Next Article in Journal
The Active Phytohormone in Microalgae: The Characteristics, Efficient Detection, and Their Adversity Resistance Applications
Next Article in Special Issue
Feature-Based Molecular Networks Identification of Bioactive Metabolites from Three Plants of the Polynesian Cosmetopoeia Targeting the Dermal Papilla Cells of the Hair Cycle
Previous Article in Journal
The Density Functional Theory Account of Interplaying Long-Range Exchange and Dispersion Effects in Supramolecular Assemblies of Aromatic Hydrocarbons with Spin
Previous Article in Special Issue
Ursane-Type Triterpenes, Phenolics and Phenolic Derivatives from Globimetula braunii Leaf
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Molecules
Volume 27
Issue 1
10.3390/molecules27010044
molecules-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Transcriptomics Reveals Host-Dependent Differences of Polysaccharides Biosynthesis in Cynomorium songaricum

by
Jie Wang
1,2,
Hongyan Su
3,
Hongping Han
4,
Wenshu Wang
5,
Mingcong Li
1,2,
Yubi Zhou
1,2,*,
Yi Li
1,2,* and
Mengfei Li
3
1
Qinghai Key Laboratory of Qinghai-Tibet Plateau Biological Resource, Northwest Institute of Plateau Biology, Chinese Academy of Sciences, Xining 810008, China
2
University of Chinese Academy of Sciences, Beijing 100049, China
3
State Key Laboratory of Aridland Crop Science, College of Life Science and Technology, Gansu Agricultural University, Lanzhou 730070, China
4
School of Chemistry and Chemical Engineering, Qinghai Normal University, Xining 810008, China
5
Alxa Forestry and Grassland Research Institute, Alxa 750306, China
*
Authors to whom correspondence should be addressed.
Molecules 2022, 27(1), 44; https://doi.org/10.3390/molecules27010044
Submission received: 31 October 2021 / Revised: 17 December 2021 / Accepted: 20 December 2021 / Published: 22 December 2021
(This article belongs to the Special Issue Bioactive Compounds from Natural Resources)
Browse Figures
Review Reports Versions Notes

Abstract

:
Cynomorium songaricum is a root holoparasitic herb that is mainly hosted in the roots of Nitraria roborowskii and Nitraria sibirica distributed in the arid desert and saline-alkaline regions. The stem of C. songaricum is widely used as a traditional Chinese medicine and applied in anti-viral, anti-obesity and anti-diabetes, which largely rely on the bioactive components including: polysaccharides, flavonoids and triterpenes. Although the differences in growth characteristics of C. songaricum between N. roborowskii and N. sibirica have been reported, the difference of the two hosts on growth and polysaccharides biosynthesis in C. songaricum as well as regulation mechanism are not limited. Here, the physiological characteristics and transcriptome of C. songaricum host in N. roborowskii (CR) and N. sibirica (CS) were conducted. The results showed that the fresh weight, soluble sugar content and antioxidant capacity on a per stem basis exhibited a 3.3-, 3.0- and 2.1-fold increase in CR compared to CS. A total of 16,921 differentially expressed genes (DEGs) were observed in CR versus CS, with 2573 characterized genes, 1725 up-regulated and 848 down-regulated. Based on biological functions, 50 DEGs were associated with polysaccharides and starch metabolism as well as their transport. The expression levels of the selected 37 genes were validated by qRT-PCR and almost consistent with their Reads Per kb per Million values. These findings would provide useful references for improving the yield and quality of C. songaricum.

1. Introduction

Cynomorium songaricum Rupr. is a root holoparasitic herb that is mainly hosted in the roots of Nitraria L., and widely distributed in the arid desert and saline-alkaline regions in northwest of China including: Qinghai, Xinjiang, Inner Mongolia and Ningxia [1,2]. As a traditional Chinese medicine, the stem of C. songaricum is generally used to tonify kidney yang, replenish essence and blood and relax the bowels [3,4]. In recent years, the stem has also been applied in anti-viral, anti-oxidation, anti-obesity, anti-diabetes, anti-tumor and ameliorates Alzheimer’s disease [5,6,7,8,9,10], which largely rely on the bioactive components including: polysaccharides (mainly polymerized by glucose, mannose and galactose), flavonoids (e.g., catechin, epicatechin and rutin), triterpenes (e.g., ursolic acid, acetyl ursolic acid and malonyl ursolic acid hemiester) and liposoluble constituents (e.g., hexadecanoic acid, oleic acid and docosenoic acid) [5,11,12,13,14,15,16].
The genus Nitraria L. is a perennial shrub and always used as a vital ecological protection plant for windbreak and sand fixation [17]. It contains 11 species in the world and 6 of them are in China [18]. C. songaricum is found to mainly host in four species including: N. roborowskii Kom., N. sibirica Pall., N. tangutorum Bobr. and N. sphaerocarpa Maxim [19,20]. Except the N. sphaerocarpa, the other three species mainly distribute in Qinghai, China [21]. Extensive surveys on habitat have found that N. roborowskii prefers locating in the margin of desert, N. sibirica in the salinized sand and drought hillslope and N. tangutorum is a transitional ecotype between N. roborowskii and N. sibirica [22,23]. Previous investigations into the differences in growth characteristics between N. roborowskii and N. sibirica have demonstrated that the growth indexes (e.g., seed weight, fruit weight and seedling height) of N. roborowskii are greater than N. sibirica [24]; while the salt tolerance, seed-setting rate, contents of nutritional components and trace elements of N. sibirica are higher than N. roborowskii [25,26,27,28,29,30].
C. songaricum is currently an endangered species, in large part because of an indiscriminate uprooting of wild plants to meet the increasing commercial demand of the pharmaceutical industry. As a holoparasitic herb, C. songaricum totally depends on the Nitraria L., for nutrients and water during the whole growth and development cycle [31]. C. songaricum is widely used as a traditional Chinese medicine and several pharmacological activities are largely relied on polysaccharides [10,15]; moreover, the growth differences in C. songaricum host in the two N. roborowskii and N. sibirica have been reported [22,23,24], the regulation mechanism of polysaccharides biosynthesis has not been revealed. Thus, it is urgent and necessary to identify the optimization host to increase production of C. songaricum. Up to now, studies on the effect of different hosts on growth and metabolite accumulation of C. songaricum have not been conducted. This study examines biomass, soluble sugar accumulation, antioxidant capacity and transcriptional alternations of stem between CR and CS.

2. Results

2.1. Comparison of Growth Characteristics between CR and CS

As shown in Figure 1, significant differences in growth characteristics of stems between the CR and CS were observed, with FW of total stems, FW per stem, stem length and diameter of CR exhibiting a 5.1-, 3.3-, 1.4 and 1.3-fold increase compared to that of CS, respectively.

2.2. Comparison of Soluble Sugar Content and Antioxidant Capacity between CR and CS

As shown in Figure 2, significant differences in soluble sugar content and antioxidant capacity between the CR and CS were observed, with a 1.1-, 1.5- and 1.5-fold respective decrease of soluble sugar content, DPPH scavenging activity and FRAP value on an FW basis in stem of CR compared to that of CS (Figure 2A,C,E), while a 3.0-, 2.1- and 2.1-fold increase on a per stem basis (Figure 2B,D,F).

2.3. Global Gene Analysis

To reveal the differences of carbohydrate metabolism between the CR and CS, comparison of the transcripts were performed. A robust data was collected, 51.2 and 46.8 million high-quality reads were obtained after data filtering, and 42.5 and 39.5 million unique reads as well as 1.6 and 1.4 million multiple reads were mapped from the CR and CS, respectively (Figure 3; Table S1). Total 95,126 unigenes were annotated on KEGG (10,274), KOG (17,550), Nr (40,427) and Swissprot (16,181) databases (Figure 4), and the top 10 species distribution against Nr includes: Cajanus cajan, Vitis vinifera, Cephalotus follicularis, Theobroma cacao, Nicotiana attenuata, Juglans regia, Corchorus capsularis, Brassica napus, Brassica rapa and Medicago truncatula (Figure 5).
A total of 16,921 DEGs were identified in the CR compared with CS, with 6580 genes up-regulated (UR) and 10,341 genes down-regulated (DR) (Figure 6). Of these 16,921 DEGs, 2684 genes were identified to match with the databases (Figure 7A). Among the 2684 genes, 2573 genes with known functions were partitioned into 1725 UR and 848 DR (Figure 7B,C).

2.4. Biological Category of DEGs

Based on biological functions, the 2573 genes were divided into nine categories: primary metabolism (493), transport (371), transcription factor (426), cell morphogenesis (289), bio-signaling (287), stress response (224), translation (195), secondary metabolism (179) and photosynthesis and energy (109) (Figure 7C; Tables S2–S10). Based on carbohydrate metabolism driving genes characterized, 50 DEGs (32UR and 18DR) were identified as potential regulatory genes for polysaccharides and starch metabolism (37) as well as transport (13) (Figure 7C; Table 1).

2.5. DEGs Involved in Carbohydrate Metabolism and Transport

2.5.1. DEGs Involved in Polysaccharides Metabolism

Thirty-two DEGs, presenting 21 UR and 11 DR in the CR compared with CS, directly participate in polysaccharides metabolism including: glucose (GapA, GAPA1, GAPA2, GAPB, GAPC, PGMP, and UGP1), galactose (BGAL, BGAL5, BGAL7, GALM, GALT29A, GLCAT14A, and GOLS2), mannose (CYT1, GMD1, MAN5, MSR2 MUR1, and PMI2), fucose (OFUT9, OFUT20, OFUT23, OFUT27, and OFUT35), trehalose (TPS7, TPS9, TPS11, TPPF, and TPPJ) and fructose (CWINV1 and CYFBP) (Table 1). Here, 22 genes were selected to be validated by qRT-PCR, and their RELs were consistent with the RPKM values, with UR for metabolism of glucose, mannose, trehalose and fructose (Figure 8A–D), while differential expression for fucose metabolism (UR for the OFUT9 and DR for the OFUT20, OFUT23 and OFUT27) (Figure 8E), and DR for galactose metabolism (Figure 8F).

2.5.2. DEGs Involved in Starch Metabolism

Five DEGs, presenting two UR and three DR in the CR compared with CS, directly participate in starch metabolism including: At2g31390, DSP4, NANA, SBE2.2 and SS2 (Table 1). These genes were validated by qRT-PCR, and their RELs were consistent with the RPKM values, with UR 3.5- and 6.8-fold for the At2g31390 and SS2, and DR 0.6-, 0.9- and 0.6-fold for the DSP4, NANA and SBE2.2, respectively (Figure 9).

2.5.3. DEGs Involved in Carbohydrate Transport

Thirteen DEGs, presenting nine UR and four DR in the CR compared with CS, are involved in carbohydrate transport including: At1g67300, ERD6, MST1, STP1, STP5, STP12, STP13, SWEET5, SWEET12, SWEET14, SWEET15, UXT2 and UXT3 (Table 1). Here, 10 genes were validated by qRT-PCR, and their RELs were consistent with the RPKM values, with the UR 4.5-, 7.3-, 4.6-, 3.5-, 4.5-, 6.2- and 1.5-fold for the STP1, STP12, STP13, SWEET5, SWEET14, SWEET15 and UXT2, while the DR 0.5-, 0.1- and 0.8-fold for the STP5, SWEET12 and UXT3, respectively (Figure 10).

3. Discussion

Although differences in growth characteristics and nutritional components of C. songaricum among the host species, especially in N. roborowskii and N. sibirica, have been observed in previous studies [25,26,27,28,29,30], the mechanism responsible for host-dependent growth and bioactive compound biosynthesis has not been dissected. Here, we found that there is a greater biomass, soluble sugar content and antioxidant capacity on a per stem basis in the CR than the CS (Figure 1 and Figure 2). By transcriptomics analysis in the CR compared with CS, a total of 2573 characterized genes differentially expressed with 1725 UR and 848 DR (Figure 7). By grouping genes based on biological functions, 50 genes (32 UR and 18 DR) were associated with carbohydrate metabolism and transport (Figure 7; Table 1).
Carbohydrates, one of the most abundant and widespread biomolecules in nature, not only plays an important role in plant growth and development, but also represents a treasure trove of untapped potential for pharmaceutical applications [32,33]. In this study, 37 genes were found to be involved in carbohydrate metabolism including polysaccharides (glucose, galactose, mannose, fucose, trehalose and fructose) and starch (Table 1). Among the 37 genes, 23 genes (62%) presenting up-regulated and 14 genes (38%) down-regulated suggest that the level of carbohydrate metabolism is greater in the CR than CS, which is in accordance with the higher content of soluble sugar on a per stem basis in the CR (Figure 2A,B).
For the polysaccharides metabolism, specifically, seven genes associated with glucose metabolic process include: GapA, GAPA1, GAPA2, GAPB and GAPC participating in the pathway Calvin cycle by catalyzing the reduction of 1,3-diphosphoglycerate by NADPH [34]; PGMP participating in both the breakdown and synthesis of glucose [35]; and UGP1 converting glucose 1-phosphate to UDP-glucose and being essential for the synthesis of sucrose, starch, cell wall and callose deposition [36,37]. Seven genes associated with galactose metabolic process include:BGAL, BGAL5 and BGAL7 degrading polysaccharides by hydrolyzing terminal non-reducing beta-D-galactose residues in beta-D-galactosides [34]; GALM catalyzing the interconversion of beta-D-galactose and alpha-D-galactose [34]; GALT29A and GLCAT14A involved in the biosynthesis of type II arabinogalactan by, respectively, transferring galactose and glucuronate to oligosaccharides [38,39]; and GOLS2 involved in the biosynthesis of raffinose family oligosaccharides [38]. Six genes associated with mannose metabolic process include: CYT1 participating in synthesizing GDP-alpha-D-mannose from alpha-D-mannose 1-phosphate [40]; GMD1 and MUR1 catalyzing the conversion of GDP-D-mannose to GDP-4-dehydro-6-deoxy-D-mannose [41]; MAN5 hydrolyzing the 1,4-beta-D-mannosidic linkages in mannans, galactomannans and glucomannans [42]; MSR2 involved in mannan biosynthesis [43]; and PMI2 involved in the synthesis of the GDP-mannose and dolichol-phosphate-mannose required for a number of critical mannosyl transfer reactions [44]. Five genes associated with fucose metabolic process include: OFUT9, OFUT20, OFUT23, OFUT27 and OFUT35 participating in the biosynthesis of matrix polysaccharides [45]. Five genes associated with trehalose metabolic process include: TPS7, TPS9, TPS11, TPPF and TPPJ involved in the trehalose biosynthesis [34,46]. Two genes associated with fructose metabolic process include: CWINV1 hydrolyzing the terminal non-reducing beta-D-fructofuranoside residues in beta-D-fructofuranosides [47,48]; and CYFBP catalyzing fructose-1,6-bisphosphate to fructose-6-phosphate and inorganic phosphate [34,49].
For the starch metabolism, five genes associated with starch metabolic process include: At2g31390 involved in maintaining the flux of carbon towards starch formation [34]; DSP4 controlling the starch accumulation and acting as a major regulator of the initial steps of starch degradation at the granule surface [50]; NANA regulating endogenous sugar levels (e.g., sucrose, glucose and fructose) by modulating starch accumulation and remobilization [51]; SBE2.2 involved in starch biosynthesis and catalyzing the formation of the alpha-1, 6-glucosidic linkages in starch [52]; and SS2 participating in the pathway starch biosynthesis [53].
Transport plays critical roles in distribution and storage of carbohydrate from leaves to roots or other organs that required nutrition [54]. In this study, 13 genes were involved in carbohydrate transport with nine genes (69%) up-regulated and four genes (31%) down-regulated, suggesting that the ability of carbohydrate transport is stronger in the CR than the CS (Table 1). Specially, the 13 genes include: At1g67300 participating in the efflux of glucose towards the cytosol [55]; ERD6 participating in sugar transport [56]; MST1 mediating active uptake of hexoses [57]; STP1, STP5, STP12 and STP13 participating in transporting glucose, 3-O-methylglucose, fructose, xylose, mannose, galactose, fucose, 2-deoxyglucose and arabinose [58]; SWEETs is a unique new family of sugar transporters that lead to many elusive transport steps including nectar secretion, phloem loading and post-phloem unloading as well as novel vacuolar transporters [59]. Here, four SWEETs genes SWEET5, SWEET12, SWEET14 and SWEET15 participate in phloem loading by mediating export from parenchyma cells feeding H+-coupled import into the sieve element/companion cell complex [59,60]; and UXT2 and UXT3 participate in transporting UDP-xylose and UMP [61].

4. Materials and Methods

4.1. Plant Materials

Stems of C. songaricum at vegetative growth stage, were host in the roots of N. roborowskii and N. sibirica (Figure 11) were collected on 6 May 2019 from Dulan county (2800 m; 36°2′25″ N, 97°40′26″ E) of Qinghai, China. The stems were cleaned and rapidly frozen in liquid nitrogen, the middle parts of stem were used for determination of soluble sugar content and antioxidant capacity, and the shoot apical meristems (SAM) were used for transcriptomic analysis.

4.2. Measurement of Growth Characteristics

Growth characteristics including fresh weight (FW) of total stems, FW per stem, and its length and diameter were immediately measured after the stems of C. songaricum were dug out and cleaned with running water and absorbent paper.

4.3. Determination of Soluble Sugar Content and Antioxidant Capacity

4.3.1. Extracts Preparation

Fresh stems (1.0 g) were ground into homogenate by adding ethanol (20 mL), agitated at 120 r/min and 22 °C for 72 h, then centrifuged at 5000 r/min and 4 °C for 10 min. The supernatant was increased 20 mL with ethanol and then kept at 4 °C for measurement.

4.3.2. Determination of Soluble Sugar Content

Soluble sugar content was determined by a phenol–sulfuric acid method [62,63]. Briefly, extracts (20 μL) were added in the reaction, absorbance reader was taken at 485 nm and soluble sugar content was calculated based on mg of sucrose.

4.3.3. Determination of Antioxidant Capacity

Antioxidant capacity was determined by DPPH and FRAP methods [64,65]. DPPH radical scavenging assay was determined according to the description of Nencini et al. [66] and Li et al. [63]. Briefly, extracts (5 μL) were added in the reaction, absorbance reader was taken at 515 nm and the capacity to scavenge DPPH radicals was calculated as following Equation (1):
DPPH scavenging activity (%) = [(A0 − A)/A0] × 100
where “A0” and “A” were the absorbance of DPPH without and with sample, respectively.
FRAP assay was determined according to the description of Benzie and Strain [67]. Briefly, extracts (20 μL) were added in the reaction, absorbance reader was taken at 593 nm and the FRAP value was calculated on the basic of (FeSO4·7H2O, 500 μmol Fe (Ⅱ)/g) as following Equation (2):
FRAP value (µmol Fe(II)/g) = [(A − A0)/(AFeSO4·7H2O − A0)] × 500 (µmol Fe(II)/g)
where “A0” and “A” were the absorbance of FRAP without and with sample, respectively; AFeSO4·7H2O was the absorbance of FeSO4·7H2O.

4.4. Total RNA Extraction, Illumina Sequencing, Sequence Filtration, Assembly, Unigene Expression Analysis and Basic Annotation

Total RNA samples of CR and CS with three biological replicates were extracted using an RNA kit (R6827, Omega Bio-Tek, Inc., Norcross, GA, USA). The processes of enrichment, fragmentation, reverse transcription, synthesis of the second-strand cDNA and purification of cDNA fragments was applied following previous protocols [68]. RNA-seq was performed by an Illumina HiSeqTM 4000 platform (Gene Denovo Biotechnology Co., Ltd., Guangzhou, China). Raw reads were filtered according to previous descriptions [68]. Clean reads were assembled using Trinity [69]. The expression level of each transcript was normalized to RPKM [70], and DEGs were analyzed according to a criterion of |log2(fold-change)| ≥ 1 and p ≤ 0.05 by DESeq2 software and the edgeR package [71,72]. Unigenes were annotated against the databases including: NR, Swiss-Prot, KEGG, KOG and GO [73].

4.5. qRT-PCR Validation

The primer sequence (Table 2) was designed via a primer-blast in NCBI and synthesized by reverse transcription (Sangon Biotech Co., Ltd., Shanghai, China). First cDNA was synthesized using a RT Kit (KR116, Tiangen, China). PCR amplification was performed using a SuperReal PreMix (FP205, Tiangen, China). Melting curve was analyzed at 72 °C for 34 s. Actin gene was used as a reference control. The RELs of genes were calculated using a 2−ΔΔCt method [74].

4.6. Statistical Analysis

All the measurements were performed using three biological replicates. A t-test was applied for independent samples, with p < 0.05 considered significant.

5. Conclusions

From the above observations, the stem biomass and polysaccharides accumulation of C. songaricum host in N. roborowskii are significantly greater than that of N. sibirica. A total of 1725 UR and 848 DR genes were observed in CR compared to CS, and 50 DEGs were involved in polysaccharides biosynthesis, which indicates that the polysaccharides biosynthesis in C. songaricum is host-dependent. The specific roles of candidate genes in regulating polysaccharides biosynthesis will require additional studies.

Supplementary Materials

The following are available online. Table supplemental legends: Table S1: Summary of sequencing data for Cynomorium songaricum transcriptome; Table S2: Primary metabolism genes differentially expressed in CR and CS; Table S3: Transport genes differentially expressed in CR and CS; Table S4: Transcription genes factor differentially expressed in CR and CS; Table S5: Cell morphogenesis genes differentially expressed in CR and CS; Table S6: Bio-signaling genes differentially expressed in CR and CS; Table S7: Stress response genes differentially expressed in CR and CS; Table S8: Translation genes differentially expressed in CR and CS; Table S9: Secondary metabolism genes differentially expressed in CR and CS; Table S10: Photosynthesis and energy genes differentially expressed in CR and CS.

Author Contributions

J.W. and H.S.: data curation, methodology and writing—original draft. H.H. and M.L. (Mingcong Li): methodology and investigation. W.W.: resources. Y.Z.: project administration and supervision. Y.L.: conceptualization and investigation. M.L. (Mengfei Li) conceptualization and writing—review and editing. All authors have read and agreed to the published version of the manuscript.

Funding

This work was financially supported by the Key Research and Transformation projects of Qinghai Province (2019-SF-171), Local Scientific Development Fund guided by the Central Government of Inner Mongolia (2021ZY0043), and Application Technology Research and Development of Alxa (AMYY2020-11).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The datasets are publicly available at NCBI, with BioSample accession: SAMN13722045 (Nitraria roborowskii) and SAMN13722048 (Nitraria sibirica), Sequence Read Archive (SRA) accession: SRR10829653 to 10829655 (Nitraria roborowskii) and SRR10829660 to 10829662 (Nitraria sibirica) (https://dataview.ncbi.nlm.nih.gov/object/PRJNA598928). (accessed on 1 February 2021)

Conflicts of Interest

The authors declare no conflict of interest.

Sample Availability

Samples of Cynomorium songaricum and other compounds are available from the authors.

Abbreviations

CRCynomoriumsongaricum host in Nitraria roborowskii Kom.
CSCynomoriumsongaricum host in Nitraria sibirica Pall.
DEGsdifferentially expressed genes
DPPH1,1-diphenyl-1-picrylhydrazyl
DRdown regulation
FRAPferric reducing antioxidant power
GOgene ontology
KEGGKyoto Encyclopedia of Genes and Genomes
KOGeuKaryotic orthologous groups of proteins
NCBINational Center for Biotechnology Information
NRnon-redundant protein
RELrelative expression level
RPKMReads Per kb per Million
URup regulation

References

  1. Chinese Academy of Sciences; China Flora Editorial Committee. Flora Reipublicae Popularis Sinicae; Science Press: Beijing, China, 2000; Volume 53, pp. 152–154. [Google Scholar]
  2. Cui, J.L.; Gong, Y.i.; Vijayakumar, V.; Zhang, G.; Wang, M.L.; Wang, J.H.; Xue, X.Z. Correlation in chemical metabolome and endophytic mycobiome in Cynomorium songaricum from different desert locations in china. J. Agric. Food Chem. 2019, 67, 3554–3564. [Google Scholar] [CrossRef]
  3. Liu, H.P.; Chang, R.F.; Wu, Y.S.; Lin, W.Y.; Tisai, F.J. The Yang-Tonifying Herbal Medicine Cynomorium songaricum Extends Lifespan and Delays Aging in Drosophila. J. Evid. Based Complement. Altern. Med. 2012, 10, 735481. [Google Scholar]
  4. Committee for the Pharmacopoeia of PR China. Pharmacopoeia of PR China; Chinese Medical Science and Technology Press: Beijing, China, 2020; Volume 1, p. 346. [Google Scholar]
  5. Ma, C.M.; Wei, Y.; Wang, Z.G.; Hattori, M. Triterpenes from Cynomorium songaricium—Analysis of HCV protease inhibitory activity, quantification, and content change under the influence of heating. J. Nat. Med. 2009, 63, 9–14. [Google Scholar] [CrossRef]
  6. Ma, C.M.; Sato, N.; Li, X.Y.; Nakamura, N.; Hattori, M. Flavan-3-ol contents, anti-oxidative and α-glucosidase inhibitory activities of Cynomorium songaricum. Food Chem. 2010, 118, 116–119. [Google Scholar] [CrossRef]
  7. Chen, J.H.; Wong, H.S.; Leung, H.Y.; Leong, P.K.; Chan, W.M.; Ko, K.M. An ursolic acid-enriched Cynomorium songarium extract attenuates high fat diet-induced obesity in mice possibly through mitochondrial uncoupling. J. Funct. Foods 2014, 9, 211–224. [Google Scholar] [CrossRef]
  8. Jin, S.W.; Chen, G.L.; Du, J.J.M.; Wang, L.H.; Ren, X.; An, T.Y. Antioxidant properties and principal phenolic compositions of Cynomorium songaricum Rupr. Int. J. Food Prop. 2014, 17, 13–25. [Google Scholar] [CrossRef] [Green Version]
  9. Cheng, D.; Su, L.; Wang, X.; Li, X.J.; Li, L.L.; Hu, M.Y.; Lu, Y. Extract of Cynomorium songaricum ameliorates mitochondrial ultrastructure impairments and dysfunction in two different in vitro models of Alzheimer’s disease. BMC Complement. Med. Ther. 2021, 21, 206. [Google Scholar] [CrossRef]
  10. Shi, Z.Q.; Wang, L.Y.; Zheng, J.Y.; Xin, G.Z.; Chen, L. Lipidomics characterization of the mechanism of Cynomorium songaricum polysaccharide on treating type-2 diabetes. J. Chromatogr. B 2021, 1176, 122737. [Google Scholar] [CrossRef]
  11. Zhou, Y.B.; Ye, R.R.; Lu, X.F.; Lin, P.C.; Yang, S.B.; Yue, P.P.; Zhang, C.X.; Peng, M. GC-MS analysis of liposoluble constituents from the stems of Cynomorium songaricum. J. Pharm. Biomed. Anal. 2009, 49, 1097–1100. [Google Scholar] [CrossRef]
  12. Luan, N.; Chang, P.; Zhuang, L.Y.; Shang, X.Y. Isolation and determination of catechin from Cynomorium songaricum Rupr. Med. Plant 2010, 8, 87–91. [Google Scholar]
  13. Jin, S.W.; Doi, A.; Kuroda, T.; Zhang, G.X.; Hatano, T.; Chen, G.L. Polyphenolic constituents of Cynomorium songaricum Rupr. and antibacterial effect of polymeric proanthocyanidin on methicillin-resistant staphylococcus aureus. J. Agric. Food Chem. 2012, 60, 7297–7305. [Google Scholar] [CrossRef]
  14. Wang, F.X.; Wang, W.; Huang, Y.L.; Liu, Z.W.; Zhang, J. Characterization of a novel polysaccharide purified from a herb of Cynomorium songaricum Rupr. Food Hydrocoll. 2015, 47, 79–86. [Google Scholar] [CrossRef]
  15. Tuvaanjav, S.; Han, S.Q.; Komata, M.; Ma, C.J.; Kanamoto, T.; Nakashima, H.; Yoshida, T. Isolation and antiviral activity of water-soluble Cynomorium songaricum Rupr. polysaccharides. J. Asian Nat. Prod. Res. 2016, 18, 159–171. [Google Scholar] [CrossRef]
  16. Wang, F.X.; Liu, Q.; Wang, W.; Li, X.B.; Zhang, J. A polysaccharide isolated from Cynomorium songaricum Rupr. protects pc12 cells against H2O2-induced injury. Int. J. Biomacro. 2016, 87, 222–228. [Google Scholar] [CrossRef]
  17. Dong, Q.; Hu, H.; Suo, Y.R.; Chi, X.F.; Wang, H.L. The complete chloroplast genome sequences of two species from Nitraria. Mitochondrial DNA B 2019, 4, 1229–1230. [Google Scholar] [CrossRef] [Green Version]
  18. Chinese Academy of Sciences, China Flora Editorial Committee. Flora Reipublicae Popularis Sinicae; Science Press: Beijing, China, 1998; Volume 43, pp. 117–118. [Google Scholar]
  19. Guo, Y.H.; Lin, H.M.; Lin, Z.J. Study on Identification Characteristics of Cynomorium of the Nitraia Siberian. Gansu Agric. Sci. Technol. 2010, 3, 15–17. [Google Scholar]
  20. Chen, Y.; Han, D.H.; Gao, H.; Luo, G.H.; Wang, J. Distribution and Utilization on Germplasm Resources of Host Plants of Cynomorium songaricum. Chin. Wild Plant Resour. 2013, 32, 45–47. [Google Scholar]
  21. Chinese Academy of Sciences; China Flora Editorial Committee. Flora Qinghaiica; Qinghai People’s Publishing House: Xinning, China, 1999; Volume 2, pp. 289–290. [Google Scholar]
  22. Pan, X.Y.; Cao, Q.D.; Wei, Q.S.; Wang, G.X. Progress of researches on systematic and biodiversity in the genus Nitraria L. Chin. Acad. Med. Organ. 2002, 4, 1–6. [Google Scholar]
  23. Chun, L.; Zhao, S.Z.; Hao, Y.Z.; Hu, Z.M.; Ma, Y.H. The resources and applications of Nitraria L. Chin. Wild Plant Resour. 2016, 35, 58–60. [Google Scholar]
  24. Ren, J.; Tao, L. Numerical analysis on the growth benefits of the genus Nitraria. J. Gansu Agric. Univ. 2001, 36, 130–134. [Google Scholar]
  25. Wu, C.R.; Li, Y.; Zhang, X.Q.; Xiao, B. Study on adaptability of Nitraria seedlings to salt stress. Gansu Sci. Technol. 2009, 25, 154–155. [Google Scholar]
  26. Li, T.C.; Suo, Y.R. Characteristic of Trace Elements in Plant Nitraria Leaf from Qinghai Chaidamu Region. Guangdong Trace Elements Sci. 2002, 9, 66–68. [Google Scholar]
  27. Liu, L.P. Analysis and appraisal on nutritional components of the four plants of Nitraria in Inner Mongolia. Master’s Thesis, Inner Mongolia Agricultural University, Inner Mongolia, China, May 2009. [Google Scholar]
  28. Liu, L.P.; Si, Q.B.L.G.; Xu, Z.M.; He, Z. Nutritional Components of Fruits of Nitraria L. and Its Utilization in Alashan Desert Area. J. Inner Mongolia Forestry Sci Tech. 2016, 42, 29–31. [Google Scholar]
  29. Wang, S.X.; Li, Q.H.; Xu, J.; Gao, T.T.; Xin, Z.M. Experimental research on the pollination characteristics of 4 plant species of genus Nitraria L. J. Biol. 2012, 29, 49–51. [Google Scholar]
  30. Zhou, L.B. Factor Analysis and Cluster Analysis on Trace Elements in Nitraria Leaf in Qinghai Area. J. Anhui Agric. Sci. 2010, 38, 10360–10361. [Google Scholar]
  31. Cui, J.Y.; Vijayakumar, V.; Zhang, G. Partitioning of Fungal Endophyte Assemblages in Root-Parasitic Plant Cynomorium songaricum and Its Host Nitraria tangutorum. Front. Microbiol. 2018, 9, 666. [Google Scholar] [CrossRef] [PubMed]
  32. Smeekens, S.; Ma, J.K.; Hanson, J.; Hanson, J.; Rolland, F. Sugar signals and molecular networks controlling plant growth. Curr. Opin. Plant Biol. 2010, 13, 274–279. [Google Scholar] [CrossRef]
  33. Pan, L.; Cai, C.; Liu, C.J.; Liu, D.; Li, G.Y.; Linhardt, R.J.; Yu, G.L. Recent progress and advanced technology in carbohydrate-based drug development. Curr. Opin. Biotechnol. 2021, 69, 191–198. [Google Scholar] [CrossRef]
  34. Gaudet, P.; Livstone, M.S.; Lewis, S.E.; Thomas, P.D. Phylogenetic-based propagation of functional annotations within the Gene Ontology consortium. Brief. Bioinform. 2011, 12, 449–462. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  35. Harrison, C.J.; Mould, R.M.; Leech, M.J.; Johnson, S.A.; Turner, L.; Schreck, S.L.; Baird, K.M.; Jack, P.L.; Rawsthorne, S.; Hedley, C.L.; et al. The rug3 locus of pea encodes plastidial phosphoglucomutase. Plant Physiol. 2000, 122, 1187–1192. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  36. Meng, M.; Geisler, M.; Johansson, H.; Harholt, J.; Scheller, H.V.; Mellerowicz, E.J.; Kleczkowski, L.A. UDP-glucose pyrophosphorylase is not rate limiting, but is essential in Arabidopsis. Plant Cell Physiol. 2009, 50, 998–1011. [Google Scholar] [CrossRef] [Green Version]
  37. Park, J.I.; Ishimizu, T.; Suwabe, K.; Sudo, K.; Masuko, H.; Hakozaki, H.; Nou, I.S.; Suzuki, G.; Watanabe, M. UDP-glucose pyrophosphorylase is rate limiting in vegetative and reproductive phases in Arabidopsis thaliana. Plant Cell Physiol. 2010, 51, 981–996. [Google Scholar] [CrossRef]
  38. Dilokpimol, A.; Poulsen, C.P.; Vereb, G.; Kaneko, S.; Schulz, A.; Geshi, N. Galactosyltransferases from Arabidopsis thaliana in the biosynthesis of type II arabinogalactan: Molecular interaction enhances enzyme activity. BMC Plant Biol. 2014, 14, 90. [Google Scholar] [CrossRef] [Green Version]
  39. Knoch, E.; Dilokpimol, A.; Tryfona, T.; Poulsen, C.P.; Xiong, G.; Harholt, J.; Petersen, B.L.; Ulvskov, P.; Hadi, M.Z.; Kotake, T.; et al. A beta-glucuronosyltransferase from Arabidopsis thaliana involved in biosynthesis of type II arabinogalactan has a role in cell elongation during seedling growth. Plant J. 2013, 76, 1016–1029. [Google Scholar] [CrossRef] [PubMed]
  40. Qin, C.; Qian, W.Q.; Wang, W.F.; Wu, Y.; Yu, C.M.; Jiang, X.H.; Wang, D.W.; Wu, P. GDP-mannose pyrophosphorylase is a genetic determinant of ammonium sensitivity in Arabidopsis thaliana. Proc. Natl. Acad. Sci. USA 2008, 105, 18308–18313. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  41. Bonin, C.P.; Freshour, G.; Hahn, M.G.; Vanzin, G.F.; Reiter, W.D. The GMD1 and GMD2 genes of Arabidopsis encode isoforms of GDP-D-mannose 4,6-dehydratase with cell type-specific expression patterns. Plant Physiol. 2003, 132, 883–892. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  42. Filichkin, S.A.; Leonard, J.M.; Monteros, A.; Liu, P.P.; Nonogaki, H. A novel endo-beta-mannanase gene in tomato LeMAN5 is associated with anther and pollen development. Plant Physiol. 2004, 134, 1080–1087. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  43. Wang, Y.; Mortimer, J.C.; Davis, J.; Dupree, P.; Keegstra, K. Identification of an additional protein involved in mannan biosynthesis. Plant J. 2013, 73, 105–117. [Google Scholar] [CrossRef]
  44. Maruta, T.; Yonemitsu, M.; Yabuta, Y.; Tamoi, M.; Ishikawa, T.; Shigeoka, S. Arabidopsis phosphomannose isomerase 1, but not phosphomannose isomerase 2, is essential for ascorbic acid biosynthesis. J. Biol. Chem. 2008, 283, 28842–28851. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  45. Halliday, J. Molecular analysis and functional elucidation of a novel plant O-fucosyltransferase in Arabidopsis thaliana and Brassica napus. Ph.D. Thesis, The University of Guelph, Ontario, Canada, June 2016. [Google Scholar]
  46. Vogel, G.; Fiehn, O.; Jean-Richard-dit-Bressel, L.; Boller, T.; Wiemken, A.; Aeschbacher, R.A.; Wingler, A. Trehalose metabolism in Arabidopsis: Occurrence of trehalose and molecular cloning and characterization of trehalose-6-phosphate synthase homologues. J. Exp. Bot. 2001, 52, 1817–1826. [Google Scholar] [CrossRef] [Green Version]
  47. De Coninck, B.; Le Roy, K.; Francis, I.; Clerens, S.; Vergauwen, R.; Halliday, A.M.; Smith, S.M.; Van Laere, A.; Van Den Ende, W. Arabidopsis AtcwINV3 and 6 are not invertases but are fructan exohydrolases (FEHs) with different substrate specificities. Plant Cell Environ. 2005, 28, 432–443. [Google Scholar] [CrossRef]
  48. Le Roy, K.; Lammens, W.; Verhaest, M.; De Coninck, B.; Rabijns, A.; Van Laere, A.; Van den Ende, W. Unraveling the difference between invertases and fructan exohydrolases: A single amino acid (Asp-239) substitution transforms Arabidopsis cell wall invertase1 into a fructan 1-exohydrolase. Plant Physiol. 2007, 145, 616–625. [Google Scholar] [CrossRef]
  49. Cho, Y.H.; Yoo, S.D. Signaling role of fructose mediated by FINS1/FBP in Arabidopsis thaliana. PLos Genet. 2011, 7, e1001263. [Google Scholar] [CrossRef] [Green Version]
  50. Berrocal-Lobo, M.; Ibanez, C.; Acebo, P.; Ramos, A.; Perez-Solis, E.; Collada, C.; Casado, R.; Aragoncillo, C.; Allona, I. Identification of a homolog of Arabidopsis DSP4 (SEX4) in chestnut: Its induction and accumulation in stem amyloplasts during winter or in response to the cold. Plant Cell Environ. 2011, 34, 1693–1704. [Google Scholar] [CrossRef] [Green Version]
  51. Paparelli, E.; Gonzali, S.; Parlanti, S.; Novi, G.; Giorgi, F.M.; Licausi, F.; Kosmacz, M.; Feil, R.; Lunn, J.E.; Brust, H.; et al. Misexpression of a chloroplast aspartyl protease leads to severe growth defects and alters carbohydrate metabolism in Arabidopsis. Plant Physiol. 2012, 160, 1237–1250. [Google Scholar] [CrossRef] [Green Version]
  52. Dumez, S.; Wattebled, F.; Dauvillee, D.; Delvalle, D.; Planchot, V.; Ball, S.G.; D’Hulst, C. Mutants of Arabidopsis lacking starch branching enzyme II substitute plastidial starch synthesis by cytoplasmic maltose accumulation. Plant Cell 2006, 18, 2694–2709. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  53. Kossmann, J.; Abel, G.J.W.; Springer, F.; Lloyd, J.R.; Willmitzer, L. Cloning and functional analysis of a cDNA encoding a starch synthase from potato (Solanum tuberosum L.) that is predominantly expressed in leaf tissue. Planta 1999, 208, 503–511. [Google Scholar] [CrossRef]
  54. Arms, K.; Camp, P.S. Biology, 4th ed.; Saunders College publishing: Philadelphia, PA, USA, 2010; pp. 929–946. [Google Scholar]
  55. Johnson, D.A.; Hill, J.P.; Thomas, M.A. The monosaccharide transporter gene family in land plants is ancient and shows differential subfamily expression and expansion across lineages. BMC Evol. Biol. 2006, 6, 64. [Google Scholar]
  56. Kiyosue, T.; Abe, H.; Yamaguchi-Shinozaki, K.; Shinozaki, K. ERD6, a cDNA clone for an early dehydration-induced gene of Arabidopsis, encodes a putative sugar transporter. Biochim. Biophys. Acta. 1998, 1370, 187–191. [Google Scholar] [CrossRef] [Green Version]
  57. Toyofuku, K.; Kasahara, M.; Yamaguchi, J. Characterization and expression of monosaccharide transporters (osMSTs) in rice. Plant Cell Physiol. 2000, 41, 940–947. [Google Scholar] [CrossRef] [Green Version]
  58. Sherson, S.M.; Hemmann, G.; Wallace, G.; Forbes, S.; Germain, V.; Stadler, R.; Bechtold, N.; Sauer, N.; Smith, S.M. Monosaccharide/proton symporter AtSTP1 plays a major role in uptake and response of Arabidopsis seeds and seedlings to sugars. Plant J. 2000, 24, 849–857. [Google Scholar] [CrossRef] [PubMed]
  59. Eom, J.S.; Chen, L.Q.; Sosso, D.; Julius, B.T.; Lin, I.W.; Qu, X.Q.; Braun, D.M.; Frommer, W.B. SWEETs, transporters for intracellular and intercellular sugar translocation. Curr. Opin. Plant Biol. 2015, 25, 53–62. [Google Scholar] [CrossRef] [Green Version]
  60. Chen, L.Q.; Qu, X.Q.; Hou, B.H.; Sosso, D.; Osorio, S.; Fernie, A.R.; Frommer, W.B. Sucrose efflux mediated by SWEET proteins as a key step for phloem transport. Science 2012, 335, 207–211. [Google Scholar] [CrossRef]
  61. Ebert, B.; Rautengarten, C.; Guo, X.Y.; Xiong, G.Y.; Stonebloom, S.; Smith-Moritz, A.M.; Herter, T.; Chan, L.J.G.; Adams, P.D.; Petzold, C.J.; et al. Identification and characterization of a Golgi-localized UDP-xylose transporter family from Arabidopsis. Plant Cell 2015, 27, 1218–1227. [Google Scholar] [CrossRef] [Green Version]
  62. Dubois, M.; Gilles, K.A.; Hamilton, J.K.; Rebers, P.A.; Smith, F. Colorimetric method for determination of sugars and related substances. Anal. Chem. 1956, 28, 350–356. [Google Scholar] [CrossRef]
  63. Li, M.F.; Liu, X.Z.; Wei, J.H.; Zhang, Z.; Chen, S.J.; Liu, Z.H.; Xing, H. Selection of high altitude planting area of Angelica sinensis based on biomass, bioactive compounds accumulation and antioxidant capacity. Chin. Tradit. Herb. Drugs 2020, 51, 474–481. [Google Scholar]
  64. Arnao, M.B. Some methodological problems in the determination of antioxidant activity using chromogen radicals: A practical case. Trends Food Sci. Technol. 2000, 11, 419–421. [Google Scholar] [CrossRef]
  65. Li, M.F.; Pare, P.W.; Zhang, J.L.; Kang, T.L.; Zhang, Z.; Yang, D.L.; Wang, K.P.; Xing, H. Antioxidant capacity connection with phenolic and flavonoid content in Chinese medicinal herbs. Rec. Nat. Prod. 2018, 3, 239–250. [Google Scholar] [CrossRef]
  66. Nencini, C.; Menchiari, A.; Franchi, G.G.; Micheli, L. In vitro antioxidant activity of aged extracts of some Italian Allium species. Plant Foods Hum. Nutr. 2011, 66, 11–16. [Google Scholar] [CrossRef]
  67. Benzie, I.F.F.; Strain, J.J. The ferric reducing ability of plasma (FRAP) as a measure of antioxidant power: The FRAP assay. Anal. Biochem. 1996, 239, 70–76. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  68. Li, M.F.; Sun, P.; Kang, T.L.; Xing, H.; Yang, D.L.; Zhang, J.L.; Paré, P.W. Mapping podophyllotoxin biosynthesis and growth-related transcripts with high elevation in Sinopodophyllum hexandrum. Ind. Crop 2018, 124, 510–518. [Google Scholar] [CrossRef]
  69. Grabherr, M.G.; Haas, B.J.; Yassour, M.; Levin, J.Z.; Thompson, D.A.; Amit, I.; Adiconis, X.; Fan, L.; Raychowdhury, R.; Zeng, Q.D.; et al. Full-length transcriptome assembly from RNA-Seq data without a reference genome. Nat. Biotechnol. 2011, 29, 644–652. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  70. Mortazavi, A.; Williams, B.A.; McCue, K.; Schaeffer, L.; Wold, B. Mapping and quantifying mammalian transcriptomes by RNA-Seq. Nat. Methods 2008, 5, 621–628. [Google Scholar] [CrossRef] [PubMed]
  71. Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNAseq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  72. Robinson, M.D.; McCarthy, D.J.; Smyth, G.K. EdgeR: A Bioconductor package for differential expression analysis of digital gene expression data. Brief Bioinform. 2010, 26, 139–140. [Google Scholar] [CrossRef] [Green Version]
  73. Conesa, A.; Götz, S.; García-Gómez, J.M.; Terol, J.; Talón, M.; Robles, M. Blast2GO: A universal tool for annotation, visualization and analysis in functional genomics research. Brief Bioinform. 2005, 21, 3674–3676. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  74. Willems, E.; Leyns, L.; Vandesompele, J. Standardization of real-time PCR gene expression data from independent biological replicates. Anal. Biochem. 2008, 379, 127–129. [Google Scholar] [CrossRef]
Molecules 27 00044 g001 550
Figure 1. Growth characteristics of stems of Cynomorium songaricum host in Nitraria roborowskii (CR) and Cynomorium songaricum host in Nitraria sibirica (CS) (mean ± SD, n = 20). Images (A–D) represent FW of total stems, FW per stem, stem length and diameter, respectively. A t-test was applied for independent samples, the “*” is considered significant at p < 0.05 between CR and CS.
Figure 1. Growth characteristics of stems of Cynomorium songaricum host in Nitraria roborowskii (CR) and Cynomorium songaricum host in Nitraria sibirica (CS) (mean ± SD, n = 20). Images (A–D) represent FW of total stems, FW per stem, stem length and diameter, respectively. A t-test was applied for independent samples, the “*” is considered significant at p < 0.05 between CR and CS.
Molecules 27 00044 g001
Molecules 27 00044 g002 550
Figure 2. Soluble sugar content and antioxidant capacity in stems between the CR and CS (mean ± SD, n = 20). Images (A–D) as well as (E,F) represent soluble sugar content, DPPH scavenging activity as well as FRAP value on an FW and per stem basis, respectively. A t-test was applied for independent samples, the “*” is considered significant at p < 0.05 between CR and CS.
Figure 2. Soluble sugar content and antioxidant capacity in stems between the CR and CS (mean ± SD, n = 20). Images (A–D) as well as (E,F) represent soluble sugar content, DPPH scavenging activity as well as FRAP value on an FW and per stem basis, respectively. A t-test was applied for independent samples, the “*” is considered significant at p < 0.05 between CR and CS.
Molecules 27 00044 g002
Molecules 27 00044 g003 550
Figure 3. Length distribution of assembled unigenes in C. songaricum.
Figure 3. Length distribution of assembled unigenes in C. songaricum.
Molecules 27 00044 g003
Molecules 27 00044 g004 550
Figure 4. Basic annotation for all unigenes in C. songaricum on KEGG, KOG, Nr and Swissprot databases.
Figure 4. Basic annotation for all unigenes in C. songaricum on KEGG, KOG, Nr and Swissprot databases.
Molecules 27 00044 g004
Molecules 27 00044 g005 550
Figure 5. Top 10 species distribution of unigenes against Nr database.
Figure 5. Top 10 species distribution of unigenes against Nr database.
Molecules 27 00044 g005
Molecules 27 00044 g006 550
Figure 6. Volcano plot of unigenes and number of differentially expressed genes (DEGs) in the CR compared with CS.
Figure 6. Volcano plot of unigenes and number of differentially expressed genes (DEGs) in the CR compared with CS.
Molecules 27 00044 g006
Molecules 27 00044 g007 550
Figure 7. Distribution and classification of DEGs in the CR compared with CS (UR, up-regulation; DR, down-regulation). Image (A) represents the classification of unidentified and identified genes, image (B) represents the classification of uncharacterized and characterized genes and image (C) represents the classification of the functional genes.
Figure 7. Distribution and classification of DEGs in the CR compared with CS (UR, up-regulation; DR, down-regulation). Image (A) represents the classification of unidentified and identified genes, image (B) represents the classification of uncharacterized and characterized genes and image (C) represents the classification of the functional genes.
Molecules 27 00044 g007
Molecules 27 00044 g008 550
Figure 8. The relative expression level of genes involved in metabolism process of glucose (A), mannose (B), trehalose (C), fructose (D), fucose (E) and galactose (F) in the CR compared with CS, as determined by qRT-PCR. Column highlighted in green represents genes UR and red represents genes DR. The dotted line in the images differentiates UR (>1) and DR (<1) in CR compared with CS, represented. The same below.
Figure 8. The relative expression level of genes involved in metabolism process of glucose (A), mannose (B), trehalose (C), fructose (D), fucose (E) and galactose (F) in the CR compared with CS, as determined by qRT-PCR. Column highlighted in green represents genes UR and red represents genes DR. The dotted line in the images differentiates UR (>1) and DR (<1) in CR compared with CS, represented. The same below.
Molecules 27 00044 g008
Molecules 27 00044 g009 550
Figure 9. The relative expression level of genes involved in starch metabolism in the CR compared with CS, as determined by qRT-PCR.
Figure 9. The relative expression level of genes involved in starch metabolism in the CR compared with CS, as determined by qRT-PCR.
Molecules 27 00044 g009
Molecules 27 00044 g010 550
Figure 10. The relative expression level of genes involved in transport in the CR compared with CS, as determined by qRT-PCR.
Figure 10. The relative expression level of genes involved in transport in the CR compared with CS, as determined by qRT-PCR.
Molecules 27 00044 g010
Molecules 27 00044 g011 550
Figure 11. Morphological characteristics of stems of C. songaricum at vegetative growth stage and aerial parts of N. roborowskii and N. sibirica. Images (A,B) represent stems host in the roots of N. roborowskii and N. sibirica, and Images (C,D) represent aerial parts of N. roborowskii and N. sibirica, respectively.
Figure 11. Morphological characteristics of stems of C. songaricum at vegetative growth stage and aerial parts of N. roborowskii and N. sibirica. Images (A,B) represent stems host in the roots of N. roborowskii and N. sibirica, and Images (C,D) represent aerial parts of N. roborowskii and N. sibirica, respectively.
Molecules 27 00044 g011
Table
Table 1. DEGs involved in carbohydrate metabolism and transport in the CR compared with CS.
Table 1. DEGs involved in carbohydrate metabolism and transport in the CR compared with CS.
Gene NameSwissprot-IDProtein NameRPKM (CR/CS)
Polysaccharides Metabolism (32)
Glucose (7)
GapAsp|Q8VXQ9|G3PA_COEVAGlyceraldehyde-3-phosphate dehydrogenase A8.83
GAPA1sp|P25856|G3PA1_ARATHGlyceraldehyde-3-phosphate dehydrogenase GAPA15.47
GAPA2sp|Q9LPW0|G3PA2_ARATHGlyceraldehyde-3-phosphate dehydrogenase GAPA24.37
GAPBsp|P25857|G3PB_ARATHGlyceraldehyde-3-phosphate dehydrogenase GAPB7.25
GAPCsp|P04796|G3PC_SINALGlyceraldehyde-3-phosphate dehydrogenase3.25
PGMPsp|Q9SM59|PGMP_PEAPhosphoglucomutase−1.70
UGP1sp|P57751|UGPA1_ARATHUTP-glucose-1-phosphate uridylyltransferase 12.80
Galactose (7)
BGALsp|P48981|BGAL_MALDOBeta-galactosidase−1.00
BGAL5sp|Q9MAJ7|BGAL5_ARATHBeta-galactosidase 5−1.32
BGAL7sp|Q9SCV5|BGAL7_ARATHBeta-galactosidase 7−3.29
GALMsp|Q5EA79|GALM_BOVINAldose 1-epimerase1.34
GALT29Asp|Q9SGD2|GT29A_ARATHBeta-1,6-galactosyltransferase GALT29A−3.71
GLCAT14Asp|Q9FLD7|GT14A_ARATHBeta-glucuronosyltransferase GlcAT14A−1.10
GOLS2sp|C7G304|GOLS2_SOLLCGalactinol synthase 2−1.23
Mannose (6)
CYT1sp|O22287|GMPP1_ARATHMannose-1-phosphate guanylyltransferase 13.29
GMD1sp|Q9SNY3|GMD1_ARATHGDP-mannose 4,6 dehydratase 12.98
MAN5sp|P93031|GMD2_ARATHMannan endo-1,4-beta-mannosidase 53.21
MSR2sp|Q6YM50|MAN5_SOLLCProtein MANNAN SYNTHESIS-RELATED 21.72
MUR1sp|Q0WPA5|MSR2_ARATHGDP-mannose 4,6 dehydratase 21.24
PMI2sp|Q9FZH5|MPI2_ARATHMannose-6-phosphate isomerase 21.61
Fucose (5)
OFUT9sp|Q8H1E6|OFUT9_ARATHO-fucosyltransferase 91.16
OFUT20sp|O64884|OFT20_ARATHO-fucosyltransferase 20−2.52
OFUT23sp|Q9MA87|OFT23_ARATHO-fucosyltransferase 23−1.86
OFUT27sp|Q8GZ81|OFT27_ARATHO-fucosyltransferase 27−1.19
OFUT35sp|Q94BY4|OFT35_ARATHO-fucosyltransferase 351.14
Trehalose (5)
TPS7sp|Q9LMI0|TPS7_ARATHProbable alpha,alpha-trehalose-phosphate synthase −1.40
TPS9sp|Q9LRA7|TPS9_ARATHProbable alpha,alpha-trehalose-phosphate synthase 8.76
TPS11sp|Q9ZV48|TPS11_ARATHProbable alpha,alpha-trehalose-phosphate synthase 3.34
TPPFsp|Q9SU39|TPPF_ARATHProbable trehalose-phosphate phosphatase F2.27
TPPJsp|Q5HZ05|TPPJ_ARATHProbable trehalose-phosphate phosphatase J2.48
Fructose (2)
CWINV1sp|Q43866|INV1_ARATHBeta-fructofuranosidase, insoluble isoenzyme CWINV11.40
CYFBPsp|Q9MA79|F16P2_ARATHFructose-1,6-bisphosphatase2.29
Starch Metabolism (5)
At2g31390sp|Q9SID0|SCRK1_ARATHProbable fructokinase-12.93
DSP4sp|G4LTX4|DSP4_CASSAPhosphoglucan phosphatase DSP4, amyloplastic−1.95
NANAsp|Q9LTW4|NANA_ARATHAspartic proteinase NANA−3.64
SBE2.2sp|Q9LZS3|GLGB2_ARATH1,4-alpha-glucan-branching enzyme 2-2−1.79
SS2sp|Q43847|SSY2_SOLTUGranule-bound starch synthase 24.05
Carbohydrate Transport (13)
At1g67300sp|Q9FYG3|PLST2_ARATHProbable plastidic glucose transporter 21.12
ERD6sp|O04036|ERD6_ARATHSugar transporter ERD62.47
MST1sp|Q0JCR9|MST1_ORYSJSugar transport protein MST1−1.09
STP1sp|P23586|STP1_ARATHSugar transport protein 18.84
STP5sp|Q93Y91|STP5_ARATHSugar transport protein 5−1.29
STP12sp|O65413|STP12_ARATHSugar transport protein 125.61
STP13sp|Q94AZ2|STP13_ARATHSugar transport protein 133.28
SWEET5sp|Q9FM10|SWET5_ARATHBidirectional sugar transporter SWEET52.05
SWEET12sp|O82587|SWT12_ARATHBidirectional sugar transporter SWEET12−2.05
SWEET14sp|Q2R3P9|SWT14_ORYSJBidirectional sugar transporter SWEET141.57
SWEET15sp|P0DKJ5|SWT15_VITVIBidirectional sugar transporter SWEET159.57
UXT2sp|Q8GUJ1|UXT2_ARATHUDP-xylose transporter 21.71
UXT3sp|Q8RXL8|UXT3_ARATHUDP-xylose transporter 3−1.81
Table
Table 2. Sequences of primer employed in qRT-PCR analysis.
Table 2. Sequences of primer employed in qRT-PCR analysis.
GenesSequences (5′ to 3′)Amplicon Size (bp)
ACTForward: CTAAACCGCTTGTTGCTGGC104
Reverse: GGGGAGCTCACACGAAAGAT
Polysaccharides Metabolism (22)
GAPA1Forward: TCGTTTTCATGCTTGTAACTTGT112
Reverse: CTTACGCCTCATTTCGCCTC
GAPA2Forward: GAAAGCGTCCTGAGCAAAGT172
Reverse: GCCCAGGACATACCCAAAAG
GAPBForward: GGCAAGATGGAACTTCATGCG106
Reverse: ATGTGAAGTCGGGCCAAAAC
GAPCForward: TTTTGGTCTGAGCCAGAGAGG106
Reverse: TGTTACCGCCTGAAAATACCT
BGAL5Forward: AGGCTCTGCTACGTTTGCTT169
Reverse: TCTCACGTTTCGGCTTTCGT
BGAL7Forward: AGTCTCATTGCCATTCCCCG104
Reverse: TGGGCGATGAATTTGGTGGA
GALT29AForward: AGCTCTGAACGGAAAGCTCAT186
Reverse: GCTTGCTCACGAATACCCCA
GLCAT14AForward:TGGTGTGACGAGGTTCAAGAGA148
Reverse: CAGATTCGCTGGTAACTGCCT
GMD1Forward: ATTGCTCTTGCACATCACACAC101
Reverse: GGCTTATAGCGGTCAACAAAAT
MUR1Forward: AGGCAAACGATTGTTGCGAG180
Reverse: GGATTTGTCAGCCCTTGCTT
MAN5Forward: AGCCAAGAAAATGGCGGAAT198
Reverse: GCGTGGATGGAATGGTGAAG
MSR2Forward: ACGAGCTTTCTCAAACAGGCA153
Reverse: TCGCAAGGGCTTCTAAAATGG
OFUT9Forward: GGGTTGTCCTTTGGTCTTGT110
Reverse: AGTTTGCGCTTGTTGTCTACC
OFUT20Forward: TTCAGGACATAGAGGAGCAGC159
Reverse: GTCCCCCTCCATAAAAGGCG
OFUT23Forward: GCGACTTCTTACCGGCATCT191
Reverse: GCCTGTCCCAAACTCTGACA
OFUT27Forward: GTTCACCGTTGCAAGACCAC132
Reverse: CCTTGGCTGGTGGAATGGAT
TPS9Forward:TGAGTAAGGAACAAGCCCCATC164
Reverse: CCTTTCCAGGCCGAGACATAA
TPS11Forward: TCCGGTCGGTGAAAGGTATG131
Reverse: ATCCCATCAACCACAGCCTC
TPPFForward: TCGGGAAAACCAATGGGTGA128
Reverse: AGACGGCTGAACTTGAGGTG
TPPJForward: TACCAACTGTGCTAAGCCCT104
Reverse:CTGTATATTGGGTTTTGGAAGGC
CWINV1Forward: GTGACGTGTGTTTCCAGTGTG109
Reverse: TCAGTGTCAGCCATAAGTTGGT
CYFBPForward: TAGTGGGCAGGGTTTAGGCA109
Reverse: TCGTGCGGTTAGTGTTTTACCT
Starch (5)
At2g31390Forward:TGTCCGCAAACAGAAAACGTC120
Reverse: TGGACGCCAAAGAGGGAATG
DSP4Forward: CCCGTGTTTATCCTCGTTGGT157
Reverse: AAGGTGGTGGTTGACGGTG
NANAForward: ATGCCGATCCCCAAACACA102
Reverse:CGAAGGTAATGCCAAATTGAGA
SBE2.2Forward:TGTCCGCAAACAGAAAACGTC120
Reverse: TGGACGCCAAAGAGGGAATG
SS2Forward: CGGCACAAAATCAACATGGG104
Reverse: CCAGGCATTCAGTTGCGAAG
Transport (10)
STP1Forward: GCACTTAGCTTTGATATGCCCC112
Reverse: TTTAAGACCCATCGCCGTCC
STP5Forward: TCTGAGACAAACAGCCTTCC110
Reverse: TCCCGTGTATAAGTGCTCTACC
STP12Forward: ACGAGCTCTGCAAAGGGTTC179
Reverse: CTCCATCTGGTTCAACGCAC
STP13Forward: AGTGTTCGACGGGGACTCTT146
Reverse: ACCCCCTCTTGAGTCTTGTC
SWEET5Forward: GGGTTAGGTTGTCGTGGACT100
Reverse: GCTTTGTCAAGTGTGGTGCT
SWEET12Forward: TCTGACAACTACCCGCAAGC190
Reverse: AGGCACAGATAGTTGCCGAA
SWEET14Forward: AGCTGCCGAAAGTACCCTAC130
Reverse: TCGCATGTTTCTCCTTCGCT
SWEET15Forward: TGTCGCCGTTGCATTTTTGT137
Reverse: CTCAACTGGGTGGCCTTCAA
UXT2Forward: AGGCCTGATTGCAAGAGCTTA148
Reverse: CACGGGTACGTCACTCAGAT
UXT3Forward: TGCGGTTAACCTGGAAGAGG189
Reverse: TGTTTAGGACATCCTCCCATGC
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Wang, J.; Su, H.; Han, H.; Wang, W.; Li, M.; Zhou, Y.; Li, Y.; Li, M. Transcriptomics Reveals Host-Dependent Differences of Polysaccharides Biosynthesis in Cynomorium songaricum. Molecules 2022, 27, 44. https://doi.org/10.3390/molecules27010044

AMA Style

Wang J, Su H, Han H, Wang W, Li M, Zhou Y, Li Y, Li M. Transcriptomics Reveals Host-Dependent Differences of Polysaccharides Biosynthesis in Cynomorium songaricum. Molecules. 2022; 27(1):44. https://doi.org/10.3390/molecules27010044

Chicago/Turabian Style

Wang, Jie, Hongyan Su, Hongping Han, Wenshu Wang, Mingcong Li, Yubi Zhou, Yi Li, and Mengfei Li. 2022. "Transcriptomics Reveals Host-Dependent Differences of Polysaccharides Biosynthesis in Cynomorium songaricum" Molecules 27, no. 1: 44. https://doi.org/10.3390/molecules27010044

Article Metrics

Back to TopTop