Immune Modulatory Activities of Arginyl-Fructose (AF) and AF-Enriched Natural Products in In-Vitro and In-Vivo Animal Models
Abstract
1. Introduction
2. Results
2.1. HPLC Analysis of AF
2.2. Effects of AF and GF on Spleen Cell Proliferation
2.3. Effects of AF and GF on Spleen Antibody Production
2.3.1. Body Weight and Immune-Related Organ Weight
2.3.2. Blood Immunoglobulin (IgM and IgG) Contents
2.3.3. Measurement of Hepatotoxicity and Cytokine Expression in Spleen Cells
3. Discussion
4. Materials and Methods
4.1. Materials
4.2. HPLC Analysis of AF
4.3. Cell Proliferation Effect of AF and GF
4.4. Animal Study
- I: Normal control (fed saline only) − Normal
 - II: Negative control (100 mg/kg of cyclophosphamide) − CY Control
 - III: 100 mg/kg Ginofos extract (GF)
 - IV: 35 mg/kg arginyl-fructose (AF)
 
4.5. Evaluation of the Ability to Improve Immunity
4.5.1. Changes in Weight of Body, Thymus, Spleen and Liver
4.5.2. Measurement of Antibody-Producing Ability in Mice Immunocompromised to CY
4.5.3. TNF-α and Expression of Cytokines
4.6. Analysis of Blood Biochemical Properties
4.7. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Sample Availability
References
- Abo, T.; Kawamura, T.; Watanabe, H. Immunologic states of autoimmune diseases. Immunol. Res. 2005, 33, 23–34. [Google Scholar] [CrossRef]
 - Swain, S.L.; Bradley, L.M.; Croft, M.; Tonkonogy, S.; Atkins, G.; Weinberg, A.D.; Duncan, D.D.; Hedrick, S.M.; Dutton, R.W.; Huston, G. Helper T-cell subsets: Phenotype, function and the role of lymphokines in regulating their development. Immunol. Rev. 1991, 123, 115–144. [Google Scholar] [CrossRef] [PubMed]
 - Campara, M.; Tzvetanov, I.G.; Oberholzer, J. Interleukin-2 receptor blockade with humanized monoclonal antibody for solid organ transplantation. Expert Opin. Biol. Ther. 2010, 10, 959–969. [Google Scholar] [CrossRef]
 - Goldby, R.A.; Kindt, T.J.; Osbome, B.A.; Kudy, J. Immunology, 5th ed.; W.H. Freemand and Company: New York, NY, USA, 2003; pp. 154–196. [Google Scholar]
 - Fiorentino, D.F.; Zlotnik, A.; Vieira, P.; Mosmann, T.R.; Howard, M.; Moore, K.W.; O’Garra, A. IL-10 acts on the antigenpresenting cell to inhibit cytokine production by Th1 cells. J. Immunol. 1991, 146, 3444–3451. [Google Scholar]
 - Andersen, M.H.; Gehl, J.; Reker, S.; Pedersen, L.; Becker, J.C.; Geertsen, P.; Straten, P. Dynamic changes of specific T cell responses to melanoma correlate with IL-2 administration. Semin. Cancer Biol. 2003, 13, 449–459. [Google Scholar] [CrossRef]
 - Waldner, M.J.; Neurath, M.F. Gene therapy using IL-12 family members in infection, auto immunity, and cancer. Curr. Gene Ther. 2009, 9, 239–247. [Google Scholar] [CrossRef] [PubMed]
 - Misson, D.R.; Abdalla, D.R.; Borges, A.M.; Shimba, D.S.; Adad, S.J.; Michelin, M.A.; Murta, E.F. Cytokine serum levels in patients with cervical intraepithelial neoplasia grade II-III treated with intralesional interferon-α 2b. Tumori J. 2011, 97, 578–584. [Google Scholar] [CrossRef]
 - Kang, S.W.; Min, H.Y. Ginseng, the ‘Immunity Boost’: The Effects of Panax ginseng on Immune System. J. Ginseng Res. 2012, 36, 354–368. [Google Scholar] [CrossRef] [PubMed]
 - Lasek, W.; Feleszko, W.; Golab, J.; Stokłosa, T.; Marczak, M.; Dabrowska, A.; Malejczyk, M.; Jakóisiak, M. Antitumor effects of the combination immunotherapy with interleukin-12 and tumor necrosis factor alpha in mice. Cancer Immunol. Immunother. 1997, 2, 100–108. [Google Scholar] [CrossRef] [PubMed]
 - Jang, D.J.; Lee, M.S.; Shin, B.C.; Lee, Y.C.; Ernst, E. Red ginseng for treating erectile dysfunction: A systematic review. Br. J. Clin. Pharmacol. 2008, 66, 444–450. [Google Scholar] [CrossRef]
 - Park, H.J.; Jung, D.H.; Joo, H.; Kang, N.S.; Jang, S.A.; Lee, J.G.; Sohn, E.H. The comparative study of anti-allergic and anti-inflammatory effects by fermented red ginseng and red ginseng. Korean J. Plant Res. 2010, 23, 415–422. [Google Scholar]
 - Berlato, C.; Cassatella, M.A.; Kinjyo, I.; Gatto, L.; Yoshimura, A.; Bazzoni, F. Involvement of suppressor of cytokine signaling-3 as a mediator of the inhibitory effects of IL-10 on lipopolysaccharide-induced macrophage activation. J. Immunol. 2002, 168, 6404–6411. [Google Scholar] [CrossRef] [PubMed]
 - Byeon, S.E.; Lee, J.; Kim, J.H.; Yang, W.S.; Kwak, Y.S.; Kim, S.Y.; Choung, E.S.; Rhee, M.H.; Cho, J.Y. Molecular mechanism of macrophage activation by re ginseng acidic polysaccharide from Korean red ginseng. Mediat. Inflamm. 2012, 732–860. [Google Scholar] [CrossRef]
 - Joo, K.M.; Park, C.W.; Jeng, H.J.; Lee, S.J.; Chang, I.S. Simultaneous determination of two Amadori compounds in Korean red ginseng (Panax ginseng) extracts and rat plasma by high-performance anion-exchange chromatography with pulsed amperometric detection. J. Chromatogr. B Anal. Technol. Biomed. Life Sci. 2008, 865, 159–166. [Google Scholar] [CrossRef] [PubMed]
 - Ha, K.S.; Jo, S.H.; Kang, B.H.; Apostolidis, E.; Lee, M.S.; Jang, H.D.; Kwon, Y.I. In vitro and in vivo antihyperglycemic effect of 2 amadori rearrangement compounds, arginyl-fructose and arginyl-fructosyl-glucose. J Food Sci. 2011, 76, H188–H193. [Google Scholar] [CrossRef] [PubMed]
 - Lee, K.H.; Bae, I.Y.; Park, S.I.; Park, J.D.; Lee, H.G. Antihypertensive effect of Korean red ginseng by enrichment of ginsenoside Rg3 and arginine-fructose. J. Ginseng Res. 2016, 40, 237–244. [Google Scholar] [CrossRef] [PubMed][Green Version]
 - Lee, J.S.; Kim, G.N.; Lee, S.H.; Kim, E.S.; Ha, K.S.; Kwon, Y.I.; Jeong, H.S.; Jang, H.D. In vitro and cellular antioxidant activity of arginyl-fructose and arginyl-fructosyl-glucose. Food Sci. Biotechnol. 2009, 18, 1505–1510. [Google Scholar]
 - Hyun, S.H.; Kim, Y.S.; Lee, J.W.; Han, C.-K.; Partk, M.S.; So, S.-H. Immunomodulatory effects of arginine-fructose-glucose enriched extracts of red ginseng. J. Korean Soc. Food Sci. Nutr. 2018, 47, 1–6. [Google Scholar] [CrossRef]
 - Pyo, M.Y.; Hyun, S.M.; Yang, K.S. Effects of Phelinus linteus extracts on the humoral immune response in normal and cyclophosphamide-treated mice. J. Appl. Pharmacol. 2001, 9, 194–200. [Google Scholar]
 - Mischell, B.; Shiigi, S. Selected Methods in Cellular Immunology; W.H. Freeman and Company: San Francisco, CA, USA, 1980; p. 156. [Google Scholar]
 - Motoyoshi, Y.; Kaminoda, K.; Saitoh, O.; Hamasaki, K.; Nakao, K.; Ishii, N.; Nagayama, Y.; Eguchi, K. Different mechanisms for anti-tumor effects of low- and high-dose cyclophosphamide. Oncol. Rep. 2006, 16, 141–146. [Google Scholar] [CrossRef]
 - Kishimoto, T.; Akira, S.; Narazaki, M.; Taga, T. Interleukin-6 family of cytokines and gp130. Blood 1995, 86, 1243–1254. [Google Scholar] [CrossRef] [PubMed]
 - Zhou, F. Molecular mechanisms of IFN-γ to up-regulate MHC class I antigen processing and presentation. Int. Rev. Immunol. 2009, 28, 239–260. [Google Scholar] [CrossRef] [PubMed]
 



| Ginofos Extract (%) | |
|---|---|
| Arginyl-fructose | 3.61 ± 0.18 | 
| Fructose | 1.51 ± 0.11 | 
| Glucose | 0.14 ± 0.02 | 
| Sucrose | 0.49 ± 0.13 | 
| Maltose | 0.30 ± 0.02 | 
| Normal Control | CY Control | CY + GF | CY + AF | |
|---|---|---|---|---|
| Body weight (g) | 21.76 ± 0.62 a | 19.79 ± 1.12 b | 17.74 ± 0.86 c | 18.52 ± 0.95 c | 
| Liver (mg/g) | 41.94 ± 2.23 a | 42.89 ± 2.29 b | 40.00 ± 3.29 b | 38.29 ± 3.84 c | 
| Kidney (mg/g) | 12.88 ± 0.60 a | 13.61 ± 0.65 b | 13.16 ± 1.16 b | 13.26 ± 1.21 b | 
| Thymus (mg/g) | 2.61 ± 0.24 a | 0.59 ± 0.18 b | 0.86 ± 0.18 b,* | 0.94 ± 0.25 b,* | 
| Spleen (mg/g) | 2.85 ± 0.08 a | 1.47 ± 0.22 b | 1.61 ± 0.04 b | 1.63 ± 0.08 b | 
| Normal Control | CY Control | CY + GF | CY + AF | |
|---|---|---|---|---|
| IgM (μg/mL) | 530.37 ± 44.91 a | 230.37 ± 61.20 b | 430.37 ± 55.92 a,* | 430.37 ± 78.83 a,* | 
| IgG (μg/mL) | 618.03 ± 151.33 a | 216.52 ± 68.23 c | 395.03 ± 25.03 b,* | 398.33 ± 62.71 b,* | 
| Normal Control | CY Control | CY + GF | CY + AF | |
|---|---|---|---|---|
| AST (mg/dL) | 249.68 ± 60.72 b | 408.52 ± 126.03 a | 200.88 ± 68.88 b,* | 299.06 ± 101.20 ab | 
| ALT (mg/dL) | 35.74 ± 7.55 a | 40.92 ± 14.04 a | 33.92 ± 14.04 a | 31.50 ± 4.47 a | 
| TNF-α (pg/dL) | 111.90 ± 31.74 a | 91.38 ± 3.33 a | 87.06 ± 6.16 a | 100.52 ± 12.70 a | 
| Genes | Primer Sequences | |
|---|---|---|
| Forward (5′–3′) | Reverse (5′–3′) | |
| GAPDH | CCACCCAGAAGACTGTGGATGGC | CATGTAGGCCATGAGGTCCACCAC | 
| IL-2 | TCCACCACAGTTGCTGACTC | CCTGCATCTAGAGGCTGTCC | 
| IL-4 | CGAAGAACACCACAGAGAGTGAGCT | GACTCATTCATGGTGCAGCTTATCG | 
| IL-6 | AGAGGAGACTTCACAGAGGA | ATCTCTCTGAAGGACTCTGG | 
| IFN-γ | GCGTCATTGAATCACACCTG | TGAGCTCATTGAATGCTTGG | 
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.  | 
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yu, J.-A.; Lee, J.-Y.; Kim, T.Y.; Kang, H.; Lee, S.-Y.; Mitiku, H.; Park, J.; Lee, Y.H.; Chang, H.-B.; Lee, B.H.; et al. Immune Modulatory Activities of Arginyl-Fructose (AF) and AF-Enriched Natural Products in In-Vitro and In-Vivo Animal Models. Molecules 2021, 26, 2251. https://doi.org/10.3390/molecules26082251
Yu J-A, Lee J-Y, Kim TY, Kang H, Lee S-Y, Mitiku H, Park J, Lee YH, Chang H-B, Lee BH, et al. Immune Modulatory Activities of Arginyl-Fructose (AF) and AF-Enriched Natural Products in In-Vitro and In-Vivo Animal Models. Molecules. 2021; 26(8):2251. https://doi.org/10.3390/molecules26082251
Chicago/Turabian StyleYu, Jin-A, Jung-Yun Lee, Tae Yang Kim, Hanna Kang, Su-Young Lee, Haimanot Mitiku, Joonheum Park, Young Hwan Lee, Hung-Bae Chang, Byung Ha Lee, and et al. 2021. "Immune Modulatory Activities of Arginyl-Fructose (AF) and AF-Enriched Natural Products in In-Vitro and In-Vivo Animal Models" Molecules 26, no. 8: 2251. https://doi.org/10.3390/molecules26082251
APA StyleYu, J.-A., Lee, J.-Y., Kim, T. Y., Kang, H., Lee, S.-Y., Mitiku, H., Park, J., Lee, Y. H., Chang, H.-B., Lee, B. H., Lee, K., Apostolidis, E., & Kwon, Y.-I. (2021). Immune Modulatory Activities of Arginyl-Fructose (AF) and AF-Enriched Natural Products in In-Vitro and In-Vivo Animal Models. Molecules, 26(8), 2251. https://doi.org/10.3390/molecules26082251
        
                                                
