-Mangostin may elicit an antiviral cellular state through a possible modulation of the IFN pathway in HeLa cells.

3. Discussion

MAYV is a neglected and emerging arbovirus with increasing activity across the Americas [3]. Although MAYV is mainly transmitted by sylvatic mosquito species in tropical regions, growing evidence indicates that urban vectors, such as Aedes aegypti or Aedes albopictus, may contribute to the spread of this pathogen, increasing the risk for future epidemics [13]. Despite MAYV’s potential threat to public health, there are no approved drugs to combat this virus. Therefore, identifying potential anti-MAYV treatments remains crucial.
Natural products are a common source of molecules with a broad range of pharmacological activities, including antiviral compounds [16,17]. In the present study, we used a series of in vitro assays to investigate the potential antiviral activity of plant-derived compounds against MAYV and other arboviruses. The compounds tested included Sanguinarine chloride, (R)-Shikonin, Fisetin, Honokiol, Tanshinone IIA, and α-Mangostin. Cytotoxicity analysis revealed that Sanguinarine chloride and (R)-Shikonin had considerable toxic effects for all doses and incubation times tested. These findings are consistent with previous reports of these compounds’ high cytotoxicity in several cancer cell lines, supporting their possible use as antitumoral drugs [30,31,32,64]. On the other hand, Fisetin, Honokiol, Tanshinone IIA, and α-Mangostin were well-tolerated at doses of 5 or 10 μM in the tested cell lines. Therefore, we evaluated their ability to protect Vero-E6 cells from MAYV-induced cytopathic effects. In these experiments, we found that Honokiol and α-Mangostin prevented MAYV-induced damage in a dose-dependent manner, indicating these compounds may have antiviral activity. In contrast, Fisetin did not protect the Vero-E6 cells, and Tanshinone IIA showed a slight protection only at the highest concentration tested.
To further explore our hypothesis, we assessed MAYV progeny production in Vero-E6 cells treated with increasing doses of Fisetin, Honokiol, Tanshinone IIA, or α-Mangostin. Our results demonstrated that Honokiol and α-Mangostin promoted a significant dose-dependent reduction in MAYV viral titers. This decrease reached between 3 and 4 logs at the maximum dose tested. In agreement with our observations for the cell protection assay, we did not find a decline in viral titers in Fisetin-treated cells, and we saw only a modest effect with Tanshinone IIA treatment. In addition, we analyzed the percentage of MAYV E1 protein-positive cells in Honokiol- and α-Mangostin-treated cells using an immunofluorescence assay. These experiments indicated that Honokiol and α-Mangostin reduced the percentage of MAYV-infected cells in a dose-dependent manner. To further validate these findings, we tested the effects of Honokiol and α-Mangostin with two additional MAYV strains, Guyane and TRVL4675, and using two human cell lines, HDFs and HeLa. We obtained similar results again, providing further evidence that these compounds exhibit anti-MAYV activity. The antiviral activity we observed is in line with previous studies, which have revealed that Honokiol or α-Mangostin inhibit Dengue virus serotype-2, CHIKV, human norovirus, Herpes simplex virus-1, hepatitis C virus, and grass carp reovirus [54,55,56,57,58,62,65].
The previously described experiments from our study involved applying Honokiol or α-Mangostin after viral adsorption, but we also explored the consequences of pretreating cells with these compounds. In these assays we found that only pretreatment with α-Mangostin affected MAYV progeny production. We also evaluated the possible effects of Honokiol or α-Mangostin on MAYV particles. However, the virucidal assay results indicate that Honokiol and α-Mangostin did not act directly on MAYV. To identify the stage of the MAYV viral cycle impacted by Honokiol or α-Mangostin, we completed binding, entry, and post-entry assays. Our findings revealed that α-Mangostin treatment led to effects on all three of these viral stages, whereas Honokiol treatment only partially affected the viral binding and post-entry stages, which indicates these natural compounds may block MAYV infection at distinct phases. Consequently, we assessed the expression of E1 and nsP1 viral proteins in Honokiol- or α-Mangostin-treated cells. Western blot analyses demonstrated that Honokiol and α-Mangostin promoted a downmodulation of both viral proteins for all the cell lines tested. In addition, RT-PCR experiments in HeLa cells revealed that these compounds strongly suppressed viral RNA replication. Collectively, these findings suggest that Honokiol and α-Mangostin may inhibit viral replication mainly through two mechanisms: the suppression of viral proteins expression and decreased viral RNA replication. Earlier work has demonstrated that Honokiol affects the Dengue virus entry step by blocking the endocytic pathway and reduces the expression of NS1 and NS3 viral proteins [54].
Since Honokiol and α-Mangostin have shown consistent suppressive activity against MAYV, we decided to examine the effects of these compounds on other arboviruses: UNAV, CHIKV, and ZIKV. Although a previous study reported that α-Mangostin disrupted the replication of an African genotype strain of CHIKV in vitro and in vivo [58], we tested this compound on a CHIKV strain (with an Asian lineage) that was isolated in Panama [66]. Viral titer quantification experiments showed that Honokiol and α-Mangostin decreased viral progeny production in a dose-dependent manner for all the arboviruses we assessed. Moreover, we observed a significant reduction in E1 and nsP1 protein levels in cell lysates from UNAV- and CHIKV-infected cells, indicating that these compounds may have broad-spectrum antiviral activity. It is important to highlight this is the first report of Honokiol’s antiviral activity against different alphaviruses.
Previous studies have shown that Honokiol and α-Mangostin were able to modulate antiviral cell defense by activating the interferon pathway. Chen and collaborators found that Honokiol and a related compound, Magnolol, enhanced the antiviral response against grass carp reovirus via increased transcription of type I IFN and IFN-stimulated genes in carp kidney cells [62]. Furthermore, Zhang et al. demonstrated that α-Mangostin activates the adaptor protein STING in human macrophages, thus promoting type I IFN synthesis [63]. While our preceding experiments in Vero-E6 cells indicated that Honokiol and α-Mangostin’s antiviral activity is independent of the interferon pathway, we decided to evaluate the expression of type I IFN and IFN-stimulated genes in Honokiol- or α-Mangostin-treated HeLa cells in order to explain our observations. These assays showed that both compounds upregulated the expression of the IFNα, IFNβ, MxA, ISG15, OAS2, and MDA-5 genes. Honokiol was also able to induce the expression of TNFα and IL-1β genes. Collectively, these findings suggest that Honokiol and α-Mangostin may also inhibit viral replication through a possible modulation of the IFN pathway, at least in Hela cells.
Although Honokiol and α-Mangostin have a limited oral bioavailability—thereby affecting their potential use as antivirals—several delivery systems, including nanoparticles or nanomicelles, have been developed in order to improve the activity, bioavailability, and pharmacokinetic properties of these natural compounds [67,68]. An alternative strategy to be explored is an analogue compound synthesis, which could provide similar or enhanced activities, but with improved pharmacological profiles [69,70]. Our results support that Honokiol and α-Mangostin compounds represent potential broad-spectrum antivirals that act through different mechanisms. However, detailed studies in animal models are necessary to determine the utility and efficacy of these compounds as antiviral drugs.

4. Materials and Methods

4.1. Cell Culture and Reagents

Vero-E6 cells (CRL-1586), human dermal fibroblasts (HDFs) from adults (PCS-201-012) (both obtained from ATCC, Manassas, VA, USA) and HeLa cells (kindly provided by Dr. Carmen Rivas, CIMUS, Santiago de Compostela, Spain) were grown in a Minimal Essential Medium (MEM) or in a Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with a 10% fetal bovine serum (FBS), a 1% penicillin-streptomycin antibiotic solution, and 2 mM of L-Glutamine (all reagents were obtained from Gibco, Waltham, MA, USA). Cell lines were incubated at 37 °C under a 5% CO2 atmosphere. The natural compounds Sanguinarine chloride (13-methyl-[1,3]-benzodioxolo [5,6-c]-1,3-dioxolo[4,5-i]phenanthridinium chloride), (97.8% purity); (R)-Shikonin (5,8-dihydroxy-2-[(1R)-1-hydroxy-4-methyl-3-penten-1-yl]-1,4-naphthalenedione), (99.8% purity); Fisetin (2-(3,4-Dihydroxyphenyl)-3,7-dihydroxy-4H-1-benzopyran-4-one), (98.0% purity); Honokiol (5,3′-Diallyl-2,4′-dihydroxybiphenyl), (99.9% purity); Tanshinone IIA (6,7,8,9-Tetrahydro-1,6,6-trimethylphenanthro[1,2-b]furan-10,11-dione), (98.6% purity); and α-Mangostin (1,3,6-Trihydroxy-7-methoxy-2,8-bis(3-methyl-2-buten-1-yl)-9H-xanthen-9-one), (97.7% purity), were all obtained from Tocris (Minneapolis, MN, USA). All compounds were dissolved in Dimethyl sulfoxide (DMSO, Sigma-Aldrich, St. Louis, MI, USA) at 10 mM concentration and stored at −20 °C until use. Working solutions of the natural compounds were prepared in MEM or DMEM at the indicated concentrations.

4.2. Virus Strains and Propagation

The Mayaro (MAYV, AVR0565, San Martín, Peru; MAYV, Guyane, Guyane, French Gianna; and MAYV, TRVL4675, Mayaro, Trinidad and Tobago) and Una (UNAV, BT-1495-3, Bocas del Toro, Panama) [71] strains, used in this study, were obtained from the World Reference Center for Emerging Viruses and Arboviruses (WRCEVA) at University of Texas Medical Branch (UTMB), USA and were kindly provided by Dr. Scott Weaver. The Chikungunya (CHIKV, Panama_256137_2014) [66] and Zika (ZIKV, 259249) strains were isolated from patient sera collected during the Chikungunya and Zika epidemics in Panama in 2014 and 2015, respectively. Viruses were propagated in Vero-E6 cells and then titrated, aliquoted, and stored as previously described [23].

4.3. Analysis of Cell Toxicity

Cytotoxicity of the natural compounds Sanguinarine chloride, (R)-Shikonin, Fisetin, Honokiol, Tanshinone IIA, and α-Mangostin was evaluated using the MTT method, as previously reported [60]. Briefly, confluent Vero-E6, HDFs, or HeLa cells grown in 96-well plates were treated with the indicated concentrations of each compound or DMSO (0.1%), as a control. After 24 or 48 h of incubation, 5 mg/mL of 3-(4,5-Dimethyl-2-thiazolyl)-2,5-diphenyltetrazolium bromide (MTT, Sigma-Aldrich, St. Louis, MI, USA) solution was applied to the cells and incubated for an additional 4 h. Formazan crystals were dissolved in a solution of 4 mM HCl and 10% Triton X-100 in isopropanol, and absorbance was determined at 570 nm using a microplate reader spectrophotometer (BioTeK, Winooski, VT, USA). Results are shown as the percentage of viable cells relative to untreated control cells.

4.4. Plaque-Forming Assay

Viral progeny production in cell supernatants from Vero-E6, HDFs, or HeLa cells infected with MAYV, UNAV, CHIKV, or ZIKV was quantified using plaque-forming assays as previously described [23]. Briefly, 10-fold serial dilutions of infected samples were used to infect confluent Vero-E6 cells grown in 6-well plates. After 1 h of virus adsorption, the inoculum was removed and the cells were overlaid with a solution of 1% agar supplemented with 2% FBS, then incubated for 3 days at 37 °C. Next, the agar was eliminated, and the cells were fixed with 4% formaldehyde solution in PBS and stained with 2% crystal violet dissolved in 30% methanol solution. Finally, the numbers of plaques were calculated, and the viral titers were reported as plaque-forming units per milliliter (PFU/mL).

4.5. Viral Infection Assay

Vero-E6, HDFs, or HeLa cells grown in 12- or 24-well plates were infected with MAYV, UNAV, CHIKV, or ZIKV at an MOI of 1. After 1 h of virus adsorption, cells were treated with the indicated doses of the natural compounds, and they were incubated for 24 h. Then, viral titers in cell supernatants were quantified using a plaque-forming assay. For the pretreatment assay, HDFs were pretreated with indicated concentrations of Honokiol or α-Mangostin for 2 h. Then, the compounds were removed, and the cells were infected with MAYV as mentioned above. After that, the cells were incubated for 24 h without the compounds and viral progeny production was quantified. For the binding, entry and post-entry assays the infection was performed at 4 °C. In the binding assay, the infection was carried out in the presence of Honokiol or α-Mangostin. Then, the compounds were eliminated, and the cells were incubated at 37 °C for 24 h, before the viral titers were quantified as previously described. For the entry assay, following 1 h of virus adsorption, cells were shifted to 37 °C, treated with the compounds for 1 h and then incubated for 24 h before evaluating the viral progeny production. Finally, in the post-entry assay, Honokiol or α-Mangostin was added to the cells after 2 h of virus adsorption, incubated for 24 h, and then viral titers were measured using a plaque-forming assay.

4.6. Immunofluorescence Assay

Vero-E6 cells grown on glass coverslips were infected with MAYV and then treated with increasing doses of Honokiol or α-Mangostin as indicated above. Following 24 h of infection, cells were fixed, blocked, and permeabilized as previously performed [60]. Next, the cells were stained with a rabbit MAYV E1 antibody, which was previously validated in our laboratory [72], followed by the application of an Alexa Flour 568 goat antirabbit secondary antibody (Invitrogen, Carlsbad, CA, USA). Lastly, coverslips were mounted on slides with Prolong Diamond Antifade Mountant with DAPI in order to stain the cell nuclei (Invitrogen, Carlsbad, CA, USA); further, microphotographs were obtained with an FV1000 Flouview confocal microscope (Olympus, Lombard, IL, USA). Moreover, the images were analyzed with ImageJ software (National Institute of Health, Bethesda, USA).

4.7. Western Blot Assay

Vero-E6, HDFs, or HeLa cells were infected with MAYV, UNAV, or CHIKV and after 1 h of virus adsorption, cells were treated with the indicated concentrations of Honokiol or α-Mangostin. Following 24 h of infection, protein extracts were obtained and separated in SDS-PAGE, transferred to nitrocellulose membranes, and blocked with a solution of 5% non-fat milk in T-TBS buffer. Next, membranes were incubated overnight at 4 °C with the following primary antibodies: rabbit polyclonal anti-E1, rabbit polyclonal anti-nsP1 (against alphaviruses)—both previously validated in the laboratory [72]—and mouse monoclonal anti-GAPDH (Cat. # VMA00046, Bio-Rad, Hercules, CA, USA). Afterward, the membranes were washed 3 times with T-TBS buffer and incubated with HRP-conjugated goat anti-rabbit (Cat. # 926-80011) or goat anti-mouse (Cat. # 926-80010) secondary antibodies (LI-COR, Lincoln, NE, USA) for 1 h at room temperature. Lastly, the membranes were incubated with SignalFireTM ECL Reagent (Cell Signaling Technology, Danvers, MA, USA) for 5 min, and the chemiluminescent signal was detected with a C-Digit scanner (LI-COR, Lincoln, NE, USA).

4.8. Gene Expression and Viral RNA Analysis by Quantitative RT-PCR

Total RNA was extracted from HeLa cells treated or untreated with Honokiol or α-Mangostin and infected with MAYV using an RNeasy kit (QIAGEN, Valencia, CA, USA) following the manufacturer’s instructions. Single-stranded cDNA was synthetized from 1 μg of RNA using a High-Capacity cDNA Reverse Transcription kit, and quantitative RT-PCR was completed using Power SYBR Green PCR Master Mix in a QuantiStudioTM 5 thermocycler (Applied Biosystems, Foster City, CA, USA) in order to evaluate the mRNA levels of the following genes using the primers listed in Table 1: IFNα, IFNβ, MxA, ISG15, OAS2, MDA-5, TNFα, and IL-1β. In addition, specific primers to detect MAYV were used. Relative mRNA expression was measured using the β-actin gene for normalization according to the ∆∆ CT method [73].

4.9. Data Analysis

All Experiments were performed at least 3 times in triplicate, unless otherwise stated. For each experiment, the mean ± standard deviation is shown. All data were analyzed using the Mann–Whitney test or one-way ANOVA test followed by Dunnett’s post hoc test. Data analysis was performed, and graphics were created, using GraphPad Prism software version 9.4.1 (GraphPad Software, San Diego, CA, USA) for Mac.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/molecules27217362/s1. Figure S1: Honokiol and α-Mangostin promote a reduction in the expression of MAYV E1 and nsP1 proteins in Vero-E6 cells and HDFs.

Author Contributions

Conceptualization, P.V.-T., D.C. and J.G.-S.; methodology, P.V.-T., D.C., M.B., P.E.G.-J., A.A.D.-A. and J.G.-S.; validation, P.V.-T., D.C. and J.G.-S.; formal analysis, P.V.-T., D.C., A.A.D.-A. and J.G.-S.; investigation, P.V.-T., D.C., M.B., P.E.G.-J., A.A.D.-A. and J.G.-S.; resources, J.G.-S.; writing—original draft preparation, J.G.-S.; writing—review and editing, P.V.-T., D.C., M.B., P.E.G.-J., A.A.D.-A. and J.G.-S.; visualization, P.V.-T., D.C. and J.G.-S.; supervision, P.V.-T., D.C. and J.G.-S.; project administration, J.G.-S.; funding acquisition, J.G.-S. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Ministerio de Economía y Finanzas de Panamá (MEF), grant number 19911.012 (J.G.-S.) and partially supported by the Sistema Nacional de Investigación (SNI) from Secretaría Nacional de Ciencia, Tecnología e Innovación de Panamá (SENACYT), grant number 23-2021 (J.G.-S.). P.V.-T. was supported by a Master of Science fellowship from SENACYT and Universidad de Panamá, grant number 014-2021.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Acknowledgments

We thank Scott Weaver (WRCEVA, UTMB, USA) for providing the Mayaro and Una virus strains and Carmen Rivas for providing the HeLa cells. We are also grateful to Rodolfo Contreras and Nicanor Obaldía for their support with the provision and use of laboratory facilities. Rita Corrales for her technical support. Finally, we express our appreciation for Jorge Ceballos and the Smithsonian Tropical Research Institute in Panama for their help and access to the confocal microscope.

Conflicts of Interest

The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to publish the results.

Sample Availability

The natural compounds tested in this study are commercially available.

References

  1. Yactayo, S.; Staples, J.E.; Millot, V.; Cibrelus, L.; Ramon-Pardo, P. Epidemiology of Chikungunya in the Americas. J. Infect. Dis. 2016, 214, S441–S445. [Google Scholar] [CrossRef] [PubMed]
  2. Gubler, D.J.; Vasilakis, N.; Musso, D. History and Emergence of Zika Virus. J. Infect. Dis. 2017, 216, S860–S867. [Google Scholar] [CrossRef] [PubMed]
  3. Ganjian, N.; Riviere-Cinnamond, A. Mayaro virus in Latin America and the Caribbean. Rev. Panam. Salud Publica 2020, 44, e14. [Google Scholar] [CrossRef] [PubMed]
  4. Aguilar-Luis, M.A.; Del Valle-Mendoza, J.; Sandoval, I.; Silva-Caso, W.; Mazulis, F.; Carrillo-Ng, H.; Tarazona-Castro, Y.; Martins-Luna, J.; Aquino-Ortega, R.; Pena-Tuesta, I.; et al. A silent public health threat: Emergence of Mayaro virus and co-infection with Dengue in Peru. BMC Res. Notes 2021, 14, 1–7. [Google Scholar] [CrossRef]
  5. Gonzalez-Escobar, G.; Churaman, C.; Rampersad, C.; Singh, R.; Nathaniel, S. Mayaro virus detection in patients from rural and urban areas in Trinidad and Tobago during the Chikungunya and Zika virus outbreaks. Pathog. Glob. Health 2021, 115, 188–195. [Google Scholar] [CrossRef]
  6. Mutricy, R.; Matheus, S.; Mosnier, E.; Martinez-Lorenzi, E.; De Laval, F.; Nacher, M.; Niemetzky, F.; Naudion, P.; Djossou, F.; Rousset, D.; et al. Mayaro virus infection in French Guiana, a cross sectional study 2003–2019. Infect. Genet. Evol. 2022, 99, 105243. [Google Scholar] [CrossRef]
  7. Carvalho, V.L.; Azevedo, R.S.S.; Carvalho, V.L.; Azevedo, R.S.; Henriques, D.F.; Cruz, A.C.R.; Vasconcelos, P.F.C.; Martins, L.C. Arbovirus outbreak in a rural region of the Brazilian Amazon. J. Clin. Virol. 2022, 150-151, 105155. [Google Scholar] [CrossRef]
  8. Acosta-Ampudia, Y.; Monsalve, D.M.; Rodriguez, Y.; Pacheco, Y.; Anaya, J.M.; Ramirez-Santana, C. Mayaro: An emerging viral threat? Emerg. Microbes Infect. 2018, 7, 1–11. [Google Scholar] [CrossRef]
  9. Aguilar-Luis, M.A.; Del Valle-Mendoza, J.; Silva-Caso, W.; Gil-Ramirez, T.; Levy-Blitchtein, S.; Bazan-Mayra, J.; Zavaleta-Gavidia, V.; Cornejo-Pacherres, D.; Palomares-Reyes, C.; Del Valle, L.J. An emerging public health threat: Mayaro virus increases its distribution in Peru. Int. J. Infect. Dis. 2020, 92, 253–258. [Google Scholar] [CrossRef]
  10. Suchowiecki, K.; Reid, S.P.; Simon, G.L.; Firestein, G.S.; Chang, A. Persistent Joint Pain Following Arthropod Virus Infections. Curr. Rheumatol. Rep. 2021, 23, 1–12. [Google Scholar] [CrossRef]
  11. Diagne, C.T.; Bengue, M.; Choumet, V.; Hamel, R.; Pompon, J.; Misse, D. Mayaro Virus Pathogenesis and Transmission Mechanisms. Pathogens 2020, 9, 738. [Google Scholar] [CrossRef]
  12. Dieme, C.; Ciota, A.T.; Kramer, L.D. Transmission potential of Mayaro virus by Aedes albopictus and Anopheles quadrimaculatus from the USA. Parasit Vectors 2020, 13, 1–6. [Google Scholar] [CrossRef] [PubMed]
  13. Pereira, T.N.; Carvalho, F.D.; De Mendonca, S.F.; Rocha, M.N.; Moreira, L.A. Vector competence of Aedes aegypti, Aedes albopictus and Culex quinquefasciatus mosquitoes for Mayaro virus. PLoS Negl. Trop. Dis. 2020, 14, e0007518. [Google Scholar] [CrossRef] [PubMed]
  14. da Silva Neves, N.A.; da Silva Ferreira, R.; Morais, D.O.; Pavon, J.A.R.; de Pinho, J.B.; Slhessarenko, R.D. Chikungunya, Zika, Mayaro and Equine Encephalitis virus detection in adult Culicinae from South Central Mato Grosso, Brazil, during the rainy season of 2018. Braz. J. Microbiol. 2022, 53, 63–70. [Google Scholar] [CrossRef] [PubMed]
  15. de Curcio, J.S.; Salem-Izacc, S.M.; Pereira Neto, L.M.; Nunes, E.B.; Anunciacao, C.E.; de Paula Silveira-Lacerda, E. Detection of Mayaro virus in Aedes aegypti mosquitoes circulating in Goiania-Goias-Brazil. Microbes Infect. 2022, 24, 104948. [Google Scholar] [CrossRef]
  16. Goh, V.S.L.; Mok, C.K.; Chu, J.J.H. Antiviral Natural Products for Arbovirus Infections. Molecules 2020, 25, 2796. [Google Scholar] [CrossRef]
  17. Thomas, E.; Stewart, L.E.; Darley, B.A.; Pham, A.M.; Esteban, I.; Panda, S.S. Plant-Based Natural Products and Extracts: Potential Source to Develop New Antiviral Drug Candidates. Molecules 2021, 26, 6197. [Google Scholar] [CrossRef]
  18. Mohan, S.; Elhassan Taha, M.M.; Makeen, H.A.; Alhazmi, H.A.; Al Bratty, M.; Sultana, S.; Ahsan, W.; Najmi, A.; Khalid, A. Bioactive Natural Antivirals: An Updated Review of the Available Plants and Isolated Molecules. Molecules 2020, 25, 4878. [Google Scholar] [CrossRef]
  19. Sagaya Jansi, R.; Khusro, A.; Agastian, P.; Alfarhan, A.; Al-Dhabi, N.A.; Arasu, M.V.; Rajagopal, R.; Barcelo, D.; Al-Tamimi, A. Emerging paradigms of viral diseases and paramount role of natural resources as antiviral agents. Sci. Total Environ. 2021, 759, 143539. [Google Scholar] [CrossRef]
  20. dos Santos, A.E.; Kuster, R.M.; Yamamoto, K.A.; Salles, T.S.; Campos, R.; de Meneses, M.D.; Soares, M.R.; Ferreira, D. Quercetin and quercetin 3-O-glycosides from Bauhinia longifolia (Bong.) Steud. show anti-Mayaro virus activity. Parasit Vectors 2014, 7, 130. [Google Scholar] [CrossRef]
  21. Ferraz, A.C.; Moraes, T.F.S.; Nizer, W.; Santos, M.D.; Totola, A.H.; Ferreira, J.M.S.; Vieira-Filho, S.A.; Rodrigues, V.G.; Duarte, L.P.; de Brito Magalhaes, C.L.; et al. Virucidal activity of proanthocyanidin against Mayaro virus. Antivir. Res. 2019, 168, 76–81. [Google Scholar] [CrossRef] [PubMed]
  22. Ferraz, A.C.; Almeida, L.T.; da Silva Caetano, C.C.; da Silva Menegatto, M.B.; Souza Lima, R.L.; de Senna, J.P.N.; de Oliveira Cardoso, J.M.; Perucci, L.O.; Talvani, A.; Geraldo de Lima, W.; et al. Hepatoprotective, antioxidant, anti-inflammatory and antiviral activities of silymarin against mayaro virus infection. Antivir. Res. 2021, 194, 105168. [Google Scholar] [CrossRef] [PubMed]
  23. Campos, D.; Navarro, S.; Llamas-Gonzalez, Y.Y.; Sugasti, M.; Gonzalez-Santamaria, J. Broad Antiviral Activity of Ginkgolic Acid against Chikungunya, Mayaro, Una, and Zika Viruses. Viruses 2020, 12, 449. [Google Scholar] [CrossRef] [PubMed]
  24. Basu, P.; Kumar, G.S. Sanguinarine and Its Role in Chronic Diseases. Adv. Exp. Med. Biol. 2016, 928, 155–172. [Google Scholar] [CrossRef] [PubMed]
  25. Boulos, J.C.; Rahama, M.; Hegazy, M.F.; Efferth, T. Shikonin derivatives for cancer prevention and therapy. Cancer Lett. 2019, 459, 248–267. [Google Scholar] [CrossRef]
  26. Xu, Q.; Yi, L.T.; Pan, Y.; Wang, X.; Li, Y.C.; Li, J.M.; Wang, C.P.; Kong, L.D. Antidepressant-like effects of the mixture of honokiol and magnolol from the barks of Magnolia officinalis in stressed rodents. Prog. Neuro-Psychopharmacol. Biol. Psychiatry 2008, 32, 715–725. [Google Scholar] [CrossRef]
  27. Guo, R.; Li, L.; Su, J.; Li, S.; Duncan, S.E.; Liu, Z.; Fan, G. Pharmacological Activity and Mechanism of Tanshinone IIA in Related Diseases. Drug Des. Dev. Ther. 2020, 14, 4735–4748. [Google Scholar] [CrossRef]
  28. Chavan, T.; Muth, A. The diverse bioactivity of alpha-mangostin and its therapeutic implications. Future Med. Chem. 2021, 13, 1679–1694. [Google Scholar] [CrossRef]
  29. Pal, H.C.; Pearlman, R.L.; Afaq, F. Fisetin and Its Role in Chronic Diseases. Adv. Exp. Med. Biol. 2016, 928, 213–244. [Google Scholar] [CrossRef]
  30. Fu, C.; Guan, G.; Wang, H. The Anticancer Effect of Sanguinarine: A Review. Curr. Pharm. Des. 2018, 24, 2760–2764. [Google Scholar] [CrossRef]
  31. Matkar, S.S.; Wrischnik, L.A.; Hellmann-Blumberg, U. Sanguinarine causes DNA damage and p53-independent cell death in human colon cancer cell lines. Chem. Biol. Interact. 2008, 172, 63–71. [Google Scholar] [CrossRef]
  32. Wang, Q.; Wang, J.; Wang, J.; Ju, X.; Zhang, H. Molecular mechanism of shikonin inhibiting tumor growth and potential application in cancer treatment. Toxicol. Res. 2021, 10, 1077–1084. [Google Scholar] [CrossRef] [PubMed]
  33. Xia, S.; Lin, H.; Liu, H.; Lu, Z.; Wang, H.; Fan, S.; Li, N. Honokiol Attenuates Sepsis-Associated Acute Kidney Injury via the Inhibition of Oxidative Stress and Inflammation. Inflammation 2019, 42, 826–834. [Google Scholar] [CrossRef] [PubMed]
  34. Munroe, M.E.; Arbiser, J.L.; Bishop, G.A. Honokiol, a natural plant product, inhibits inflammatory signals and alleviates inflammatory arthritis. J. Immunol. 2007, 179, 753–763. [Google Scholar] [CrossRef]
  35. Yin, Q.; Wu, Y.J.; Pan, S.; Wang, D.D.; Tao, M.Q.; Pei, W.Y.; Zuo, J. Activation of Cholinergic Anti-Inflammatory Pathway in Peripheral Immune Cells Involved in Therapeutic Actions of alpha-Mangostin on Collagen-Induced Arthritis in Rats. Drug Des. Dev. Ther. 2020, 14, 1983–1993. [Google Scholar] [CrossRef] [PubMed]
  36. Chen, Y.H.; Lu, M.H.; Guo, D.S.; Zhai, Y.Y.; Miao, D.; Yue, J.Y.; Yuan, C.H.; Zhao, M.M.; An, D.R. Antifungal Effect of Magnolol and Honokiol from Magnolia officinalis on Alternaria alternata Causing Tobacco Brown Spot. Molecules 2019, 24, 2140. [Google Scholar] [CrossRef]
  37. Ye, H.; Wang, Q.; Zhu, F.; Feng, G.; Yan, C.; Zhang, J. Antifungal Activity of Alpha-Mangostin against Colletotrichum gloeosporioides In Vitro and In Vivo. Molecules 2020, 25, 5335. [Google Scholar] [CrossRef]
  38. Kataoka, S.; Umemura, A.; Okuda, K.; Taketani, H.; Seko, Y.; Nishikawa, T.; Yamaguchi, K.; Moriguchi, M.; Kanbara, Y.; Arbiser, J.L.; et al. Honokiol Acts as a Potent Anti-Fibrotic Agent in the Liver through Inhibition of TGF-beta1/SMAD Signaling and Autophagy in Hepatic Stellate Cells. Int. J. Mol. Sci. 2021, 22, 13354. [Google Scholar] [CrossRef]
  39. Li, R.S.; Xu, G.H.; Cao, J.; Liu, B.; Xie, H.F.; Ishii, Y.; Zhang, C.F. Alpha-Mangostin Ameliorates Bleomycin-Induced Pulmonary Fibrosis in Mice Partly Through Activating Adenosine 5′-Monophosphate-Activated Protein Kinase. Front. Pharm. 2019, 10, 1305. [Google Scholar] [CrossRef]
  40. Sakaue, Y.; Domon, H.; Oda, M.; Takenaka, S.; Kubo, M.; Fukuyama, Y.; Okiji, T.; Terao, Y. Anti-biofilm and bactericidal effects of magnolia bark-derived magnolol and honokiol on Streptococcus mutans. Microbiol. Immunol. 2016, 60, 10–16. [Google Scholar] [CrossRef]
  41. Guo, N.; Liu, Z.; Yan, Z.; Liu, Z.; Hao, K.; Liu, C.; Wang, J. Subinhibitory concentrations of Honokiol reduce alpha-Hemolysin (Hla) secretion by Staphylococcus aureus and the Hla-induced inflammatory response by inactivating the NLRP3 inflammasome. Emerg. Microbes Infect. 2019, 8, 707–716. [Google Scholar] [CrossRef] [PubMed]
  42. Lin, S.; Zhu, C.; Li, H.; Chen, Y.; Liu, S. Potent in vitro and in vivo antimicrobial activity of semisynthetic amphiphilic gamma-mangostin derivative LS02 against Gram-positive bacteria with destructive effect on bacterial membrane. Biochim. Bioph. Acta Biomembr. 2020, 1862, 183353. [Google Scholar] [CrossRef] [PubMed]
  43. Guillermo-Lagae, R.; Santha, S.; Thomas, M.; Zoelle, E.; Stevens, J.; Kaushik, R.S.; Dwivedi, C. Antineoplastic Effects of Honokiol on Melanoma. BioMed Res. Int. 2017, 2017, 1–10. [Google Scholar] [CrossRef]
  44. Lu, C.H.; Chen, S.H.; Chang, Y.S.; Liu, Y.W.; Wu, J.Y.; Lim, Y.P.; Yu, H.I.; Lee, Y.R. Honokiol, a potential therapeutic agent, induces cell cycle arrest and program cell death in vitro and in vivo in human thyroid cancer cells. Pharm. Res. 2017, 115, 288–298. [Google Scholar] [CrossRef] [PubMed]
  45. Zhang, H.; Tan, Y.P.; Zhao, L.; Wang, L.; Fu, N.J.; Zheng, S.P.; Shen, X.F. Anticancer activity of dietary xanthone alpha-mangostin against hepatocellular carcinoma by inhibition of STAT3 signaling via stabilization of SHP1. Cell Death Dis. 2020, 11, 1–17. [Google Scholar] [CrossRef]
  46. Xu, Q.; Ma, J.; Lei, J.; Duan, W.; Sheng, L.; Chen, X.; Hu, A.; Wang, Z.; Wu, Z.; Wu, E.; et al. alpha-Mangostin suppresses the viability and epithelial-mesenchymal transition of pancreatic cancer cells by downregulating the PI3K/Akt pathway. BioMed Res. Int. 2014, 2014, 1–12. [Google Scholar] [CrossRef]
  47. Dikalov, S.; Losik, T.; Arbiser, J.L. Honokiol is a potent scavenger of superoxide and peroxyl radicals. Biochem. Pharm. 2008, 76, 589–596. [Google Scholar] [CrossRef]
  48. Pedraza-Chaverri, J.; Reyes-Fermin, L.M.; Nolasco-Amaya, E.G.; Orozco-Ibarra, M.; Medina-Campos, O.N.; Gonzalez-Cuahutencos, O.; Rivero-Cruz, I.; Mata, R. ROS scavenging capacity and neuroprotective effect of alpha-mangostin against 3-nitropropionic acid in cerebellar granule neurons. Exp. Toxicol. Pathol. 2009, 61, 491–501. [Google Scholar] [CrossRef]
  49. Jalali, A.; Firouzabadi, N.; Zarshenas, M.M. Pharmacogenetic-based management of depression: Role of traditional Persian medicine. Phytother. Res. 2021, 35, 5031–5052. [Google Scholar] [CrossRef]
  50. Hoi, C.P.; Ho, Y.P.; Baum, L.; Chow, A.H. Neuroprotective effect of honokiol and magnolol, compounds from Magnolia officinalis, on beta-amyloid-induced toxicity in PC12 cells. Phytother. Res. 2010, 24, 1538–1542. [Google Scholar] [CrossRef]
  51. Liu, J.; Tang, M.; Li, T.; Su, Z.; Zhu, Z.; Dou, C.; Liu, Y.; Pei, H.; Yang, J.; Ye, H.; et al. Honokiol Ameliorates Post-Myocardial Infarction Heart Failure Through Ucp3-Mediated Reactive Oxygen Species Inhibition. Front. Pharm. 2022, 13, 811682. [Google Scholar] [CrossRef]
  52. Tiwari, A.; Khera, R.; Rahi, S.; Mehan, S.; Makeen, H.A.; Khormi, Y.H.; Rehman, M.U.; Khan, A. Neuroprotective Effect of alpha-Mangostin in the Ameliorating Propionic Acid-Induced Experimental Model of Autism in Wistar Rats. Brain Sci. 2021, 11, 288. [Google Scholar] [CrossRef] [PubMed]
  53. Devi Sampath, P.; Vijayaraghavan, K. Cardioprotective effect of alpha-mangostin, a xanthone derivative from mangosteen on tissue defense system against isoproterenol-induced myocardial infarction in rats. J. Biochem. Mol. Toxicol. 2007, 21, 336–339. [Google Scholar] [CrossRef] [PubMed]
  54. Fang, C.Y.; Chen, S.J.; Wu, H.N.; Ping, Y.H.; Lin, C.Y.; Shiuan, D.; Chen, C.L.; Lee, Y.R.; Huang, K.J. Honokiol, a Lignan Biphenol Derived from the Magnolia Tree, Inhibits Dengue Virus Type 2 Infection. Viruses 2015, 7, 4894–4910. [Google Scholar] [CrossRef] [PubMed]
  55. Liu, S.; Li, L.; Tan, L.; Liang, X. Inhibition of Herpes Simplex Virus-1 Replication by Natural Compound Honokiol. Virol. Sin. 2019, 34, 315–323. [Google Scholar] [CrossRef] [PubMed]
  56. Kim, H.; Lim, C.Y.; Chung, M.S. Magnolia officinalis and Its Honokiol and Magnolol Constituents Inhibit Human Norovirus Surrogates. Foodborne Pathog. Dis. 2021, 18, 24–30. [Google Scholar] [CrossRef]
  57. Panda, K.; Alagarasu, K.; Patil, P.; Agrawal, M.; More, A.; Kumar, N.V.; Mainkar, P.S.; Parashar, D.; Cherian, S. In Vitro Antiviral Activity of alpha-Mangostin against Dengue Virus Serotype-2 (DENV-2). Molecules 2021, 26, 3016. [Google Scholar] [CrossRef] [PubMed]
  58. Patil, P.; Agrawal, M.; Almelkar, S.; Jeengar, M.K.; More, A.; Alagarasu, K.; Kumar, N.V.; Mainkar, P.S.; Parashar, D.; Cherian, S. In vitro and in vivo studies reveal alpha-Mangostin, a xanthonoid from Garcinia mangostana, as a promising natural antiviral compound against chikungunya virus. Virol. J. 2021, 18, 47. [Google Scholar] [CrossRef]
  59. Barroso, M.M.; Lima, C.S.; Silva-Neto, M.A.; Da Poian, A.T. Mayaro virus infection cycle relies on casein kinase 2 activity. Biochem. Bioph. Res. Commun. 2002, 296, 1334–1339. [Google Scholar] [CrossRef]
  60. Sugasti-Salazar, M.; Llamas-Gonzalez, Y.Y.; Campos, D.; Gonzalez-Santamaria, J. Inhibition of p38 Mitogen-Activated Protein Kinase Impairs Mayaro Virus Replication in Human Dermal Fibroblasts and HeLa Cells. Viruses 2021, 13, 1156. [Google Scholar] [CrossRef]
  61. Stetson, D.B.; Medzhitov, R. Type I interferons in host defense. Immunity 2006, 25, 373–381. [Google Scholar] [CrossRef]
  62. Chen, X.; Hu, Y.; Shan, L.; Yu, X.; Hao, K.; Wang, G.X. Magnolol and honokiol from Magnolia officinalis enhanced antiviral immune responses against grass carp reovirus in Ctenopharyngodon idella kidney cells. Fish Shellfish Immunol. 2017, 63, 245–254. [Google Scholar] [CrossRef] [PubMed]
  63. Zhang, Y.; Sun, Z.; Pei, J.; Luo, Q.; Zeng, X.; Li, Q.; Yang, Z.; Quan, J. Identification of alpha-Mangostin as an Agonist of Human STING. ChemMedChem 2018, 13, 2057–2064. [Google Scholar] [CrossRef] [PubMed]
  64. Zeng, Y.; Zhang, H.; Zhu, M.; Pu, Q.; Li, J.; Hu, X. beta-Hydroxyisovaleryl-Shikonin Exerts an Antitumor Effect on Pancreatic Cancer Through the PI3K/AKT Signaling Pathway. Front. Oncol. 2022, 12, 904258. [Google Scholar] [CrossRef] [PubMed]
  65. Lan, K.H.; Wang, Y.W.; Lee, W.P.; Lan, K.L.; Tseng, S.H.; Hung, L.R.; Yen, S.H.; Lin, H.C.; Lee, S.D. Multiple effects of Honokiol on the life cycle of hepatitis C virus. Liver Int. 2012, 32, 989–997. [Google Scholar] [CrossRef] [PubMed]
  66. Diaz, Y.; Carrera, J.P.; Cerezo, L.; Arauz, D.; Guerra, I.; Cisneros, J.; Armien, B.; Botello, A.M.; Arauz, A.B.; Gonzalez, V.; et al. Chikungunya virus infection: First detection of imported and autochthonous cases in Panama. Am. J. Trop. Med. Hyg. 2015, 92, 482–485. [Google Scholar] [CrossRef] [PubMed]
  67. Godugu, C.; Doddapaneni, R.; Singh, M. Honokiol nanomicellar formulation produced increased oral bioavailability and anticancer effects in triple negative breast cancer (TNBC). Colloids Surf. B Biointerfaces 2017, 153, 208–219. [Google Scholar] [CrossRef]
  68. Ben-Shabat, S.; Yarmolinsky, L.; Porat, D.; Dahan, A. Antiviral effect of phytochemicals from medicinal plants: Applications and drug delivery strategies. Drug Deliv. Transl. Res. 2020, 10, 354–367. [Google Scholar] [CrossRef]
  69. Guo, Y.; Meng, J.R.; Liu, J.Z.; Xu, T.; Zheng, Z.Y.; Jiang, Z.H.; Bai, L.P. Synthesis and Biological Evaluation of Honokiol Derivatives Bearing 3-((5-phenyl-1,3,4-oxadiazol-2-yl)methyl)oxazol-2(3H)-ones as Potential Viral Entry Inhibitors against SARS-CoV-2. Pharmaceuticals 2021, 14, 885. [Google Scholar] [CrossRef]
  70. Hu, X.; Liu, C.; Wang, K.; Zhao, L.; Qiu, Y.; Chen, H.; Hu, J.; Xu, J. Multifunctional Anti-Alzheimer’s Disease Effects of Natural Xanthone Derivatives: A Primary Structure-Activity Evaluation. Front. Chem. 2022, 10, 842208. [Google Scholar] [CrossRef]
  71. Powers, A.M.; Aguilar, P.V.; Chandler, L.J.; Brault, A.C.; Meakins, T.A.; Watts, D.; Russell, K.L.; Olson, J.; Vasconcelos, P.F.; Da Rosa, A.T.; et al. Genetic relationships among Mayaro and Una viruses suggest distinct patterns of transmission. Am. J. Trop. Med. Hyg. 2006, 75, 461–469. [Google Scholar] [CrossRef]
  72. Llamas-Gonzalez, Y.Y.; Campos, D.; Pascale, J.M.; Arbiza, J.; Gonzalez-Santamaria, J. A Functional Ubiquitin-Proteasome System is Required for Efficient Replication of New World Mayaro and Una Alphaviruses. Viruses 2019, 11, 370. [Google Scholar] [CrossRef] [PubMed]
  73. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
  74. Devhare, P.B.; Chatterjee, S.N.; Arankalle, V.A.; Lole, K.S. Analysis of antiviral response in human epithelial cells infected with hepatitis E virus. PLoS ONE 2013, 8, e63793. [Google Scholar] [CrossRef]
  75. Stevenson, N.J.; Murphy, A.G.; Bourke, N.M.; Keogh, C.A.; Hegarty, J.E.; O’Farrelly, C. Ribavirin enhances IFN-alpha signalling and MxA expression: A novel immune modulation mechanism during treatment of HCV. PLoS ONE 2011, 6, e27866. [Google Scholar] [CrossRef] [PubMed]
  76. Bektas, N.; Noetzel, E.; Veeck, J.; Press, M.F.; Kristiansen, G.; Naami, A.; Hartmann, A.; Dimmler, A.; Beckmann, M.W.; Knuchel, R.; et al. The ubiquitin-like molecule interferon-stimulated gene 15 (ISG15) is a potential prognostic marker in human breast cancer. Breast Cancer Res. 2008, 10, R58. [Google Scholar] [CrossRef]
  77. Hamel, R.; Dejarnac, O.; Wichit, S.; Ekchariyawat, P.; Neyret, A.; Luplertlop, N.; Perera-Lecoin, M.; Surasombatpattana, P.; Talignani, L.; Thomas, F.; et al. Biology of Zika Virus Infection in Human Skin Cells. J. Virol. 2015, 89, 8880–8896. [Google Scholar] [CrossRef]
  78. Chen, F.; Zhang, G.; Yu, L.; Feng, Y.; Li, X.; Zhang, Z.; Wang, Y.; Sun, D.; Pradhan, S. High-efficiency generation of induced pluripotent mesenchymal stem cells from human dermal fibroblasts using recombinant proteins. Stem Cell Res. Ther. 2016, 7, 99. [Google Scholar] [CrossRef][Green Version]
Figure 1. Chemical structures of the natural compounds tested. (A) Sanguinarine chloride; (B) (R)-Shikonin; (C) Fisetin; (D) Honokiol; (E) Tanshinone IIA; and (F) α-Mangostin.
Figure 1. Chemical structures of the natural compounds tested. (A) Sanguinarine chloride; (B) (R)-Shikonin; (C) Fisetin; (D) Honokiol; (E) Tanshinone IIA; and (F) α-Mangostin.
Molecules 27 07362 g001
Figure 2. Cytotoxicity of the natural compounds evaluated in this study. Vero-E6 cells were treated with the indicated concentrations of Sanguinarine chloride (A), (R)-Shikonin (B), Fisetin (C), Honokiol (D), Tanshinone IIA, (E) or α-Mangostin (F). After 24 or 48 h of incubation, cell viability was determined using an MTT assay. Data represent the mean ± standard deviation of two independent experiments with five replicates. Data were analyzed with a one-way ANOVA test followed by Dunnett’s post hoc test. Statistically significant differences are denoted as follows: * p < 0.05; ** p < 0.01; **** p < 0.0001; and ns: non-significant.
Figure 2. Cytotoxicity of the natural compounds evaluated in this study. Vero-E6 cells were treated with the indicated concentrations of Sanguinarine chloride (A), (R)-Shikonin (B), Fisetin (C), Honokiol (D), Tanshinone IIA, (E) or α-Mangostin (F). After 24 or 48 h of incubation, cell viability was determined using an MTT assay. Data represent the mean ± standard deviation of two independent experiments with five replicates. Data were analyzed with a one-way ANOVA test followed by Dunnett’s post hoc test. Statistically significant differences are denoted as follows: * p < 0.05; ** p < 0.01; **** p < 0.0001; and ns: non-significant.
Molecules 27 07362 g002
Figure 3. Inhibition of MAYV-induced cytopathic effects by Honokiol and α-Mangostin in Vero-E6 cells is dose-dependent. Vero-E6 cells were infected with the MAYV strain AVR0565 at a multiplicity of infection (MOI) of 1. Further, after 1 h of virus adsorption, cells were treated with Fisetin, Honokiol, Tanshinone IIA (at doses of 5 or 10 μM), or α-Mangostin (at doses of 1 or 5 μM) for 48 h. DMSO (0.1%) served as a control. Cytopathic effects were evaluated using an inverted microscope. One representative microphotograph of at least 10 different fields is shown. Scale bar: 100 μm.
Figure 3. Inhibition of MAYV-induced cytopathic effects by Honokiol and α-Mangostin in Vero-E6 cells is dose-dependent. Vero-E6 cells were infected with the MAYV strain AVR0565 at a multiplicity of infection (MOI) of 1. Further, after 1 h of virus adsorption, cells were treated with Fisetin, Honokiol, Tanshinone IIA (at doses of 5 or 10 μM), or α-Mangostin (at doses of 1 or 5 μM) for 48 h. DMSO (0.1%) served as a control. Cytopathic effects were evaluated using an inverted microscope. One representative microphotograph of at least 10 different fields is shown. Scale bar: 100 μm.
Molecules 27 07362 g003
Figure 4. Honokiol and α-Mangostin promote a reduction in MAYV progeny production. Vero-E6 cells were infected with the MAYV strain AVR0565 using an MOI of 1. After 1 h of virus adsorption, cells were treated with the indicated doses of Fisetin (A), Honokiol (B), Tanshinone IIA (C), or α-Mangostin (D); further, DMSO (0.1%) was used as a control. After 24 h of incubation, viral progeny production in cell supernatants was quantified using a plaque-forming assay. Data represent the mean ± standard deviation of three independent experiments in triplicate. (E) Vero-E6 cells grown on glass coverslips were infected with MAYV and treated with Honokiol or α-Mangostin as indicated above. After 24 h of infection, cells were stained with an MAYV E1 antibody followed by a secondary antibody Alexa-Flour 568 and nuclei were stained with DAPI. Then, the cells were analyzed with an immunofluorescence confocal microscope, with a scale bar of: 30 μm. (F) The percentage of MAYV E1 protein-positive cells was determined in at least 10 different fields. Data were analyzed using a one-way ANOVA test followed by Dunnett post hoc test. Statistically significant differences are denoted as follows: ** p < 0.01; *** p < 0.001; **** p < 0.0001; and ns: non-significant.
Figure 4. Honokiol and α-Mangostin promote a reduction in MAYV progeny production. Vero-E6 cells were infected with the MAYV strain AVR0565 using an MOI of 1. After 1 h of virus adsorption, cells were treated with the indicated doses of Fisetin (A), Honokiol (B), Tanshinone IIA (C), or α-Mangostin (D); further, DMSO (0.1%) was used as a control. After 24 h of incubation, viral progeny production in cell supernatants was quantified using a plaque-forming assay. Data represent the mean ± standard deviation of three independent experiments in triplicate. (E) Vero-E6 cells grown on glass coverslips were infected with MAYV and treated with Honokiol or α-Mangostin as indicated above. After 24 h of infection, cells were stained with an MAYV E1 antibody followed by a secondary antibody Alexa-Flour 568 and nuclei were stained with DAPI. Then, the cells were analyzed with an immunofluorescence confocal microscope, with a scale bar of: 30 μm. (F) The percentage of MAYV E1 protein-positive cells was determined in at least 10 different fields. Data were analyzed using a one-way ANOVA test followed by Dunnett post hoc test. Statistically significant differences are denoted as follows: ** p < 0.01; *** p < 0.001; **** p < 0.0001; and ns: non-significant.
Molecules 27 07362 g004
Figure 5. Honokiol and α-Mangostin reduce MAYV progeny yields, regardless of the virus strain or human cell line tested. Vero-E6 cells were infected with the MAYV Guyane (A,B) or TRVL4675 (C,D) strains and then treated with Honokiol or α-Mangostin at the indicated concentrations for 24 h. After that, viral progeny production in cell supernatants was quantified using a plaque-forming assay. HDFs (E,F) or HeLa (G,H) cells were infected with the MAYV AVR0565 strain and treated as previously indicated. Following 24 h of incubation, viral titers in cell supernatants were analyzed as previously described. Cell viability in HDFs (I,J) or HeLa cells (K,L) treated with Honokiol (10 μM) or α-Mangostin (5 μM) for 24 h was evaluated using the MTT method. Data represent the mean ± standard deviation of three independent experiments in triplicate. Data were analyzed using one-way ANOVA test followed by Dunnett post hoc test or Mann–Whitney test. Statistically significant differences are denoted as follows: * p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001; and ns: non-significant.
Figure 5. Honokiol and α-Mangostin reduce MAYV progeny yields, regardless of the virus strain or human cell line tested. Vero-E6 cells were infected with the MAYV Guyane (A,B) or TRVL4675 (C,D) strains and then treated with Honokiol or α-Mangostin at the indicated concentrations for 24 h. After that, viral progeny production in cell supernatants was quantified using a plaque-forming assay. HDFs (E,F) or HeLa (G,H) cells were infected with the MAYV AVR0565 strain and treated as previously indicated. Following 24 h of incubation, viral titers in cell supernatants were analyzed as previously described. Cell viability in HDFs (I,J) or HeLa cells (K,L) treated with Honokiol (10 μM) or α-Mangostin (5 μM) for 24 h was evaluated using the MTT method. Data represent the mean ± standard deviation of three independent experiments in triplicate. Data were analyzed using one-way ANOVA test followed by Dunnett post hoc test or Mann–Whitney test. Statistically significant differences are denoted as follows: * p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001; and ns: non-significant.
Molecules 27 07362 g005
Figure 6. α-Mangostin pretreatment reduces MAYV progeny production. HDFs were pretreated with increasing doses of Honokiol (A) or α-Mangostin (B) for 2 h; after that, the compounds were removed, and the cells were infected with the MAYV AVR0565 strain. Following 1 h of virus adsorption, a fresh medium without the compounds was added to the cells, and they were incubated for 24 h. Next, viral titers were quantified as previously described. Following this, a 1 × 105 UFP amount of the MAYV AVR0565 strain was incubated at 37 °C with the indicated concentration of Honokiol (C) or α-Mangostin (D) for 2 h. Then, the remaining virus in each experimental condition was directly calculated using plaque-forming assays. Data represent the mean ± standard deviation of three independent experiments in triplicate. Data were analyzed using one-way ANOVA test followed by Dunnett post hoc test. Statistically significant differences are denoted as follows: ** p < 0.01 and ns: non-significant.
Figure 6. α-Mangostin pretreatment reduces MAYV progeny production. HDFs were pretreated with increasing doses of Honokiol (A) or α-Mangostin (B) for 2 h; after that, the compounds were removed, and the cells were infected with the MAYV AVR0565 strain. Following 1 h of virus adsorption, a fresh medium without the compounds was added to the cells, and they were incubated for 24 h. Next, viral titers were quantified as previously described. Following this, a 1 × 105 UFP amount of the MAYV AVR0565 strain was incubated at 37 °C with the indicated concentration of Honokiol (C) or α-Mangostin (D) for 2 h. Then, the remaining virus in each experimental condition was directly calculated using plaque-forming assays. Data represent the mean ± standard deviation of three independent experiments in triplicate. Data were analyzed using one-way ANOVA test followed by Dunnett post hoc test. Statistically significant differences are denoted as follows: ** p < 0.01 and ns: non-significant.
Molecules 27 07362 g006
Figure 7. Honokiol and α-Mangostin inhibit MAYV infection at different stages of the viral life cycle. HDFs infected with MAYV AVR0565 strain at an MOI 1 and the effect of Honokiol or α-Mangostin were assessed using binding (A,B), entry (C,D), and post-entry assays (E,F). Then, viral titers were quantified using a plaque-forming assay. Data represent the mean ± standard deviation of three independent experiments in triplicate. Data were analyzed using one-way ANOVA test followed by Dunnett post hoc test. Statistically significant differences are denoted as follows: * p < 0.5; ** p < 0.01; and ns: non-significant.
Figure 7. Honokiol and α-Mangostin inhibit MAYV infection at different stages of the viral life cycle. HDFs infected with MAYV AVR0565 strain at an MOI 1 and the effect of Honokiol or α-Mangostin were assessed using binding (A,B), entry (C,D), and post-entry assays (E,F). Then, viral titers were quantified using a plaque-forming assay. Data represent the mean ± standard deviation of three independent experiments in triplicate. Data were analyzed using one-way ANOVA test followed by Dunnett post hoc test. Statistically significant differences are denoted as follows: * p < 0.5; ** p < 0.01; and ns: non-significant.
Molecules 27 07362 g007
Figure 8. Honokiol and α-Mangostin reduce the expression of MAYV E1 and nsP1 proteins and promote a decrease in viral RNA. HeLa cells (A,B) were infected with the MAYV AVR0565 strain at an MOI of 1 and then treated with Honokiol or α-Mangostin at the indicated doses. After 24 h of incubation, protein extracts were obtained, and E1 and nsP1 viral protein levels were analyzed using Western blot. GAPDH protein was used as a loading control. Please note, kDa: kilodaltons and WB: Western blot. (C) HeLa cells were treated or untreated with Honokiol (10 μM) or α-Mangostin (5 μM) and viral RNA replication was assessed using RT-PCR. Data represent the mean ± standard deviation of two independent experiments in triplicate. Data were analyzed using one-way ANOVA test followed by Dunnett post hoc test. Statistically significant differences are denoted as follows: **** p < 0.0001.
Figure 8. Honokiol and α-Mangostin reduce the expression of MAYV E1 and nsP1 proteins and promote a decrease in viral RNA. HeLa cells (A,B) were infected with the MAYV AVR0565 strain at an MOI of 1 and then treated with Honokiol or α-Mangostin at the indicated doses. After 24 h of incubation, protein extracts were obtained, and E1 and nsP1 viral protein levels were analyzed using Western blot. GAPDH protein was used as a loading control. Please note, kDa: kilodaltons and WB: Western blot. (C) HeLa cells were treated or untreated with Honokiol (10 μM) or α-Mangostin (5 μM) and viral RNA replication was assessed using RT-PCR. Data represent the mean ± standard deviation of two independent experiments in triplicate. Data were analyzed using one-way ANOVA test followed by Dunnett post hoc test. Statistically significant differences are denoted as follows: **** p < 0.0001.
Molecules 27 07362 g008
Figure 9. Honokiol and α-Mangostin impair UNAV, CHIKV, and ZIKV replication. Vero-E6 cells were infected with UNAV (AD), CHIKV (EH), or ZIKV (I,J) at an MOI of 1. After viral adsorption, increasing doses of Honokiol or α-Mangostin were added to the cells, and they were incubated for 24 h. Next, viral titers and E1 and nsP1 protein expression were evaluated using a plaque-forming assay or Western blot, respectively. GAPDH protein was used as a loading control. Please note, kDa: Kilodaltons and WB: Western blot. Data represent the mean ± standard deviation of three independent experiments in triplicate. Data were analyzed using one-way ANOVA test followed by Dunnett post hoc test. Statistically significant differences are denoted as follows: * p < 0.5; ** p < 0.01; *** p < 0.001; **** p < 0.0001; and ns: non-significant.
Figure 9. Honokiol and α-Mangostin impair UNAV, CHIKV, and ZIKV replication. Vero-E6 cells were infected with UNAV (AD), CHIKV (EH), or ZIKV (I,J) at an MOI of 1. After viral adsorption, increasing doses of Honokiol or α-Mangostin were added to the cells, and they were incubated for 24 h. Next, viral titers and E1 and nsP1 protein expression were evaluated using a plaque-forming assay or Western blot, respectively. GAPDH protein was used as a loading control. Please note, kDa: Kilodaltons and WB: Western blot. Data represent the mean ± standard deviation of three independent experiments in triplicate. Data were analyzed using one-way ANOVA test followed by Dunnett post hoc test. Statistically significant differences are denoted as follows: * p < 0.5; ** p < 0.01; *** p < 0.001; **** p < 0.0001; and ns: non-significant.
Molecules 27 07362 g009
Figure 10. Honokiol and α-Mangostin treatment stimulate the expression of type I IFN and specific IFN-stimulated genes. HeLa cells were treated with Honokiol (10 μM) or α-Mangostin (5 μM) for 24 h. Then, total RNA was extracted and the levels of the indicated immune response genes (AH) were assessed using quantitative RT-PCR. Relative mRNA expression in Honokiol- or α-Mangostin-treated cells was represented as fold changes as compared to DMSO-treated cells. Data represent the mean ± standard deviation of three independent experiments in triplicate. Data were analyzed using one-way ANOVA test followed by Dunnett post hoc test. Statistically significant differences are denoted as follows: ** p < 0.01; *** p < 0.001; **** p < 0.0001; and ns: non-significant.
Figure 10. Honokiol and α-Mangostin treatment stimulate the expression of type I IFN and specific IFN-stimulated genes. HeLa cells were treated with Honokiol (10 μM) or α-Mangostin (5 μM) for 24 h. Then, total RNA was extracted and the levels of the indicated immune response genes (AH) were assessed using quantitative RT-PCR. Relative mRNA expression in Honokiol- or α-Mangostin-treated cells was represented as fold changes as compared to DMSO-treated cells. Data represent the mean ± standard deviation of three independent experiments in triplicate. Data were analyzed using one-way ANOVA test followed by Dunnett post hoc test. Statistically significant differences are denoted as follows: ** p < 0.01; *** p < 0.001; **** p < 0.0001; and ns: non-significant.
Molecules 27 07362 g010
Table 1. Primers used in this study.
Table 1. Primers used in this study.
GenePrimer Sequences (5′-3′)References
IFNForward: GCCTCGCCCTTTGCTTTACT[74]
Reverse: CTGTGGGTCTCAGGGAGATCA
IFNβForward: ATGACCAACAAGTGTCTCCTCC[74]
Reverse: GCTCATGGAAAGAGCTGTAGTG
MxAForward: GGTGGTGGTCCCCAGTAATG[75]
Reverse: ACCACGTCCACAACCTTGTCT
ISG15Forward: GAGAGGCAGCGAACTCATCT[76]
Reverse: CTTCAGCTCTGACACCGACA
OAS2Forward: AAACCAGGCCTGTGATCTTG[77]
Reverse: GGGCTATTTCCAGACAACGC
MDA-5Forward: GCCATTGCAGATGCAACCAG[77]
Reverse: TTGCGATTTCCTTCTTTTGCAG
TNFForward: CAGAGGGAAGAGTTCCCCAGGGACC[74]
Reverse: CCTTGGTCTGGTAGGAGACGG
IL-1βForward: AACCTCTTCGAGGCACAAGG[77]
Reverse: GTCCTGGAAGGAGCACTTCAT
β-actinForward: AGAGCTACGAGCTGCCTGAC[78]
Reverse: AGCACTGTGTTGGCGTACAG
MAYVForward: CATGGCCTACCTGTGGGATAATA
Reverse: GCACTCCCGACGCTCACTG
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Valdés-Torres, P.; Campos, D.; Bhakta, M.; Galán-Jurado, P.E.; Durant-Archibold, A.A.; González-Santamaría, J. Honokiol and Alpha-Mangostin Inhibit Mayaro Virus Replication through Different Mechanisms. Molecules 2022, 27, 7362. https://doi.org/10.3390/molecules27217362

AMA Style

Valdés-Torres P, Campos D, Bhakta M, Galán-Jurado PE, Durant-Archibold AA, González-Santamaría J. Honokiol and Alpha-Mangostin Inhibit Mayaro Virus Replication through Different Mechanisms. Molecules. 2022; 27(21):7362. https://doi.org/10.3390/molecules27217362

Chicago/Turabian Style

Valdés-Torres, Patricia, Dalkiria Campos, Madhvi Bhakta, Paola Elaine Galán-Jurado, Armando A. Durant-Archibold, and José González-Santamaría. 2022. "Honokiol and Alpha-Mangostin Inhibit Mayaro Virus Replication through Different Mechanisms" Molecules 27, no. 21: 7362. https://doi.org/10.3390/molecules27217362

APA Style

Valdés-Torres, P., Campos, D., Bhakta, M., Galán-Jurado, P. E., Durant-Archibold, A. A., & González-Santamaría, J. (2022). Honokiol and Alpha-Mangostin Inhibit Mayaro Virus Replication through Different Mechanisms. Molecules, 27(21), 7362. https://doi.org/10.3390/molecules27217362

Article Metrics

Back to TopTop