Insights into Aptamer–Drug Delivery Systems against Prostate Cancer
Abstract
1. Introduction
2. Aptamer–Drug Delivery Systems against Prostate Cancer
2.1. Aptamer–Doxorubicin Drug Delivery Systems
2.2. Aptamer–Cisplatin Delivery Systems
2.3. Aptamer–Curcumin Delivery Systems
2.4. Aptamer–Docetaxel Delivery Systems
2.5. Aptamer–Monomethyl Auristatin Conjugates
2.6. Aptamer–Paclitaxel Delivery Systems
2.7. Aptamer–Poly(amidoamine) Conjugates
2.8. Aptamer–Thymoquinone Delivery Systems
2.9. Aptamer–TPEN Delivery Systems
3. Perspective
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
| ADCs | Antibody-drug conjugates |
| ADDP-Ad5 | A10-3.2(Dox)/DUP-1-PEG-Ad5 |
| ApDCs | Aptamer–drug conjugates |
| APM | Aptamer binding liposome |
| Apt | Aptamer |
| Apt·dONT-DEN | Double strands DNA-A9-(CGA)7 aptamer and a dendrimer |
| ApTDCs | Aptamer highly toxic drug conjugates |
| Apt-MCS | Aptamer with linked to Myristilated Chitosan nanogels |
| A9-(CGA)7 | An extended version of A9 aptamer |
| CAP | Calcium phosphate |
| CRPC | Castration resistant prostate cancer |
| CSCs | Cancer stem cells |
| Cur | Curcumin |
| Cur-LPs | Curcumin liposomes |
| DAC-D | DAC with Dox |
| Dox | Doxorubicin |
| Dox@ Apt·dONT-DEN | Dox combined with double strands DNA-A9-(CGA)7 aptamer and a dendrimer |
| Dtx | Docetaxel |
| Ecad01 | DNA aptamer-targeting E-cadherin |
| EpDT3 | 19-nt RNA aptamer |
| EPR | Enhancing permeability and retention |
| FDA | Food and Drug Administration |
| GLI-1 | Glioma-associated oncogene homolog 1 |
| Hh | Hedgehog |
| mCRPC | Metastatic castration resistant prostate cancer |
| MCS | Myristilated chitosan nanogels |
| MDR | Multi-drug resistance |
| MMAE | Monomethyl auristatin E |
| MMAF | Monomethyl auristatin F |
| MTA | Microtubule-targeting agent |
| NC | Nanoconjugates |
| PAMAM | Poly(amidoamine) |
| PBM-NPs | Planetary ball-milled nanoparticles |
| PCA | Prostate cancer |
| PEG | Poly(ethylene glycol) |
| PLA | Polylactideepoly |
| PLGA | Poly(D, L-lactic-co-glycolic acid) |
| pMEG3 | Plasmid-encoding lncRNA MEG3 |
| PSMA | Prostate specific membrane antigen |
| Ptx | Paclitaxel |
| QD | Quantum dot |
| SELEX | Systematic evolution of ligands by exponential enrichment |
| SHH | Sonic hedgehog |
| SPION | Superparamagnetic iron oxide nanoparticles |
| STEP1 | Six-transmembrane epithelial antigen of the prostate 1 |
| TCL-SPION | Thermally cross-linked superparamagnetic iron oxide nanopaticles |
| TPEN | N, N, N′, N′-tetrakis (2-pyridylmethyl)-ethylenediamine |
| TQ | Thymoquinone |
References
- Porcacchia, A.S.; Camara, D.A.D.; Andersen, M.L.; Tufik, S. Sleep disorders and prostate cancer prognosis: Biology, epidemiology, and association with cancer development risk. Eur. J. Cancer Prev. 2022, 31, 178–189. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Damber, J.E. Endocrine therapy for prostate cancer. Acta Oncol. 2005, 44, 605–609. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Su, S.; Kang, P.M. Recent Advances in Nanocarrier-Assisted Therapeutics Delivery Systems. Pharmaceutics 2020, 12, 837. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sheyi, R.; de la Torre, B.G.; Albericio, F. Linkers: An Assurance for Controlled Delivery of Antibody-Drug Conjugate. Pharmaceutics 2022, 14, 396. [Google Scholar] [CrossRef] [Scilit]
- Zhang, X.; Huang, A.C.; Chen, F.; Chen, H.; Li, L.; Kong, N.; Luo, W.; Fang, J. Novel development strategies and challenges for anti-Her2 antibody-drug conjugates. Antib. Ther. 2022, 5, 18–29. [Google Scholar] [CrossRef] [Scilit]
- Hyvakka, A.; Virtanen, V.; Kemppainen, J.; Gronroos, T.J.; Minn, H.; Sundvall, M. More Than Meets the Eye: Scientific Rationale behind Molecular Imaging and Therapeutic Targeting of Prostate-Specific Membrane Antigen (PSMA) in Metastatic Prostate Cancer and Beyond. Cancers 2021, 13, 2244. [Google Scholar] [CrossRef] [Scilit]
- Lasek, W.; Zapala, L. Therapeutic metastatic prostate cancer vaccines: Lessons learnt from urologic oncology. Cent. Eur. J. Urol. 2021, 74, 300–307. [Google Scholar]
- He, F.; Wen, N.; Xiao, D.; Yan, J.; Xiong, H.; Cai, S.; Liu, Z.; Liu, Y. Aptamer-Based Targeted Drug Delivery Systems: Current Potential and Challenges. Curr. Med. Chem. 2020, 27, 2189–2219. [Google Scholar] [CrossRef] [Scilit]
- Ptacek, J.; Zhang, D.; Qiu, L.; Kruspe, S.; Motlova, L.; Kolenko, P.; Novakova, Z.; Shubham, S.; Havlinova, B.; Baranova, P.; et al. Structural basis of prostate-specific membrane antigen recognition by the A9g RNA aptamer. Nucleic Acids Res. 2020, 48, 11130–11145. [Google Scholar] [CrossRef] [Scilit]
- He, X.-Y.; Ren, X.-H.; Peng, Y.; Zhang, J.-P.; Ai, S.-L.; Liu, B.-Y.; Xu, C.; Cheng, S.-X. Aptamer/Peptide-Functionalized Genome-Editing System for Effective Immune Restoration through Reversal of PD-L1-Mediated Cancer Immunosuppression. Adv. Mater. 2020, 32, e2000208. [Google Scholar] [CrossRef] [Scilit]
- Keefe, A.D.; Pai, S.; Ellington, A. Aptamers as therapeutics. Nat. Rev. Drug Discov. 2010, 9, 537–550. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Di Primo, C.; Dausse, E.; Toulme, J.-J. Surface plasmon resonance investigation of RNA aptamer-RNA ligand interactions. Methods Mol. Biol. 2011, 764, 279–300. [Google Scholar] [PubMed]
- Dunn, M.R.; Jimenez, R.M.; Chaput, J.C. Analysis of aptamer discovery and technology. Nat. Rev. Chem. 2017, 1, 0076. [Google Scholar] [CrossRef] [Scilit]
- Li, L.; Xu, S.; Yan, H.; Li, X.; Yazd, H.S.; Li, X.; Huang, T.; Cui, C.; Jiang, J.; Tan, W. Nucleic Acid Aptamers for Molecular Diagnostics and Therapeutics: Advances and Perspectives. Angew. Chem. Int. Ed. 2021, 60, 2221–2231. [Google Scholar] [CrossRef] [Scilit]
- Antipova, O.M.; Zavyalova, E.G.; Golovin, A.V.; Pavlova, G.V.; Kopylov, A.M.; Reshetnikov, R.V. Advances in the Application of Modified Nucleotides in SELEX Technology. Biochem. Mosc. 2018, 83, 1161–1172. [Google Scholar] [CrossRef] [Scilit]
- Kaur, H. Recent developments in cell-SELEX technology for aptamer selection. Biochim. Biophys. Acta Gen. Subj. 2018, 1862, 2323–2329. [Google Scholar] [CrossRef] [Scilit]
- Bayat, P.; Nosrati, R.; Alibolandi, M.; Rafatpanah, H.; Abnous, K.; Khedri, M.; Ramezani, M. SELEX methods on the road to protein targeting with nucleic acid aptamers. Biochimie 2018, 154, 132–155. [Google Scholar] [CrossRef] [Scilit]
- Wu, Y.X.; Kwon, Y.J. Aptamers: The “evolution” of SELEX. Methods 2016, 106, 21–28. [Google Scholar] [CrossRef] [Scilit]
- Sheibani, M.; Azizi, Y.; Shayan, M.; Nezamoleslami, S.; Eslami, F.; Farjoo, M.H.; Dehpour, A.R. Doxorubicin-Induced Cardiotoxicity: An Overview on Pre-clinical Therapeutic Approaches. Cardiovasc. Toxicol. 2022, 22, 292–310. [Google Scholar] [CrossRef] [Scilit]
- Boyacioglu, O.; Stuart, C.H.; Kulik, G.; Gmeiner, W.H. Dimeric DNA Aptamer Complexes for High-capacity-targeted Drug Delivery Using pH-sensitive Covalent Linkages. Mol. Ther. Nucleic Acids 2013, 2, e107. [Google Scholar] [CrossRef] [Scilit]
- Riccardi, C.; Napolitano, E.; Musumeci, D.; Montesarchio, D. Dimeric and Multimeric DNA Aptamers for Highly Effective Protein Recognition. Molecules 2020, 25, 5227. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jing, P.; Cao, S.; Xiao, S.; Zhang, X.; Ke, S.; Ke, F.; Yu, X.; Wang, L.; Wang, S.; Luo, Y.; et al. Enhanced growth inhibition of prostate cancer in vitro and in vivo by a recombinant adenovirus-mediated dual-aptamer modified drug delivery system. Cancer Lett. 2016, 383, 230–242. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, K.-S.; Lee, G.-H.; Jeong, H.Y.; Park, Y.S.; Kim, D.-E. Efficient and Specific Co-Delivery of Vimentin siRNA and Doxorubicin with Aptamosomes for Combination Cancer Therapy. Mol. Ther. 2012, 20, S158. [Google Scholar]
- Lee, G.-H.; Jeong, H.Y.; Park, Y.S.; Kim, D.-E.; Kim, K.-S. Prostate Cancer Cell-Specific siRNA and Drug Co-Delivery with Aptamer-Functionalized Liposomes (Aptamosomes). Mol. Ther. 2013, 21, S63. [Google Scholar]
- Xu, W.; Siddiqui, I.A.; Nihal, M.; Pilla, S.; Rosenthal, K.; Mukhtar, H.; Gong, S. Aptamer-conjugated and doxorubicin-loaded unimolecular micelles for targeted therapy of prostate cancer. Biomaterials 2013, 34, 5244–5253. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tang, L.; Tong, R.; Coyle, V.J.; Yin, Q.; Pondenis, H.; Borst, L.B.; Cheng, J.; Fan, T.M. Targeting Tumor Vasculature with Aptamer-Functionalized Doxorubicin—Polylactide Nanoconjugates for Enhanced Cancer Therapy. Acs Nano 2015, 9, 5072–5081. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fang, M.; Chen, M.; Liu, L.; Li, Y. Applications of Quantum Dots in Cancer Detection and Diagnosis: A Review. J. Biomed. Nanotechnol. 2017, 13, 1–16. [Google Scholar] [CrossRef] [Scilit]
- Bagalkot, V.; Zhang, L.; Levy-Nissenbaum, E.; Jon, S.; Kantoff, P.W.; Langer, A.R.; Farokhzad, O.C. Quantum dot—Aptamer conjugates for synchronous cancer imaging, therapy, and sensing of drug delivery based on Bi-fluorescence resonance energy transfer. Nano Lett. 2007, 7, 3065–3070. [Google Scholar] [CrossRef] [Scilit]
- Atabi, F.; Gargari, S.L.M.; Hashemi, M.; Yaghmaei, P. Doxorubicin Loaded DNA Aptamer Linked Myristilated Chitosan Nanogel for Targeted Drug Delivery to Prostate Cancer. Iran. J. Pharm. Res. 2017, 16, 35–49. [Google Scholar]
- Kim, D.; Jeong, Y.Y.; Jon, S. A Drug-Loaded Aptamer-Gold Nanoparticle Bioconjugate for Combined CT Imaging and Therapy of Prostate Cancer. Acs Nano 2010, 4, 3689–3696. [Google Scholar] [CrossRef] [Scilit]
- Lee, I.-H.; An, S.; Yu, M.K.; Kwon, H.-K.; Im, S.-H.; Jon, S. Targeted chemoimmunotherapy using drug-loaded aptamer-dendrimer bioconjugates. J. Control. Release 2011, 155, 435–441. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, E.; Jung, Y.; Choi, H.; Yang, J.; Suh, J.-S.; Huh, Y.-M.; Kim, K.; Haam, S. Prostate cancer cell death produced by the co-delivery of Bcl-xL shRNA and doxorubicin using an aptamer-conjugated polyplex. Biomaterials 2010, 31, 4592–4599. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bates, P.J.; Reyes-Reyes, E.M.; Malik, M.T.; Murphy, E.M.; O’Toole, M.G.; Trent, J.O. G-quadruplex oligonucleotide AS1411 as a cancer-targeting agent: Uses and mechanisms. Biochim. Biophys. Acta Gen. Subj. 2017, 1861, 1414–1428. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Taghdisi, S.M.; Danesh, N.M.; Ramezani, M.; Yazdian-Robati, R.; Abnous, K. A Novel AS1411 Aptamer-Based Three-Way Junction Pocket DNA Nanostructure Loaded with Doxorubicin for Targeting Cancer Cells in Vitro and in Vivo. Mol. Pharm. 2018, 15, 1972–1978. [Google Scholar] [CrossRef] [Scilit]
- Chaudhary, R.; Roy, K.; Kanwar, R.K.; Veedu, R.N.; Krishnakumar, S.; Cheung, C.H.A.; Verma, A.K.; Kanwar, J.R. E-Cadherin Aptamer-Conjugated Delivery of Doxorubicin for Targeted Inhibition of Prostate Cancer Cells. Aust. J. Chem. 2016, 69, 1108–1116. [Google Scholar] [CrossRef] [Scilit]
- Leach, J.C.; Wang, A.; Ye, K.; Jin, S. A RNA-DNA Hybrid Aptamer for Nanoparticle-Based Prostate Tumor Targeted Drug Delivery. Int. J. Mol. Sci. 2016, 17, 380. [Google Scholar] [CrossRef] [Scilit]
- Min, K.; Jo, H.; Song, K.; Cho, M.; Chun, Y.-S.; Jon, S.; Kim, W.J.; Ban, C. Dual-aptamer-based delivery vehicle of doxorubicin to both PSMA (+) and PSMA (-) prostate cancers. Biomaterials 2011, 32, 2124–2132. [Google Scholar] [CrossRef] [Scilit]
- Wang, A.Z.; Bagalkot, V.; Vasilliou, C.C.; Gu, F.; Alexis, F.; Zhang, L.; Shaikh, M.; Yuet, K.; Cima, M.J.; Langer, R.; et al. Superparamagnetic iron oxide nanoparticle-aptamer bioconjugates for combined prostate cancer imaging and therapy. Chemmedchem 2008, 3, 1311–1315. [Google Scholar]
- Hussein, J.; El-Naggar, M.E.; Fouda, M.M.G.; Morsy, O.M.; Ajarem, J.S.; Almalki, A.M.; Allam, A.A.; Mekawi, E.M. The efficiency of blackberry loaded AgNPs, AuNPs and Ag@AuNPs mediated pectin in the treatment of cisplatin-induced cardiotoxicity in experimental rats. Int. J. Biol. Macromol. 2020, 159, 1084–1093. [Google Scholar] [CrossRef] [Scilit]
- Li, Q.Q.; Wang, G.; Reed, E.; Huang, L.; Cuff, C.F. Evaluation of Cisplatin in Combination with beta-Elemene as a Regimen for Prostate Cancer Chemotherapy. Basic Clin. Pharmacol. Toxicol. 2010, 107, 868–876. [Google Scholar]
- Yang, C.; Lee, M.; Song, G.; Lim, W. tRNA(Lys)-Derived Fragment Alleviates Cisplatin-Induced Apoptosis in Prostate Cancer Cells. Pharmaceutics 2021, 13, 55. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huang, H.; Li, P.; Ye, X.; Zhang, F.; Lin, Q.; Wu, K.; Chen, W. Isoalantolactone Increases the Sensitivity of Prostate Cancer Cells to Cisplatin Treatment by Inducing Oxidative Stress. Front. Cell Dev. Biol. 2021, 9, 632779. [Google Scholar] [CrossRef] [Scilit]
- Dhar, S.; Kolishetti, N.; Lippard, S.J.; Farokhzad, O.C. Targeted delivery of a cisplatin prodrug for safer and more effective prostate cancer therapy in vivo. Proc. Natl. Acad. Sci. USA 2011, 108, 1850–1855. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dhar, S.; Gu, F.X.; Langer, R.; Farokhzad, O.C.; Lippard, S.J. Targeted delivery of cisplatin to prostate cancer cells by aptamer functionalized Pt(IV) prodrug-PLGA-PEG nanoparticles. Proc. Natl. Acad. Sci. USA 2008, 105, 17356–17361. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- McKenzie, L.K.; Flamme, M.; Felder, P.S.; Karges, J.; Bonhomme, F.; Gandioso, A.; Malosse, C.; Gasser, G.; Hollenstein, M. A ruthenium-oligonucleotide bioconjugated photosensitizing aptamer for cancer cell specific photodynamic therapy. RSC Chem. Biol. 2022, 3, 85–95. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Prasad, S.; Tyagi, A.K.; Aggarwal, B.B. Recent Developments in Delivery, Bioavailability, Absorption and Metabolism of Curcumin: The Golden Pigment from Golden Spice. Cancer Res. Treat. 2014, 46, 2–18. [Google Scholar] [CrossRef] [Scilit]
- Nocito, M.C.; De Luca, A.; Prestia, F.; Avena, P.; La Padula, D.; Zavaglia, L.; Sirianni, R.; Casaburi, I.; Puoci, F.; Chimento, A.; et al. Antitumoral Activities of Curcumin and Recent Advances to ImProve Its Oral Bioavailability. Biomedicines 2021, 9, 1476. [Google Scholar] [CrossRef] [Scilit]
- Mishra, S.; Patel, S.; Halpani, C.G. Recent Updates in Curcumin Pyrazole and Isoxazole Derivatives: Synthesis and Biological Application. Chem. Biodivers. 2019, 16, e1800366. [Google Scholar] [CrossRef] [Scilit]
- Shigdar, S.; Qiao, L.; Zhou, S.-F.; Xiang, D.; Wang, T.; Li, Y.; Lim, L.Y.; Kong, L.; Li, L.; Duan, W. RNA aptamers targeting cancer stem cell marker CD133. Cancer Lett. 2013, 330, 84–95. [Google Scholar] [CrossRef] [Scilit]
- Ma, J.; Zhuang, H.; Zhuang, Z.; Lu, Y.; Xia, R.; Gan, L.; Wu, Y. Development of docetaxel liposome surface modified with CD133 aptamers for lung cancer targeting. Artif. Cells Nanomed. Biotechnol. 2018, 46, 1864–1871. [Google Scholar] [CrossRef] [Scilit]
- Ma, Q.; Qian, W.; Tao, W.; Zhou, Y.; Xue, B. Delivery Of Curcumin Nanoliposomes Using Surface Modified With CD133 Aptamers For Prostate Cancer. Drug Des. Dev. Ther. 2019, 13, 4021–4033. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Armand, J.P. Focus on cellular pharmacology of docetaxel. Bull. Cancer 2003, 90, 1067–1070. [Google Scholar] [PubMed]
- Thomas, C.; Baunacke, M.; Erb, H.H.H.; Fuessel, S.; Erdmann, K.; Putz, J.; Borkowetz, A. Systemic Triple Therapy in Metastatic Hormone-Sensitive Prostate Cancer (mHSPC): Ready for Prime Time or Still to Be Explored? Cancers 2022, 14, 8. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Patil, K.S.; Hajare, A.A.; Manjappa, A.S.; More, H.N.; Disouza, J.I. Design, development, in silico and in vitro characterization of Docetaxel-loaded TPGS/Pluronic F 108 mixed micelles for improved cancer treatment. J. Drug Deliv. Sci. Technol. 2021, 65, 102685. [Google Scholar] [CrossRef] [Scilit]
- Farokhzad, O.C.; Cheng, J.J.; Teply, B.A.; Sherifi, I.; Jon, S.; Kantoff, P.W.; Richie, J.P.; Langer, R. Targeted nanoparticle-aptamer bioconjugates for cancer chemotherapy in vivo. Proc. Natl. Acad. Sci. USA 2006, 103, 6315–6320. [Google Scholar] [CrossRef] [Scilit]
- Chen, Z.; Tai, Z.; Gu, F.; Hu, C.; Zhu, Q.; Gao, S. Aptamer-mediated delivery of docetaxel to prostate cancer through polymeric nanoparticles for enhancement of antitumor efficacy. Eur. J. Pharm. Biopharm. 2016, 107, 130–141. [Google Scholar] [CrossRef] [Scilit]
- Best, R.L.; LaPointe, N.E.; Azarenko, O.; Miller, H.; Genualdi, C.; Chih, S.; Shen, B.-Q.; Jordan, M.A.; Wilson, L.; Feinstein, S.C.; et al. Microtubule and tubulin binding and regulation of microtubule dynamics by the antibody drug conjugate (ADC) payload, monomethyl auristatin E (MMAE): Mechanistic insights into MMAE ADC peripheral neuropathy. Toxicol. Appl. Pharmacol. 2021, 421, 115534. [Google Scholar] [CrossRef] [Scilit]
- Doronina, S.O.; Mendelsohn, B.A.; Bovee, T.D.; Cerveny, C.G.; Alley, S.C.; Meyer, D.L.; Oflazoglu, E.; Toki, B.E.; Sanderson, R.J.; Zabinski, R.F.; et al. Enhanced activity of monomethylauristatin F through monoclonal antibody delivery: Effects of linker technology on efficacy and toxicity. Bioconjug. Chem. 2006, 17, 114–124. [Google Scholar] [CrossRef] [Scilit]
- Gray, B.P.; Kelly, L.; Ahrens, D.P.; Barry, A.P.; Kratschmer, C.; Levy, M.; Sullenger, B.A. Tunable cytotoxic aptamer-drug conjugates for the treatment of prostate cancer. Proc. Natl. Acad. Sci. USA 2018, 115, 4761–4766. [Google Scholar] [CrossRef] [Scilit]
- Gray, B.P.; Song, X.; Hsu, D.S.; Kratschmer, C.; Levy, M.; Barry, A.P.; Sullenger, B.A. An Aptamer for Broad Cancer Targeting and Therapy. Cancers 2020, 12, 3217. [Google Scholar] [CrossRef] [Scilit]
- Yang, Y.-H.; Mao, J.-W.; Tan, X.-L. Research progress on the source, production, and anti-cancer mechanisms of paclitaxel. Chin. J. Nat. Med. 2020, 18, 890–897. [Google Scholar] [CrossRef] [Scilit]
- Gan, Y.; Chen, Q.; Lei, Y. Regulation of paclitaxel sensitivity in prostate cancer cells by PTEN/maspin signaling. Oncol. Lett. 2017, 14, 4977–4982. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rabzia, A.; Khazaei, M.; Rashidi, Z.; Khazaei, M.R. Synergistic Anticancer Effect of Paclitaxel and Noscapine on Human Prostate Cancer Cell Lines. Iran. J. Pharm. Res. 2017, 16, 1432–1442. [Google Scholar] [PubMed]
- Guo, Q.; Dong, Y.; Zhang, Y.; Fu, H.; Chen, C.; Wang, L.; Yang, X.; Shen, M.; Yu, J.; Chen, M.; et al. Sequential Release of Pooled siRNAs and Paclitaxel by Aptamer-Functionalized Shell-Core Nanoparticles to Overcome Paclitaxel Resistance of Prostate Cancer. Acs Appl. Mater. Interfaces 2021, 13, 13990–14003. [Google Scholar] [CrossRef] [Scilit]
- Li, J.; Liang, H.; Liu, J.; Wang, Z. Poly (amidoamine) (PAMAM) dendrimer mediated delivery of drug and pDNA/siRNA for cancer therapy. Int. J. Pharm. 2018, 546, 215–225. [Google Scholar] [CrossRef] [Scilit]
- Shigdar, S.; Lin, J.; Yu, Y.; Pastuovic, M.; Wei, M.; Duan, W. RNA aptamer against a cancer stem cell marker epithelial cell adhesion molecule. Cancer Sci. 2011, 102, 991–998. [Google Scholar] [CrossRef] [Scilit]
- Xiang, D.; Shigdar, S.; Bean, A.G.; Bruce, M.; Yang, W.; Mathesh, M.; Wang, T.; Yin, W.; Tran, P.; Al Shamaileh, H.; et al. Transforming doxorubicin into a cancer stem cell killer via EpCAM aptamer-mediated delivery. Theranostics 2017, 7, 4071–4086. [Google Scholar] [CrossRef] [Scilit]
- Tai, Z.; Ma, J.; Ding, J.; Pan, H.; Chai, R.; Zhu, C.; Cui, Z.; Chen, Z.; Zhu, Q. Aptamer-Functionalized Dendrimer Delivery of Plasmid-Encoding lncRNA MEG3 Enhances Gene Therapy in Castration-Resistant Prostate Cancer. Int. J. Nanomed. 2020, 15, 10305–10320. [Google Scholar] [CrossRef] [Scilit]
- Khan, M.A.; Tania, M.; Fu, J. Epigenetic role of thymoquinone: Impact on cellular mechanism and cancer therapeutics. Drug Discov. Today 2019, 24, 2315–2322. [Google Scholar] [CrossRef] [Scilit]
- Singh, S.K.; Gordetsky, J.B.; Bae, S.; Acosta, E.P.; Lillard, J.W., Jr.; Singh, R. Selective Targeting of the Hedgehog Signaling Pathway by PBM Nanoparticles in Docetaxel-Resistant Prostate Cancer. Cells 2020, 9, 1976. [Google Scholar] [CrossRef] [Scilit]
- Costello, L. Intermediary metabolism of normal and malignant prostate: A neglected area of prostate research. Prostate 1998, 34, 303–304. [Google Scholar] [CrossRef] [Scilit]
- Costello, L.C.; Franklin, R.B. The intermediary metabolism of the prostate: A key to understanding the pathogenesis and progression of prostate malignancy. Oncology 2000, 59, 269–282. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Makhov, P.; Golovine, K.; Uzzo, R.G.; Rothman, J.; Crispen, P.L.; Shaw, T.; Scoll, B.J.; Kolenko, V.M. Zinc chelation induces rapid depletion of the X-linked inhibitor of apoptosis and sensitizes prostate cancer cells to TRAIL-mediated apoptosis. Cell Death Differ. 2008, 15, 1745–1751. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stuart, C.H.; Singh, R.; Smith, T.L.; D’Agostino, R., Jr.; Caudell, D.; Balaji, K.C.; Gmeiner, W.H. Prostate-specific membrane antigen-targeted liposomes specifically deliver the Zn2+ chelator TPEN inducing oxidative stress in prostate cancer cells. Nanomedicine 2016, 11, 1207–1222. [Google Scholar] [CrossRef] [Scilit] [PubMed]



| No. | Aptamer Code | Type of Aptamer | Base Sequence (5′-3′) | Target Protein | Target Cell | Drug | Pharmaceutical Preparation | References |
|---|---|---|---|---|---|---|---|---|
| 1 | DAC | DNA | dCGGCA16GCCG or dCGGCT16GCCG | PSMA | C4-2 | Doxorubicin | Conjugates | [20] |
| 2 | A10-3.2/DUP-1 | RNA/Peptide | A10-3.2: the 3′-end was modified with the amino “5′-GGGAGGACGAUGCGGAUCAGCCAUGUUU ACGUCACUCCU-(CH2)6-NH2-3′(with 2′-fluoro pyrimidine modifications)”, and the 5′-end was labeled with fluorescein isothiocyanate (FITC). DUP-1: N’-FITC-FRPNRAQDYNTN | PSMA | LNCaP, PC-3 | Doxorubicin | Adenovirus | [22] |
| 3 | A10 | DNA | GGGAGGACGAUGCGGAUCAGCCAUGUUUACGUCACUCCUUGUCAAUCCUCAUCGGC | PSMA | CWR22Rv1 | Doxorubicin | Micelle | [25] |
| 4 | Apt 1 | DNA | CATCCATGGGAATTCGTCGACCCTGCAGGCATGCAAGCTTTCCCTATAGTGAGTCGTATTACGAGCTCGAGCCTAGGCAG | LNCaP | Doxorubicin | Myristilated Chitosan Nanogel | [29] | |
| 5 | A9 | RNA | GGGAGGACGAUGCGGACCGAAAAAGACCUGACUUCUAUACUAAGUCUACGUUCCCAGACGACUCGCCCGACGA | PSMA | LNCaP | Doxorubicin | Nanoliposomes | [23,24] |
| 6 | A9-(CGA)7 | RNA | GGGAGGACGAUGCGGACCGAAAAAGACCUGACUUCUAUACUAAGUCUACGUUCCCAGACGACUCGCCCGACGACGACGACGACGACGACGACGA | PSMA | LNCaP | Doxorubicin | Nanoparticles | [30] |
| 7 | A9-(CGA)7 | RNA-DNA | GGGAGGACGAUGCGGACCGAAAAAGACCUGACUUCUAUACUAAGUCUACGUUCCCAGACGACUCGCCCGACGACGACGACGACGACGACGACGA | PSMA | LNCaP, 22RV1, DU145 | Doxorubicin | Nanoparticles | [31] |
| 8 | A10 | RNA | GGGAGGAcGAuGcGGAucAGccAuGuuuAcGucAcuccuuGucAAuccucAucGGc (3′-3′dT)-5′) | PSMA | LNCaP | Doxorubicin | Nanoparticles | [26] |
| 9 | anti-PSMA aptamer | RNA | NH2-spacer-GGGAGGACGAUGCGGAUCAGCCAUGUUUACGUCACUCCUUGUC-AAUCCUCAUCGGC invertedT-30 with 20-fluoro pyrimidines, 30-inverted T cap, and 50-amino group attached by a hexaethyleneglycol spacer | PSMA | LNCaP | Doxorubicin | Nanoparticles | [32] |
| 10 | AS1411 | DNA | Apt1: TATGGTGAAGGGAAAGGTGGTGGTGGTTGTGGTGGTGGTGGAAACACCAAACCCAA Apt2: TTGGGTTTGGTGAAAGGTGGTGGTGGTTGTGGTGGTGGTGGAAACCTCCTTTCCTT Apt3: AAGGAAAGGAGGAAAGGTGGTGGTGGTTGTGGTGGTGGTGGAAACCCTTCACCATA | Nucleolin | PC-3, 4T1 | Doxorubicin | Nanoparticles | [34] |
| 11 | Ecad01 | DNA | GTGGGCTCAAGAAGAAGCGCAA | E-cadherin | DU145 | Doxorubicin | Conjugates, Nanoparticles | [35] |
| 12 | A10 | RNA | GGGAGGACGAUGCGGAUCAGCCAUGUUUACGUCACUCCUUGUCAAUCCUCAUCGGC | PSMA | LNCaP | Doxorubicin | Quantum dots, Nanoparticles | [28] |
| 13 | A10-3-J1 | RNA-DNA | GGGAGGAAUAGCUGACGGGAGGACGAUGCGGAUCAGCCAUGUUUACGU CACUCCUUGUCAAUAAUAAGGGGC | PSMA | LNCaP | Doxorubicin | Super paramagnetic iron oxide nanoparticle | [36] |
| 14 | A10/DUP-1 | RNA/Peptide | A10: TAATACGACTCACTATAGGGGAGGACGATGCGGATCAGCCATGTTTACGTCACTCC TTGTCAATCCTCATCGGC DUP-1: N′ biotin-FRPNRAQDYNTN | PSMA | LNCaP, PC-3 | Doxorubicin | Super paramagnetic iron oxide nanoparticles | [37] |
| 15 | A10 | RNA | GGGAGGACGAUGCGGAUCAGCCAUGUUUACGUCACUCCUUGUCAAUCCUCAUCGGC | PSMA | LNCaP | Doxorubicin | Super paramagnetic iron oxide nanoparticles | [38] |
| No. | Aptamer Code | Type of Aptamer | Base Sequence (5′-3′) | Target Protein | Target Cell | Drug | Pharmaceutical Preparation | References |
|---|---|---|---|---|---|---|---|---|
| 1 | A10 | RNA | 5′-NH2-spacer GGGAGGACGAUGCGGAUCAGCCAUGUUUACGUCACUCCUUGUCAAUCCUCAUCGGCiT-3′ containing 2′-fluoro pyrimidines, a 3′-inverted T cap, and a 5′-amino group attached by a hexaethyleneglycol spacer | PSMA | LNCaP | Cisplatin | Nanoliposomes | [44] |
| 2 | A15 | RNA | SH-CCCUCCUACAUAGGG | CD133 | DU145 | Curcumin | Nanoliposomes | [51] |
| 3 | A10 | RNA | GGGAGGACGAUGCGGAUCAGCCAUGUUUACGUCACUCCUUGUCAAUCCUCAUCGGC | PSMA | LNCaP | Docetaxel | Nanoparticles | [55] |
| 4 | Anti-PSMA aptamer | RNA | 5′-NH2-GGGAGGACGAUGCGGAUCAGCCAUGUUUACGUCACUCCU (CH2)6-S-S-(CH2)6-OH-3′ with 2′-fluoro pyrimidines | PSMA | LNCaP | Docetaxel | Nanoparticles | [56] |
| 5 | E3 | RNA | GGCUUUCGGGCUUUCGGCAACAUCAGCCCCUCAGCC | PSMA | 22Rv1 | Monomethyl auristatin | Conjugates | [59,60] |
| 6 | Unnamed | RNA | 5′-NH2 (CH2)6 GGGAGGACGAUGCGGAUCAGCCAUGUUUACGUCACUCCUUGUCAAUCCU- CAUCGGCiT-3′ with 2-fluoro pyrimidines, a 3-inverted T cap | PSMA | LNCaP | Paclitaxel | Nanoparticles | [64] |
| 7 | EpDT3 | RNA | 5ʹ/5thiol/-GCGACUGGUUACCCGGUCG-3′ | EpCAM | PC-3, DU-145 | Poly(amidoamine) | Conjugates | [68] |
| 8 | A10-3.2 | RNA | GGGAGGACGAUGCGGAUCAGCC AUGUUUACGUCACUCCU-spacer-NH2 | PSMA | C4-2B-R, LNCaP-R | Thymoquinone | Nanoparticles | [70] |
| 9 | SZTI01 | DNA | dGCGTTTTCGCTTTTGCGTTTTGGGTCATCTGCTTACGATAGCAATGCT | PSMA | C4–2 | TPEN | Liposomes | [74] |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, X.; Zhou, Q.; Li, X.; Gan, X.; Liu, P.; Feng, X.; Fang, G.; Liu, Y. Insights into Aptamer–Drug Delivery Systems against Prostate Cancer. Molecules 2022, 27, 3446. https://doi.org/10.3390/molecules27113446
Wang X, Zhou Q, Li X, Gan X, Liu P, Feng X, Fang G, Liu Y. Insights into Aptamer–Drug Delivery Systems against Prostate Cancer. Molecules. 2022; 27(11):3446. https://doi.org/10.3390/molecules27113446
Chicago/Turabian StyleWang, Xueni, Qian Zhou, Xiaoning Li, Xia Gan, Peng Liu, Xiaotao Feng, Gang Fang, and Yonghong Liu. 2022. "Insights into Aptamer–Drug Delivery Systems against Prostate Cancer" Molecules 27, no. 11: 3446. https://doi.org/10.3390/molecules27113446
APA StyleWang, X., Zhou, Q., Li, X., Gan, X., Liu, P., Feng, X., Fang, G., & Liu, Y. (2022). Insights into Aptamer–Drug Delivery Systems against Prostate Cancer. Molecules, 27(11), 3446. https://doi.org/10.3390/molecules27113446

