Cold Atmospheric Plasma Suppressed MM In Vivo Engraftment by Increasing ROS and Inhibiting the Notch Signaling Pathway
Abstract
1. Introduction
2. Results
2.1. Plasma-Inhibited MM-Cell-Colony-Formation Ability In Vitro and Engraftment In Vivo
2.2. Plasma Suppressed MM-Cell-Colony-Formation Abilities by Increasing ROS
2.3. Physicochemical Properties of Ar Plasma
2.4. Plasma Suppressed MM-Cell-Colony-Formation Abilities by Inhibiting the Notch Pathway
3. Discussion
4. Materials and Methods
4.1. Plasma Jet Device
4.2. Cell Culture and Treatment and the Cell Viability Assay
4.3. Colony Forming Cell (CFC) Assay
4.4. Animal Study
4.5. Giemsa Staining Detect
4.6. Detection of ROS Levels
4.7. Real-Time PCR Assay
4.8. Cancer Stem Cell PCR Array
4.9. Measurement of Physicochemical Properties
4.10. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Kazandjian, D. Multiple myeloma epidemiology and survival: A unique malignancy. Semin. Oncol. 2016, 43, 676–681. [Google Scholar] [CrossRef] [PubMed]
- Kyle, R.A.; Rajkumar, S.V. Multiple myeloma. Blood 2008, 111, 2962–2972. [Google Scholar] [CrossRef] [PubMed]
- Hideshima, T.; Mitsiades, C.; Tonon, G.; Richardson, P.G.; Anderson, K.C. Understanding multiple myeloma pathogenesis in the bone marrow to identify new therapeutic targets. Nat. Rev. Cancer 2007, 7, 585–598. [Google Scholar] [CrossRef] [PubMed]
- Kumar, S.K.; Rajkumar, V.; Kyle, R.A.; van Duin, M.; Sonneveld, P.; Mateos, M.V.; Gay, F.; Anderson, K.C. Multiple myeloma. Nat. Rev. Dis. Primers 2017, 3, 17046. [Google Scholar] [CrossRef] [PubMed]
- Minnie, S.A.; Hill, G.R. Immunotherapy of multiple myeloma. J. Clin. Investig. 2020, 130, 1565–1575. [Google Scholar] [CrossRef]
- Gandolfi, S.; Laubach, J.P.; Hideshima, T.; Chauhan, D.; Anderson, K.C.; Richardson, P.G. The proteasome and proteasome inhibitors in multiple myeloma. Cancer Metastasis Rev. 2017, 36, 561–584. [Google Scholar] [CrossRef]
- Al Hamed, R.; Bazarbachi, A.H.; Malard, F.; Harousseau, J.L.; Mohty, M. Current status of autologous stem cell transplantation for multiple myeloma. Blood Cancer J. 2019, 9, 44. [Google Scholar] [CrossRef]
- Gentile, M.; Morabito, F.; Martino, M.; Vigna, E.; Martino, E.A.; Mendicino, F.; Martinelli, G.; Cerchione, C. Chemotherapy-based regimens in multiple myeloma in 2020. Panminerva Med. 2021, 63, 7–12. [Google Scholar] [CrossRef]
- Tsang, R.W.; Campbell, B.A.; Goda, J.S.; Kelsey, C.R.; Kirova, Y.M.; Parikh, R.R.; Ng, A.K.; Ricardi, U.; Suh, C.O.; Mauch, P.M.; et al. Radiation Therapy for Solitary Plasmacytoma and Multiple Myeloma: Guidelines From the International Lymphoma Radiation Oncology Group. Int. J. Radiat. Oncol. Biol. Phys. 2018, 101, 794–808. [Google Scholar] [CrossRef]
- Cowan, A.J.; Green, D.J.; Kwok, M.; Lee, S.; Coffey, D.G.; Holmberg, L.A.; Tuazon, S.; Gopal, A.K.; Libby, E.N. Diagnosis and Management of Multiple Myeloma: A Review. JAMA 2022, 327, 464–477. [Google Scholar] [CrossRef]
- Nassar, D.; Blanpain, C. Cancer Stem Cells: Basic Concepts and Therapeutic Implications. Annu. Rev. Pathol. 2016, 11, 47–76. [Google Scholar] [CrossRef]
- Batlle, E.; Clevers, H. Cancer stem cells revisited. Nat. Med. 2017, 23, 1124–1134. [Google Scholar] [CrossRef] [PubMed]
- Peiris-Pages, M.; Martinez-Outschoorn, U.E.; Pestell, R.G.; Sotgia, F.; Lisanti, M.P. Cancer stem cell metabolism. Breast Cancer Res. BCR 2016, 18, 55. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.; Gong, Y.; Liang, L.; Xiao, L.; Yi, H.; Ye, M.; Roy, M.; Xia, J.; Zhou, W.; Yang, C.; et al. Lycorine targets multiple myeloma stem cell-like cells by inhibition of Wnt/beta-catenin pathway. Br. J. Haematol. 2020, 189, 1151–1164. [Google Scholar] [CrossRef] [PubMed]
- Balamurugan, K. HIF-1 at the crossroads of hypoxia, inflammation, and cancer. Int. J. Cancer 2016, 138, 1058–1066. [Google Scholar] [CrossRef] [PubMed]
- Diehn, M.; Cho, R.W.; Lobo, N.A.; Kalisky, T.; Dorie, M.J.; Kulp, A.N.; Qian, D.; Lam, J.S.; Ailles, L.E.; Wong, M.; et al. Association of reactive oxygen species levels and radioresistance in cancer stem cells. Nature 2009, 458, 780–783. [Google Scholar] [CrossRef]
- Ghosh, N.; Matsui, W. Cancer stem cells in multiple myeloma. Cancer Lett. 2009, 277, 1–7. [Google Scholar] [CrossRef]
- Sabol, H.M.; Delgado-Calle, J. The multifunctional role of Notch signaling in multiple myeloma. J. Cancer Metastasis Treat 2021, 7. [Google Scholar] [CrossRef]
- Keidar, M. Plasma for cancer treatment. Plasma Sources Sci. Technol. 2015, 24, 33001. [Google Scholar] [CrossRef]
- Yan, D.; Sherman, J.H.; Keidar, M. Cold atmospheric plasma, a novel promising anti-cancer treatment modality. Oncotarget 2017, 8, 15977–15995. [Google Scholar] [CrossRef]
- Dai, X.; Bazaka, K.; Thompson, E.W.; Ostrikov, K.K. Cold Atmospheric Plasma: A Promising Controller of Cancer Cell States. Cancers 2020, 12, 3360. [Google Scholar] [CrossRef] [PubMed]
- Faramarzi, F.; Zafari, P.; Alimohammadi, M.; Moonesi, M.; Rafiei, A.; Bekeschus, S. Cold Physical Plasma in Cancer Therapy: Mechanisms, Signaling, and Immunity. Oxidative Med. Cell. Longev. 2021, 2021, 9916796. [Google Scholar] [CrossRef] [PubMed]
- Hirst, A.M.; Frame, F.M.; Arya, M.; Maitland, N.J.; O’Connell, D. Low temperature plasmas as emerging cancer therapeutics: The state of play and thoughts for the future. Tumor Biol. 2016, 37, 7021–7031. [Google Scholar] [CrossRef] [PubMed]
- Xu, D.; Xu, Y.; Cui, Q.; Liu, D.; Liu, Z.; Wang, X.; Yang, Y.; Feng, M.; Liang, R.; Chen, H.; et al. Cold atmospheric plasma as a potential tool for multiple myeloma treatment. Oncotarget 2018, 9, 18002–18017. [Google Scholar] [CrossRef]
- Pang, L.; Ding, J.; Ge, Y.; Fan, J.; Fan, S.K. Single-Cell-Derived Tumor-Sphere Formation and Drug-Resistance Assay Using an Integrated Microfluidics. Anal. Chem. 2019, 91, 8318–8325. [Google Scholar] [CrossRef] [PubMed]
- Xu, Y.H.; Sun, L.G.; Sun, C.; Bai, O.; Liang, T.T.; Ma, K.W. Anterior mediastinum invasion by multiple myeloma: A case report. Oncol. Lett. 2017, 13, 2637–2641. [Google Scholar] [CrossRef][Green Version]
- Olson, D.L.; Burkly, L.C.; Leone, D.R.; Dolinski, B.M.; Lobb, R.R. Anti-alpha4 integrin monoclonal antibody inhibits multiple myeloma growth in a murine model. Mol. Cancer Ther. 2005, 4, 91–99. [Google Scholar] [CrossRef]
- Zhang, Z.Y.; Yang, J.; Wu, Y.R. Transcriptional Regulation of Zein Gene Expression in Maize through the Additive and Synergistic Action of opaque2, Prolamine-Box Binding Factor, and O2 Heterodimerizing Proteins. Plant Cell 2015, 27, 1162–1172. [Google Scholar] [CrossRef]
- Deng, X.T.; Shi, J.J.; Kong, M.G. Protein destruction by a helium atmospheric pressure glow discharge: Capability and mechanisms. J. Appl. Phys. 2007, 101, 074701. [Google Scholar] [CrossRef]
- Girard, P.M.; Arbabian, A.; Fleury, M.; Bauville, G.; Puech, V.; Dutreix, M.; Sousa, J.S. Synergistic Effect of H2O2 and NO2 in Cell Death Induced by Cold Atmospheric He Plasma. Sci. Rep. 2016, 6, 29098. [Google Scholar] [CrossRef]
- Clara, J.A.; Monge, C.; Yang, Y.; Takebe, N. Targeting signalling pathways and the immune microenvironment of cancer stem cells—A clinical update. Nat. Rev. Clin. Oncol. 2020, 17, 204–232. [Google Scholar] [CrossRef]
- Liou, G.Y.; Storz, P. Reactive oxygen species in cancer. Free Radic. Res. 2010, 44, 479–496. [Google Scholar] [CrossRef] [PubMed]
- Sabharwal, S.S.; Schumacker, P.T. Mitochondrial ROS in cancer: Initiators, amplifiers or an Achilles’ heel? Nat. Rev. Cancer 2014, 14, 709–721. [Google Scholar] [CrossRef] [PubMed]
- Moloney, J.N.; Cotter, T.G. ROS signalling in the biology of cancer. Semin. Cell Dev. Biol. 2018, 80, 50–64. [Google Scholar] [CrossRef] [PubMed]
- Li, B.; Zhou, P.; Xu, K.; Chen, T.; Jiao, J.; Wei, H.; Yang, X.; Xu, W.; Wan, W.; Xiao, J. Metformin induces cell cycle arrest, apoptosis and autophagy through ROS/JNK signaling pathway in human osteosarcoma. Int. J. Biol. Sci. 2020, 16, 74–84. [Google Scholar] [CrossRef]
- Kang, R.; Li, R.; Dai, P.; Li, Z.; Li, Y.; Li, C. Deoxynivalenol induced apoptosis and inflammation of IPEC-J2 cells by promoting ROS production. Environ. Pollut. 2019, 251, 689–698. [Google Scholar] [CrossRef]
- Cordani, M.; Donadelli, M.; Strippoli, R.; Bazhin, A.V.; Sanchez-Alvarez, M. Interplay between ROS and Autophagy in Cancer and Aging: From Molecular Mechanisms to Novel Therapeutic Approaches. Oxidative Med. Cell. Longev. 2019, 2019, 8794612. [Google Scholar] [CrossRef]
- Dickinson, B.C.; Chang, C.J. Chemistry and biology of reactive oxygen species in signaling or stress responses. Nat. Chem. Biol. 2011, 7, 504–511. [Google Scholar] [CrossRef]
- Winterbourn, C.C.; Hampton, M.B. Thiol chemistry and specificity in redox signaling. Free Radic. Biol. Med. 2008, 45, 549–561. [Google Scholar] [CrossRef]
- Liu, K.; Ren, W.; Ran, C.F.; Zhou, R.S.; Tang, W.B.; Zhou, R.W.; Yang, Z.H.; Kostya, O. Long-lived species in plasma-activated water generated by an AC multi-needle-to-water discharge: Effects of gas flow on chemical reactions. J. Phys. D Appl. Phys. 2021, 54, 65201. [Google Scholar] [CrossRef]
- Liu, Z.C.; Liu, D.X.; Chen, C.; Li, D.; Yang, A.J.; Rong, M.Z.; Chen, H.L.; Kong, M.G. Physicochemical processes in the indirect interaction between surface air plasma and deionized water. J. Phys. D Appl. Phys. 2015, 48, 495201. [Google Scholar] [CrossRef]
- Xu, D.; Luo, X.; Xu, Y.; Cui, Q.; Yang, Y.; Liu, D.; Chen, H.; Kong, M.G. The effects of cold atmospheric plasma on cell adhesion, differentiation, migration, apoptosis and drug sensitivity of multiple myeloma. Biochem. Biophys. Res. Commun. 2016, 473, 1125–1132. [Google Scholar] [CrossRef]
- Rafiei, A.; Sohbatzadeh, F.; Hadavi, S.; Bekeschus, S.; Alimohammadi, M.; Valadan, R. Inhibition of murine melanoma tumor growth in vitro and in vivo using an argon-based plasma jet. Clin. Plasma Med. 2020, 19–20, 100102. [Google Scholar] [CrossRef]
- Luo, M.; Shang, L.; Brooks, M.D.; Jiagge, E.; Zhu, Y.; Buschhaus, J.M.; Conley, S.; Fath, M.A.; Davis, A.; Gheordunescu, E.; et al. Targeting Breast Cancer Stem Cell State Equilibrium through Modulation of Redox Signaling. Cell Metab. 2018, 28, 69–86.e6. [Google Scholar] [CrossRef]
- Choi, H.J.; Jhe, Y.L.; Kim, J.; Lim, J.Y.; Lee, J.E.; Shin, M.K.; Cheong, J.H. FoxM1-dependent and fatty acid oxidation-mediated ROS modulation is a cell-intrinsic drug resistance mechanism in cancer stem-like cells. Redox Biol. 2020, 36, 101589. [Google Scholar] [CrossRef] [PubMed]
- Hou, G.X.; Liu, P.P.; Zhang, S.; Yang, M.; Liao, J.; Yang, J.; Hu, Y.; Jiang, W.Q.; Wen, S.; Huang, P. Elimination of stem-like cancer cell side-population by auranofin through modulation of ROS and glycolysis. Cell Death Dis. 2018, 9, 89. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Tang, T.; Lee, H.J.; Song, K. Selective Anti-Cancer Effects of Plasma-Activated Medium and Its High Efficacy with Cisplatin on Hepatocellular Carcinoma with Cancer Stem Cell Characteristics. Int. J. Mol. Sci. 2021, 22, 3956. [Google Scholar] [CrossRef]
- Venkatesh, V.; Nataraj, R.; Thangaraj, G.S.; Karthikeyan, M.; Gnanasekaran, A.; Kaginelli, S.B.; Kuppanna, G.; Kallappa, C.G.; Basalingappa, K.M. Targeting Notch signalling pathway of cancer stem cells. Stem Cell Investig. 2018, 5, 5. [Google Scholar] [CrossRef]
- Sabol, H.M.; Ferrari, A.J.; Adhikari, M.; Amorim, T.; McAndrews, K.; Anderson, J.; Vigolo, M.; Lehal, R.; Cregor, M.; Khan, S.; et al. Targeting Notch Inhibitors to the Myeloma Bone Marrow Niche Decreases Tumor Growth and Bone Destruction without Gut Toxicity. Cancer Res. 2021, 81, 5102–5114. [Google Scholar] [CrossRef]
- Colombo, M.; Galletti, S.; Garavelli, S.; Platonova, N.; Paoli, A.; Basile, A.; Taiana, E.; Neri, A.; Chiaramonte, R. Notch signaling deregulation in multiple myeloma: A rational molecular target. Oncotarget 2015, 6, 26826–26840. [Google Scholar] [CrossRef]
- Paul, M.K.; Bisht, B.; Darmawan, D.O.; Chiou, R.; Ha, V.L.; Wallace, W.D.; Chon, A.T.; Hegab, A.E.; Grogan, T.; Elashoff, D.A.; et al. Dynamic changes in intracellular ROS levels regulate airway basal stem cell homeostasis through Nrf2-dependent Notch signaling. Cell Stem Cell 2014, 15, 199–214. [Google Scholar] [CrossRef] [PubMed]
- Pang, B.L.; Liu, Z.J.; Zhang, H.Y.; Wang, S.T.; Gao, Y.T.; Xu, D.H.; Liu, D.X.; Kong, M.G. Investigation of the chemical characteristics and anticancer effect of plasma-activated water: The effect of liquid temperature. Plasma Process. Polym. 2022, 19, 2100079. [Google Scholar] [CrossRef]
- Liu, X.; Quan, N. Immune Cell Isolation from Mouse Femur Bone Marrow. Bio. Protoc. 2015, 5, e1631. [Google Scholar] [CrossRef] [PubMed]
- Yan, X.; Li, P.; Zhan, Y.; Qi, M.; Liu, J.; An, Z.; Yang, W.; Xiao, H.; Wu, H.; Qi, Y.; et al. Dihydroartemisinin suppresses STAT3 signaling and Mcl-1 and Survivin expression to potentiate ABT-263-induced apoptosis in Non-small Cell Lung Cancer cells harboring EGFR or RAS mutation. Biochem. Pharm. 2018, 150, 72–85. [Google Scholar] [CrossRef]
Gene | Forward Sequence | Reverse Sequence |
---|---|---|
Hes1 | AGGCTGGAGAGGCGGCTAAG | TGGAAGGTGACACTGCGTTGG |
Hes5 | CCGGTGGTGGAGAAGATGCG | GCGACGAAGGCTTTGCTGTG |
Hey1 | GGATCACCTGAAAATGCTGCATAC | CCGAAATCCCAAACTCCGATAG |
Hey2 | GTGCGGCTTGTGTCTCATCTC | CTGCTGCTGCTGCGTTTG |
HeyL | AGCCAGGAAGAAACGCAGAGG | GCTGTTGAGGTGGGAGAGAAGG |
Notch1 | GCCGCCTTTGTGCTTCTGTTC | GTCCTCCTCTTCCTCGCTGTTG |
Notch2 | CTCCTTGCTGTTGCTGTTGTCATC | CACATCCACCTCCTGCTCTGC |
Dll1 | GCCTGCCTGGATGTGATGAG | CTGGATAGCGGATACACTCGT |
ActinB | GCCTCGCTGTCCACCTTCC | TGCTGTCACCTTCACCGTTCC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Qi, M.; Zhao, X.; Fan, R.; Zhang, X.; Peng, S.; Xu, D.; Yang, Y. Cold Atmospheric Plasma Suppressed MM In Vivo Engraftment by Increasing ROS and Inhibiting the Notch Signaling Pathway. Molecules 2022, 27, 5832. https://doi.org/10.3390/molecules27185832
Qi M, Zhao X, Fan R, Zhang X, Peng S, Xu D, Yang Y. Cold Atmospheric Plasma Suppressed MM In Vivo Engraftment by Increasing ROS and Inhibiting the Notch Signaling Pathway. Molecules. 2022; 27(18):5832. https://doi.org/10.3390/molecules27185832
Chicago/Turabian StyleQi, Miao, Xinyi Zhao, Runze Fan, Xinying Zhang, Sansan Peng, Dehui Xu, and Yanjie Yang. 2022. "Cold Atmospheric Plasma Suppressed MM In Vivo Engraftment by Increasing ROS and Inhibiting the Notch Signaling Pathway" Molecules 27, no. 18: 5832. https://doi.org/10.3390/molecules27185832
APA StyleQi, M., Zhao, X., Fan, R., Zhang, X., Peng, S., Xu, D., & Yang, Y. (2022). Cold Atmospheric Plasma Suppressed MM In Vivo Engraftment by Increasing ROS and Inhibiting the Notch Signaling Pathway. Molecules, 27(18), 5832. https://doi.org/10.3390/molecules27185832