Essential Oil Composition and DNA Barcode and Identification of Aniba species (Lauraceae) Growing in the Amazon Region
Abstract
1. Introduction
2. Results and Discussion
2.1. Chemical Composition and Multivariate Analysis
2.2. DNA Barcode Analysis
3. Materials and Methods
3.1. Plant Material
3.2. Essential Oil Extraction
3.3. GC-MS Analysis
3.4. Statistical Analysis
3.5. Oligonucleotides Design
3.6. DNA Extraction, Amplification, and Sequencing
3.7. Sequence Identity and Phylogenetic Analysis
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
Sample Availability
References
- Angiosperm Phylogeny Group (APG) IV. An update of the Angiosperm Phylogeny Group classification for the orders and families of flowering plants: APG IV. Bot. J. Linn. Soc. 2016, 181, 1–20. [Google Scholar] [CrossRef] [Scilit]
- Chanderbali, A.S.; Van der Werff, H.; Renner, S.S. Phylogeny and historical biogeography of Lauraceae: Evidence from the chloroplast and nuclear genomes. Ann. Mo. Bot. Gard. 2001, 88, 104. [Google Scholar] [CrossRef] [Scilit]
- Rohwer, J.G. Lauraceae. In The Families and Genera of Vascular Plants: Magnoliid, Hamameliid and Caryophyliid Families; Kubitzki, K., Rohwer, J., Bittrich, G., Eds.; Springer: Berlin/Heidelberg, Germany, 1993; Volume 2, pp. 336–391. [Google Scholar] [CrossRef] [Scilit]
- Renner, S.S. Circumscription and phylogeny of the Laurales: Evidence from molecular and morphological data. Am. J. Bot. 1999, 86, 1301–1315. [Google Scholar] [CrossRef] [Scilit]
- Renner, S.S.; Chanderbali, A.S. What is the relationship among Hernandiaceae, Lauraceae, and Monimiaceae, and why is this question so difficult to answer? Int. J. Plant Sci. 2000, 161, S109–S119. [Google Scholar] [CrossRef] [Scilit]
- Contim, L.A.S.; Carvalho, C.R.; Martins, F.A.; Freitas, D.V. Nuclear DNA content and karyotype of rosewood (Aniba rosaeodora). Genet. Mol. Biol. 2005, 28, 754–757. [Google Scholar] [CrossRef] [Scilit]
- Sobral, M.; Proença, C.; Souza, M.; Mazine, F.; Lucas, E. Lista de Espécies da Flora do Brasil. 2020. Available online: http://floradobrasil.jbrj.gov.br (accessed on 2 September 2020).
- Tropicos. Lauraceae Juss. Missouri Botanical Garden. Available online: http://www.tropicos.org (accessed on 3 February 2021).
- Maia, J.G.S.; Andrade, E.H.A.; Couto, H.A.R.; Silva, A.C.M.; Marx, F.; Henke, C. Plant sources of amazon rosewood oil. Quim. Nova 2007, 30, 1906–1910. [Google Scholar] [CrossRef] [Scilit]
- Maia, J.G.S.; Andrade, E.H.A. Database of the Amazon aromatic plants and their essential oils. Quim. Nova 2009, 32, 595–622. [Google Scholar] [CrossRef] [Scilit]
- Maia, J.G.S.; Mourão, R.H.V. Amazon rosewood (Aniba rosaeodora Ducke and A. parviflora) oils. In Essential Oils in Food Preservation, Flavor and Safety; Elsevier: Amsterdam, The Netherlands, 2016; pp. 193–201. [Google Scholar] [CrossRef] [Scilit]
- D’Acampora, Z.B.; Lo Presti, M.; Barata, L.E.S.; Dugo, P.; Dugo, G.; Mondello, L. Evaluation of leaf-derived extracts as an environmentally sustainable source of essential oils by using gas chromatography-mass spectrometry and enantioselective gas chromatography-olfactometry. Anal. Chem 2006, 78, 883–890. [Google Scholar] [CrossRef] [Scilit]
- Tranchida, P.; Souza, R.; Barata, L.; Mondello, M.; Dugo, P.; Dugo, G.; Mondello, L. Analysis of macacaporanga (Aniba parviflora) leaf essential oil by using comprehensive two-dimensional gas chromatography combined with rapid-scanning quadrupole mass spectrometry. Chromatogr. Today 2008, 1, 5–9. [Google Scholar]
- Andrade, E.H.A.; Zoghbi, M.G.B.; Maia, J.G.S. Volatiles from Aniba terminalis Ducke. J. Essent. Oil Res. 2003, 15, 81–82. [Google Scholar] [CrossRef] [Scilit]
- Da Silva, J.K.R.; Sousa, P.J.C.; Andrade, E.H.A.; Maia, J.G.S. Antioxidant capacity and cytotoxicity of essential oil and methanol extract of Aniba canelilla (H.B.K.) Mez. J. Agric. Food Chem. 2007, 55, 9422–9426. [Google Scholar] [CrossRef] [Scilit]
- Maia, J.G.S.; Zoghbi, M.G.B.; Andrade, E.H.A. Plantas Aromáticas na Amazônia e Seus Óleos Essenciais; Museu Paraense Emilio Goeldi: Belém, Brazil, 2001. [Google Scholar]
- Souza, F.J.C., Jr.; Luz-Moraes, D.; Pereira, F.S.; Barros, M.A.; Fernandes, L.M.P.; Queiroz, L.Y.; Maia, C.F.; Maia, J.G.S.; Fontes-Junior, E.A. Aniba canelilla (Kunth) Mez (Lauraceae): A review of ethnobotany, phytochemical, antioxidant, anti-inflammatory, cardiovascular, and neurological properties. Front. Pharmacol. 2020, 11, 699. [Google Scholar] [CrossRef] [Scilit]
- Brito, T.S.; Lima, F.J.B.; Aragão, K.S.; De Siqueira, R.J.B.; Sousa, P.J.C.; Maia, J.G.S.; Filho, J.D.; Lahlou, S.; Magalhães, P.J.C. The vasorelaxant effects of 1-nitro-2-phenylethane involve stimulation of the soluble guanylate cyclase-cGMP pathway. Biochem. Pharmacol. 2013, 85, 780–788. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- De Siqueira, R.J.B.; Macedo, F.I.B.; Interaminense, L.F.L.; Duarte, G.P.; Magalhães, P.J.C.; Brito, T.S.; Da Silva, J.K.R.; Maia, J.G.S.; Sousa, P.J.C.; Leal-Cardoso, J.H.; et al. 1-Nitro-2-phenylethane, the main constituent of the essential oil of Aniba canelilla, elicits a vago-vagal bradycardiac and depressor reflex in normotensive rats. Eur. J. Pharmacol. 2010, 638, 90–98. [Google Scholar] [CrossRef] [Scilit]
- Interaminense, L.F.L.; De Siqueira, R.J.B.; Xavier, F.E.; Duarte, G.P.; Magalhães, P.J.C.; Da Silva, J.K.; Maia, J.G.S.; Sousa, P.J.C.; Leal-Cardoso, J.H.; Lahlou, S. Cardiovascular effects of 1-nitro-2-phenylethane, the main constituent of the essential oil of Aniba canelilla, in spontaneously hypertensive rats. Fundam. Clin. Pharmacol. 2011, 25, 661–669. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Interaminense, L.F.L.; Ramos-Alves, F.E.; De Siqueira, R.J.B.; Xavier, F.E.; Duarte, G.P.; Magalhães, P.J.C.; Maia, J.G.S.; Sousa, P.J.C.; Lahlou, S. Vasorelaxant effects of 1-nitro-2-phenylethane, the main constituent of the essential oil of Aniba canelilla, in superior mesenteric arteries from spontaneously hypertensive rats. Eur. J. Pharm. Sci. 2013, 48, 709–716. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lahlou, S.; Magalhães, P.J.C.; de Siqueira, R.J.B.; Figueiredo, A.F.; Interaminense, L.F.L.; Maia, J.G.S.; Sousa, P.J.C. Cardiovascular effects of the essential oil of Aniba canelilla bark in normotensive rats. J. Cardiovasc. Pharmacol. 2005, 46, 412–421. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dos Santos, É.R.Q.; Maia, C.S.F.; Fontes, E.A., Jr.; Melo, A.S.; Pinheiro, B.G.; Maia, J.G.S. Linalool-rich essential oils from the Amazon display antidepressant-type effect in rodents. J. Ethnopharmacol. 2018, 212, 43–49. [Google Scholar] [CrossRef] [Scilit]
- Baldisserotto, B.; Barata, L.E.S.; Silva, A.S.; Lobato, W.F.F.; Silva, L.L.; Toni, C.; Silva, L.V.F. Anesthesia of tambaqui Colossoma macropomum (Characiformes: Serrasalmidae) with the essential oils of Aniba rosaeodora and Aniba parviflora and their major compound, linalool. Neotrop. Ichthyol. 2018, 1, 16. [Google Scholar] [CrossRef] [Scilit]
- De Almeida, R.N.; Araújo, D.A.M.; Gonçalves, J.C.R.; Montenegro, F.C.; De Sousa, D.P.; Leite, J.R.; Mattei, R.; Benedito, M.A.C.; De Carvalho, J.G.B.; Cruz, J.S.; et al. Rosewood oil induces sedation and inhibits compound action potential in rodents. J. Ethnopharmacol. 2009, 124, 440–443. [Google Scholar] [CrossRef] [Scilit]
- De Moura, V.M.; Da Costa Guimarães, N.; Batista, L.T.; Freitas-de-Sousa, L.A.; De Sousa Martins, J.; De Souza, M.C.S.; de Almeida, O.P.D.; Monteiro, W.M.; De Oliveira, R.B.; Dos-Santos, M.C.; et al. Assessment of the anti-snakebite properties of extracts of Aniba fragrans Ducke (Lauraceae) used in folk medicine as complementary treatment in cases of envenomation by Bothrops atrox. J. Ethnopharmacol. 2018, 213, 350–358. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hopkins, M.J.G. Modelling the known and unknown plant biodiversity of the Amazon Basin. J. Biogeogr. 2007, 34, 1400–1411. [Google Scholar] [CrossRef] [Scilit]
- Kubitzki, K.; Renner, S. Lauraceae I (Aniba and Aiouea). Flora Neotrop. 1982, 31, 1–124. [Google Scholar]
- Matta, A.; Carvalho, R.B.; Vicentini, A. Aniba inaequabilis (Lauraceae), a new species from Peru. Phytotaxa 2016, 282, 139. [Google Scholar] [CrossRef] [Scilit]
- Van der Werff, H. A key to the genera of Lauraceae in the new world. Ann. Mo. Bot. Gard. 1991, 78, 377. [Google Scholar] [CrossRef] [Scilit]
- Franciscon, C.H.; Miranda, I.S. Distribution and conservation of Aniba Aubl. (Lauraceae Jussieu) species in Brazil. Biota Neotrop. 2018, 18, 362. [Google Scholar] [CrossRef] [Scilit]
- Hwang, S.W.; Kobayashi, K.; Zhai, S.; Sugiyama, J. Automated identification of Lauraceae by scale-invariant feature transform. J. Wood Sci. 2018, 64, 69–77. [Google Scholar] [CrossRef] [Scilit]
- Hebert, P.D.N.; Gregory, T.R. The promise of DNA barcoding for taxonomy. Syst. Biol. 2005, 54, 852–859. [Google Scholar] [CrossRef] [Scilit]
- Kress, W.J.; Erickson, D.L. A two-locus global DNA barcode for land plants: The coding RBCL gene complements the non-coding trnH-psbA spacer region. PLoS ONE 2007, 2, e508. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shneyer, V.S.; Rodionov, A.V. Plant DNA barcodes. Biol. Bull. Rev. 2019, 9, 295–300. [Google Scholar] [CrossRef] [Scilit]
- Hollingsworth, P.M.; Forrest, L.L.; Spouge, J.L.; Hajibabaei, M.; Ratnasingham, S.; van der Bank, M.; Chase, M.W.; Cowan, R.S.; Erickson, D.L.; Fazekas, A.J.; et al. A DNA barcode for land plants. Proc. Natl. Acad. Sci. USA 2009, 106, 12794–12797. [Google Scholar] [CrossRef] [Scilit]
- Liu, Z.F.; Ci, X.Q.; Li, L.; Li, H.W.; Conran, J.G.; Li, J. DNA barcoding evaluation and implications for phylogenetic relationships in Lauraceae from China. PLoS ONE 2017, 12, e0175788. [Google Scholar] [CrossRef] [Scilit]
- Zhang, M.; Yahara, T.; Tagane, S.; Rueangruea, S.; Suddee, S.; Moritsuka, E.; Suyama, Y. Cryptocarya kaengkrachanensis, a new species of Lauraceae from Kaeng Krachan National Park, southwest Thailand. PhytoKeys 2020, 140, 139–157. [Google Scholar] [CrossRef] [Scilit]
- Packer, L.; Gibbs, J.; Sheffield, C.; Hanner, R. DNA barcoding and the mediocrity of morphology. Mol. Ecol. Resour. 2009, 9, 42–50. [Google Scholar] [CrossRef] [Scilit]
- Wang, F.H.; Lu, J.M.; Wen, J.; Ebihara, A.; Li, D.Z. Applying DNA Barcodes to Identify Closely Related Species of Ferns: A Case Study of the Chinese Adiantum (Pteridaceae). PLoS ONE 2016, 11, e0160611. [Google Scholar] [CrossRef] [Scilit]
- Mondello, L. FFNSC 2: Flavors and Fragrances of Natural and Synthetic Compounds, Mass Spectral Database; John Wiley & Sons Inc.: Hoboken, NJ, USA, 2011. [Google Scholar]
- Adams, R.P. Identification of Essential Oil Components by Gas Chromatography/Mass Spectrometry; Allured Publishing Corporation: Carol Stream, IL, USA, 2007. [Google Scholar]
- Sarrazin, S.; Oliveira, R.; Maia, J.; Mourão, R. Antibacterial activity of the rosewood (Aniba rosaeodora and A. parviflora) linalool-rich oils from the Amazon. Eur. J. Med. Plants 2016, 12, 1–9. [Google Scholar] [CrossRef] [Scilit]
- Souza, R.C.Z.; Eiras, M.M.; Cabral, E.C.; Barata, L.E.S.; Eberlin, M.N.; Catharino, R.R. The famous amazonian rosewood essential oil: Characterization and adulteration monitoring by electrospray ionization mass spectrometry fingerprinting. Anal. Lett. 2011, 44, 2417–2422. [Google Scholar] [CrossRef] [Scilit]
- Zoghbi, M.G.B.; Ohashi, S.T.; Salomão, R.P.; Guilhon, G.M.S.P. Chemical variability of Aniba rosaeodora oils. Glob. J. Sci. Front. Res. B Chem. 2015, 15, 780. [Google Scholar]
- Hebert, P.D.N.; Cywinska, A.; Ball, S.L.; DeWaard, J.R. Biological identifications through DNA barcodes. Proc. R. Soc. Lond. Ser. B Biol. Sci. 2003, 270, 313–321. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kress, W.J.; Erickson, D.L.; Jones, F.A.; Swenson, N.G.; Perez, R.; Sanjur, O.; Bermingham, E. Plant DNA barcodes and a community phylogeny of a tropical forest dynamics plot in Panama. Proc. Natl. Acad. Sci. USA 2009, 106, 18621–18626. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dong, W.; Xu, C.; Li, C.; Sun, J.; Zuo, Y.; Shi, S.; Cheng, T.; Guo, J.; Zhou, S. Ycf1, the most promising plastid DNA barcode of land plants. Sci. Rep. 2015, 5, 8348. [Google Scholar] [CrossRef] [Scilit]
- Kang, Y.; Deng, Z.; Zang, R.; Long, W. DNA barcoding analysis and phylogenetic relationships of tree species in tropical cloud forests. Sci. Rep. 2017, 7, 12564. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kress, W.J.; Wurdack, K.J.; Zimmer, E.A.; Weigt, L.A.; Janzen, D.H. Use of DNA barcodes to identify flowering plants. Proc. Natl. Acad. Sci. USA 2005, 102, 8369–8374. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cruz-Maya, M.E.; Barrientos-Priego, A.F.; Zelaya-Molina, L.X.; Rodríguez-de la O, J.L.; Reyes-Alemán, J.C. Phylogenetic analysis of some members of the subgenus Persea (Persea, Lauraceae). Rev. Chapingo Ser. Hortic. 2018, 24, 133–150. [Google Scholar] [CrossRef] [Scilit]
- Trofimov, D.; De Moraes, P.L.R.; Rohwer, J.G. Towards a phylogenetic classification of the Ocotea complex (Lauraceae): Classification principles and reinstatement of Mespilodaphne. Bot. J. Linn. Soc. 2019, 190, 25–50. [Google Scholar] [CrossRef] [Scilit]
- Zhao, M.-L.; Song, Y.; Ni, J.; Yao, X.; Tan, Y.-H.; Xu, Z.-F. Comparative chloroplast genomics and phylogenetics of nine Lindera species (Lauraceae). Sci. Rep. 2018, 8, 8844. [Google Scholar] [CrossRef] [Scilit]
- Roy, S.; Tyagi, A.; Shukla, V.; Kumar, A.; Singh, U.M.; Chaudhary, L.B.; Datt, B.; Bag, S.K.; Singh, P.K.; Nair, N.K.; et al. Universal plant DNA barcode loci may not work in complex groups: A case study with Indian Berberis species. PLoS ONE 2010, 5, e13674. [Google Scholar] [CrossRef] [Scilit]
- Yan, H.F.; Hao, G.; Hu, C.M.; Ge, X.J. DNA barcoding in closely related species: A case study of Primula, L. sect. Proliferae Pax (Primulaceae) in China. J. Syst. Evol. 2011, 49, 225–236. [Google Scholar] [CrossRef] [Scilit]
- Hollingsworth, P.M.; Graham, S.W.; Little, D.P. Choosing and using a plant DNA barcode. PLoS ONE 2011, 6, e19254. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gonzalez, M.A.; Baraloto, C.; Engel, J.; Mori, S.A.; Pétronelli, P.; Riéra, B.; Roger, A.; Thébaud, C.; Chave, J. Identification of Amazonian trees with DNA barcodes. PLoS ONE 2009, 4, e7483. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, Z.; Chen, S.L.; Song, J.Y.; Zang, S.I.; Chen, K.L. Application of deoxyribonucleic acid barcoding in Lauraceae plants. Pharmacogn. Mag. 2012, 8, 4. [Google Scholar] [CrossRef] [Scilit]
- Nie, Z.L.; Wen, J.; Sun, H. Phylogeny and biogeography of Sassafras (Lauraceae) disjunct between eastern Asia and eastern North America. Plant. Syst. Evol. 2007, 267, 191–203. [Google Scholar] [CrossRef] [Scilit]
- Tautz, D.; Arctander, P.; Minelli, A.; Thomas, R.H.; Vogler, A.P. A plea for DNA taxonomy. Trends Ecol. Evol. 2003, 18, 70–74. [Google Scholar] [CrossRef] [Scilit]
- Newmaster, S.G.; Fazekas, A.J.; Ragupathy, S. DNA barcoding in land plants: Evaluation of rbcL in a multigene tiered approach. Can. J. Bot. 2006, 84, 335–341. [Google Scholar] [CrossRef] [Scilit]
- Rohwer, J.G. Toward a phylogenetic classification of the Lauraceae: Evidence from matK sequences. Syst. Bot. 2000, 25, 60. [Google Scholar] [CrossRef] [Scilit]
- Giovino, A.; Martinelli, F.; Perrone, A. The technique of plant DNA barcoding: Potential application in floriculture. Caryologia. Int. J. Cytol. Cytosyst. Cytogenet. 2020, 73, 27–38. [Google Scholar] [CrossRef] [Scilit]
- Lv, Y.N.; Yang, C.Y.; Shi, L.C.; Zhang, Z.L.; Xu, A.S.; Zhang, L.X.; Li, X.L.; Li, H.T. Identification of medicinal plants within the Apocynaceae family using ITS2 and psbA-trnH barcodes. Chin. J. Nat. Med. 2020, 18, 594–605. [Google Scholar] [CrossRef] [Scilit]
- Feng, S.; Jiao, K.; Zhu, Y.; Wang, H.; Jiang, M.; Wang, H. Molecular identification of species of Physalis (Solanaceae) using a candidate DNA barcode: The chloroplast psbA-trnH intergenic region. Genome 2018, 61, 15–20. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dong, W.; Liu, J.; Yu, J.; Wang, L.; Zhou, S. Highly variable chloroplast markers for evaluating plant phylogeny at low taxonomic levels and for DNA barcoding. PLoS ONE 2012, 7, e35071. [Google Scholar] [CrossRef] [Scilit]
- Mahadani, P.; Ghosh, S.K. Utility of indels for species-level identification of a biologically complex plant group: A study with intergenic spacer in Citrus. Mol. Biol. Rep. 2014, 41, 7217–7222. [Google Scholar] [CrossRef] [Scilit]
- Wu, F.; Li, M.; Liao, B.; Shi, X.; Xu, Y. DNA barcoding analysis and phylogenetic relation of mangroves in Guangdong Province, China. Forests 2019, 10, 56. [Google Scholar] [CrossRef] [Scilit]
- Amazonas, D.R.; Oliveira, C.; Barata, L.E.S.; Tepe, E.J.; Kato, M.J.; Mourão, R.H.V.; Yamaguchi, L.F. Chemical and genotypic variations in Aniba rosiodora from the Brazilian Amazon Forest. Molecules 2020, 26, 69. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gottlieb, O.R.; Kubitzki, K. Chemosystematics of Aniba. Biochem. Syst. Ecol. 1981, 9, 5–12. [Google Scholar] [CrossRef] [Scilit]
- Da Silva, J.; da Trindade, R.; Moreira, E.; Maia, J.; Dosoky, N.; Miller, R.; Cseke, L.; Setzer, W. Chemical diversity, biological activity, and genetic aspects of three Ocotea species from the Amazon. Int. J. Mol. Sci. 2017, 18, 1081. [Google Scholar] [CrossRef] [Scilit]
- Van Den Dool, H.; Kratz, P. A generalization of the retention index system including linear temperature programmed gas-liquid partition chromatography. J. Chromatogr. 1963, A11, 463–471. [Google Scholar] [CrossRef] [Scilit]
- Lias, S.G.; Mikaia, A.I.; Sparkman, O.D.; Stein, S.E.; Zaikin, G. The NIST/EPA/NIH Mass Spectral Database: Simultaneous Control of Quality and Quantity. 1997. Available online: https://www.nist.gov/publications/nistepanih-mass-spectral-database-simultaneous-control-quality-and-quantity (accessed on 26 February 2021).
- Tate, J.A.; Simpson, B.B. Paraphyly of Tarasa (Malvaceae) and diverse origins of the polyploid species. Syst. Bot. 2003, 28, 723–737. [Google Scholar] [CrossRef]
- Edgar, R.C. MUSCLE: Multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 2004, 32, 1792–1797. [Google Scholar] [CrossRef] [Scilit]
- Sang, T.; Crawford, D.J.; Stuessy, T.F. Chloroplast DNA phylogeny, reticulate evolution, and biogeography of Paeonia (Paeoniaceae). Am. J. Bot. 1997, 84, 1120–1136. [Google Scholar] [CrossRef] [Scilit]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [Scilit]
- Katoh, K.; Standley, D.M. MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Mol. Biol. Evol. 2013, 30, 772–780. [Google Scholar] [CrossRef] [Scilit]
- Zhang, D.; Gao, F.; Jakovlić, I.; Zou, H.; Zhang, J.; Li, W.X.; Wang, G.T. PhyloSuite: An integrated and scalable desktop platform for streamlined molecular sequence data management and evolutionary phylogenetics studies. Mol. Ecol. Resour. 2020, 20, 348–355. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nguyen, L.T.; Schmidt, H.A.; von Haeseler, A.; Minh, B.Q. IQ-TREE: A fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Mol. Biol. Evol. 2015, 32, 268–274. [Google Scholar] [CrossRef] [Scilit]
- Ronquist, F.; Teslenko, M.; van der Mark, P.; Ayres, D.L.; Darling, A.; Höhna, S.; Larget, B.; Liu, L.; Suchard, M.A.; Huelsenbeck, J.P. MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Syst. Biol. 2012, 61, 539–542. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kalyaanamoorthy, S.; Minh, B.Q.; Wong, T.K.F.; Von Haeseler, A.; Jermiin, L.S. ModelFinder: Fast model selection for accurate phylogenetic estimates. Nat. Methods 2017, 14, 587–589. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rambaut, A. FigTree. Version 1.4.4. 2018. Available online: http://tree.bio.ed.ac.uk/software/figtree/ (accessed on 20 December 2020).
- Rozas, J.; Ferrer-Mata, A.; Sánchez-DelBarrio, J.C.; Guirao-Rico, S.; Librado, P.; Ramos-Onsins, S.E.; Sánchez-Gracia, A. DnaSP 6: DNA sequence polymorphism analysis of large data sets. Mol. Biol. Evol. 2017, 34, 3299–3302. [Google Scholar] [CrossRef] [Scilit]





| Oil Yield (%) | 1.5 | 1.0 | 1.6 | 0.9 | 1.8 | 1.6 | 1.3 | 0.7 | ||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Constituents (%) | Class | CAS Number | RI(C) | RI(L) | AC-L | AC-T | AP-L | AP-T | AR-L | AR-T | AT-L | AT-T |
| (3E)-Hexenol | O | 928-97-2 | 848 | 844 1 | - | - | - | - | 0.2 | - | - | - |
| (3Z)-Hexenol | O | 928-96-1 | 846 | 850 1 | - | - | 1.0 | - | - | - | - | - |
| 1-Hexanol | O | 111-27-3 | 860 | 863 1 | - | - | - | - | 0.2 | - | - | - |
| α-Thujene | MH | 2867-05-2 | 828 | 924 1 | - | - | 0.3 | 0.2 | - | - | 0.2 | 0.1 |
| α-Pinene | MH | 80-56-8 | 934 | 932 1 | - | 2.1 | 10.6 | 4.7 | - | 0.3 | 4.3 | 3.8 |
| Camphene | MH | 79-92-5 | 945 | 946 1 | - | - | 2.4 | 1.7 | - | - | 0.7 | 2.0 |
| Benzaldehyde | BZ | 100-52-7 | 954 | 952 1 | 0.1 | 0.1 | - | - | - | - | 0.4 | - |
| Sabinene | MH | 3387-41-5 | 972 | 969 1 | - | - | - | - | - | - | - | 2.2 |
| β-Pinene | MH | 18172-67-3 | 973 | 974 1 | - | 1.3 | 6.4 | 3.5 | - | 0.2 | 1.5 | 3.6 |
| Myrcene | MH | 123-35-3 | 985 | 988 1 | - | 0.4 | 3.2 | 4.1 | 0.3 | 0.4 | 3.6 | - |
| α-Phellandrene | MH | 99-83-2 | 1000 | 1002 1 | - | 0.2 | 1.3 | 3.0 | - | - | 51.8 | 36.0 |
| α-Terpinene | MH | 99-86-5 | 1012 | 1014 1 | - | - | 0.2 | 0.5 | - | - | - | - |
| cis-p-menth-2-en-1-ol | OM | 53399-74-9 | 1124 | 1118 1 | - | - | 0.1 | 0.1 | - | - | - | - |
| p-Cymene | MH | 99-87-6 | 1020 | 1020 1 | - | 0.1 | 1.0 | 0.4 | - | - | 12.0 | 7.5 |
| Limonene | MH | 5989-27-5 | 1024 | 1024 1 | - | - | - | - | 0.2 | 0.3 | - | - |
| β-Phellandrene | MH | 555-10-2 | 1026 | 1025 1 | - | 2.8 | 22.6 | 25.4 | - | - | 11.6 | 11.9 |
| (Z)-β-Ocimene | MH | 3338-55-4 | 1032 | 1032 1 | - | - | - | 3.3 | - | 0.1 | 1.4 | 1.8 |
| Benzene acetaldehyde | BZ | 122-78-1 | 1037 | 1036 1 | 2.7 | 0.5 | - | - | - | - | - | - |
| (E)-β-Ocimene | MH | 3779-61-1 | 1043 | 1044 1 | - | 0.5 | 1.7 | - | 0.1 | 0.2 | 0.4 | 0.7 |
| γ-Terpinene | MH | 99-85-4 | 1056 | 1054 1 | - | - | 0.6 | 0.7 | - | - | 0.2 | 0.1 |
| Acetophenone | BZ | 98-86-2 | 1061 | 1059 1 | - | - | - | - | - | - | - | - |
| cis-Linalool oxide (furanoid) | OM | 23007-29-6 | 1071 | 1067 1 | - | - | 0.3 | - | 5.4 | 2.6 | 0.1 | - |
| trans-Linalool oxide (furanoid) | OM | 41720-60-9 | 1089 | 1084 1 | - | - | 0.4 | - | 4.9 | 2.5 | - | - |
| Terpinolene | MH | 586-62-9 | 1088 | 1086 1 | - | - | - | 0.2 | - | - | 1.0 | 0.6 |
| Linalool | OM | 78-70-6 | 1102 | 1095 1 | 3.9 | 16.1 | 21.9 | 15.2 | 67.9 | 75.3 | - | 19.0 |
| trans-Pinene hydrate | OM | 4948-29-2 | 1112 | 1119 1 | - | - | - | - | - | 0.1 | - | - |
| allo-Ocimene | MH | 3016-19-1 | 1131 | 1128 1 | - | - | - | - | - | - | 0.1 | 0.1 |
| Benzene acetonitrile | BZ | 140-29-4 | 1138 | 1134 1 | 0.4 | 0.4 | - | - | - | - | - | - |
| iso-3-Thujanol | OM | 33766-31-3 | 1141 | 1134 1 | - | - | - | 0.1 | - | - | - | - |
| trans-Pinocarveol | OM | 547-61-5 | 1141 | 1135 1 | - | - | 0.2 | - | - | - | - | - |
| Borneol | OM | 6627-72-1 | 1168 | 1165 1 | - | - | 0.5 | 0.4 | - | - | 0.1 | 0.5 |
| cis-Linalool oxide (pyranoid) | OM | 22628-11-1 | 1172 | 1170 1 | - | - | - | - | 0.3 | 0.1 | - | - |
| trans-Linalool oxide (pyranoid) | OM | 41720-62-1 | 1176 | 1173 1 | - | - | - | - | 0.4 | 0.2 | - | - |
| Terpinen-4-ol | OM | 562-74-3 | 1181 | 1174 1 | - | - | 0.7 | 0.7 | - | - | 0.1 | 0.1 |
| p-Cymen-8-ol | OM | 1197-01-9 | 1188 | 1179 1 | - | - | - | - | - | - | 0.1 | - |
| Cryptone | OM | 500-02-7 | 1190 | 1183 1 | 0.1 | - | 0.1 | - | - | - | - | |
| α-Terpineol | OM | 98-55-5 | 1195 | 1186 1 | 0.3 | 0.4 | 3.9 | 3.9 | 0.2 | 0.6 | 0.8 | 0.9 |
| trans-Piperitol | OM | 16721-39-4 | 1206 | 1207 1 | - | - | - | - | - | - | - | - |
| Nerol | OM | 106-25-2 | 1231 | 1227 1 | - | - | - | - | - | 0.1 | - | - |
| Geraniol | OM | 106-24-1 | 1256 | 1249 1 | - | - | - | - | 0.1 | 0.2 | - | - |
| 2-Phenylethyl acetate | BZ | 103-45-7 | 1258 | 1254 1 | 0.2 | 0.1 | - | - | - | - | - | - |
| Thymol | OM | 89-83-8 | 1289 | 1289 1 | - | - | - | - | - | - | - | 0.1 |
| 1-Nitro-2-phenylethane | BZ | 6125-24-2 | 1297 | 1294 1 | 88.3 | 70.9 | 0.1 | 0.2 | 0.1 | 0.2 | - | - |
| δ-Elemene | SH | 20307-84-0 | 1340 | 1335 1 | - | - | 0.3 | 0.1 | - | - | - | - |
| α-Cubebene | SH | 17699-14-8 | 1352 | 1345 1 | - | 0.3 | 0.1 | 1.3 | - | - | 0.1 | 0.4 |
| Eugenol | PP | 97-53-0 | 1358 | 1356 1 | 0.1 | 0.3 | - | - | - | - | - | - |
| Methyl p-anisate | BZ | 121-98-2 | 1374 | 1375 2 | - | - | - | - | 0.2 | 0.1 | - | - |
| α-Copaene | SH | 3856-25-5 | 1379 | 1374 1 | 0.1 | 0.3 | - | 0.3 | 1.1 | 0.5 | 0.1 | 0.1 |
| β-Elemene | SH | 33880-83-0 | 1395 | 1389 1 | - | - | 0.2 | 0.4 | 0.2 | 0.2 | 0.4 | 0.6 |
| 7-epi-Sesquithujene | SH | 159407-35-9 | 1392 | 1390 1 | - | - | - | 0.3 | - | - | - | 0.1 |
| (Z)-Caryophyllene | SH | 118-65-0 | 1411 | 1408 1 | 0.5 | - | - | - | - | - | - | - |
| (E)-Caryophyllene | SH | 87-44-5 | 1424 | 1417 1 | - | 0.8 | 2.8 | 1.9 | 0.2 | 0.3 | 1.2 | 0.8 |
| trans-α-Bergamotene | SH | 13474-59-4 | 1439 | 1432 2 | - | - | - | 0.1 | - | - | - | - |
| Aromadendrene | SH | 109119-91-7 | 1444 | 1439 1 | - | - | 0.5 | - | - | - | - | - |
| (Z)-β-Farnesene | SH | 28973-97-9 | 1433 | 1440 1 | - | - | 0.1 | 1.5 | - | - | 0.1 | 0.5 |
| α-Himachalene | SH | 3853-83-6 | 1447 | 1449 1 | - | - | 0.2 | - | - | - | - | - |
| (E)-β-Farnesene | SH | 18794-84-8 | 1459 | 1454 1 | - | - | - | 1.2 | - | - | 0.4 | |
| α-Humulene | SH | 6753-98-6 | 1459 | 1454 1 | - | 0.2 | 0.4 | - | - | - | 0.2 | - |
| α-Acoradiene | SH | 24048-44-0 | 1464 | 1464 1 | - | - | 0.2 | - | - | - | - | - |
| γ-Muurolene | SH | 30021-74-0 | 1474 | 1478 1 | - | - | - | - | - | - | 0.1 | - |
| γ-Gurjunene | SH | 22567-17-5 | 1480 | 1475 1 | - | - | - | - | 0.3 | - | - | - |
| γ-Curcumene | SH | 28976-68-3 | 1483 | 1481 1 | - | - | - | 0.2 | - | - | - | - |
| Germacrene D | SH | 23986-74-5 | 1484 | 1484 1 | - | - | 0.4 | 0.6 | - | - | 0.3 | 0.3 |
| β-Selinene | SH | 17066-67-0 | 1492 | 1489 1 | - | 0.3 | 0.1 | 0.6 | 2.9 | 0.5 | 0.2 | 0.1 |
| α-Selinene | SH | 473-13-2 | 1497 | 1498 2 | - | 0.2 | 1.1 | - | - | - | 0.2 | |
| Valencene | SH | 4630-07-3 | 1501 | 1496 1 | - | - | - | - | 2.4 | 0.4 | 0.2 | |
| Bicyclogermacrene | SH | 67650-90-2 | 1502 | 1500 1 | - | - | 1.9 | 0.9 | - | - | - | - |
| α-Muurolene | SH | 10208-80-7 | 1505 | 1500 1 | - | - | - | 0.1 | - | - | - | - |
| (E,E)-α-Farnesene | SH | 502-61-4 | 1504 | 1505 1 | - | - | - | - | - | - | 0.1 | 0.1 |
| γ-Cadinene | SH | 483-74-9 | 1512 | 1513 2 | - | - | - | - | - | - | 0.1 | 0.1 |
| β-Curcumene | SH | 28976-67-2 | 1516 | 1514 1 | - | - | - | 0.3 | - | - | - | - |
| 7-epi-α-Selinene | SH | 28290-23-5 | 1524 | 1520 1 | - | - | 0.1 | 0.1 | - | - | - | - |
| δ-Cadinene | SH | 483-76-1 | 1521 | 1522 1 | - | 0.1 | 0.2 | 0.9 | - | 0.1 | 0.2 | 0.2 |
| trans-Cadina-1,4-diene | SH | 38758-02-0 | 1537 | 1533 1 | - | - | - | 0.1 | - | - | - | - |
| cis-Sesquisabinene hydrate | OS | 58319-05-4 | 1548 | 1542 1 | - | - | - | 0.2 | - | - | - | 0.1 |
| Elemol | OS | 639-99-6 | 1554 | 1548 1 | - | - | 0.2 | 2.0 | - | - | 0.9 | 1.3 |
| Germacrene B | SH | 15423-57-1 | 1559 | 1559 1 | - | - | - | - | 0.1 | - | - | - |
| (E)-Nerolidol | OS | 40716-66-3 | 1567 | 1561 1 | - | - | 0.2 | 0.6 | 0.1 | 0.2 | 0.1 | 0.3 |
| Palustrol | OS | 5986-49-2 | 1575 | 1567 1 | - | - | 0.2 | - | - | - | - | - |
| Spathulenol | OS | 6750-60-3 | 1584 | 1577 1 | - | 0.1 | 3.4 | 0.9 | 1.0 | 0.6 | 0.1 | 0.2 |
| Caryophyllene oxide | OS | 1139-30-6 | 1587 | 1582 1 | 2.4 | 0.1 | 1.7 | 0.7 | 1.6 | 1.0 | 0.2 | 0.3 |
| Viridiflorol | OS | 552-02-3 | 1598 | 1592 1 | - | - | - | 0.1 | - | - | - | - |
| Cubeban-11-ol | OS | 864875-70-7 | 1600 | 1595 1 | - | - | 0.3 | - | - | - | - | - |
| Guaiol | OS | 489-86-1 | 1603 | 1600 1 | - | - | - | 1.0 | - | - | 0.5 | 0.4 |
| Rosifoliol | OS | 63891-61-2 | 1606 | 1600 1 | - | - | 0.4 | 0.4 | - | - | - | 0.1 |
| Khusimone | OS | 30557-76-7 | 1603 | 1604 1 | - | - | 0.3 | - | - | - | - | - |
| β-Atlantol | OS | 38142-56-2 | 1609 | 1608 1 | - | - | 0.2 | - | - | - | - | - |
| Humulene epoxide II | OS | 19888-34-7 | 1616 | 1608 1 | - | - | - | - | 0.4 | 0.1 | 0.1 | - |
| Junenol | OS | 472-07-1 | 1619 | 1618 1 | - | - | - | - | 0.2 | 0.3 | - | - |
| 10-epi-γ-Eudesmol | OS | 15051-81-7 | 1626 | 1622 1 | - | - | - | 0.2 | - | - | - | - |
| epi-γ-Eudesmol | OS | 117066-77-0 | 1627 | 1624 2 | - | - | - | 0.3 | - | - | - | - |
| Eremoligenol | OS | 10219-71-3 | 1629 | 1629 1 | - | - | 0.3 | - | - | - | - | 0.2 |
| γ-Eudesmol | OS | 1209-71-8 | 1638 | 1630 1 | - | - | 1.6 | 4.5 | - | - | - | - |
| β-Acorenol | OS | 28400-11-5 | 1644 | 1636 1 | - | - | 0.6 | - | - | - | - | - |
| allo-Aromadendrene epoxide | OS | 85760-81-2 | 1644 | 1639 1 | 0.3 | - | - | 0.3 | - | - | - | - |
| Caryophylla-4 (12),8(13)-dien-5β-ol | OS | 19431-80-2 | 1642 | 1639 1 | - | - | - | - | 0.1 | 0.1 | - | - |
| epi-α-Muurolol | OS | 19912-62-0 | 1646 | 1640 1 | - | - | - | 1.0 | - | - | - | - |
| α-Muurolol | OS | 19435-97-3 | 1651 | 1644 1 | - | - | - | - | - | - | 0.1 | - |
| Cubenol | OS | 21284-22-0 | 1651 | 1645 1 | - | - | - | - | - | 0.3 | - | - |
| Khusilal | OS | 2221-68-3 | 1651 | 1647 1 | - | - | 0.1 | - | 0.1 | - | - | - |
| β-Eudesmol | OS | 473-15-4 | 1656 | 1649 1 | - | - | 0.4 | 1.7 | - | - | 0.8 | 0.4 |
| α-Eudesmol | OS | 473-16-5 | 1659 | 1652 1 | - | - | 0.6 | 2.3 | - | - | 1.0 | - |
| Pogostol | OS | 21698-41-9 | 1661 | 1651 1 | 0.7 | - | - | - | - | - | - | |
| neo-Intermedeol | OS | 5945-72-2 | 1660 | 1658 1 | 0.1 | - | - | - | - | 0.6 | - | - |
| Selin-11-en-4α-ol | OS | 16641-47-7 | 1660 | 1658 1 | - | - | - | - | 0.9 | - | - | - |
| 14-Hydroxy-(Z)-caryophyllene | OS | 78683-81-5 | 1663 | 1666 1 | - | - | - | - | - | 0.2 | - | - |
| 14-Hydroxy-9-epi- (E)-caryophyllene | OS | 79768-25-5 | 1667 | 1668 1 | 0.2 | - | 0.3 | 0.2 | 0.9 | - | - | |
| Bulnesol | OS | 22451-73-6 | 1672 | 1670 1 | - | - | 0.2 | 1.3 | - | - | 0.4 | 0.4 |
| epi-β-Bisabolol | OS | 235421-59-7 | 1675 | 1670 1 | - | - | - | 0.8 | - | - | - | 0.1 |
| (Z)-α-Santalol | OS | 115-71-9 | 1677 | 1674 1 | - | - | - | - | 0.4 | 1.4 | - | - |
| Khusinol | OS | 24268-34-6 | 1672 | 1679 1 | - | - | - | 0.1 | 0.2 | - | - | - |
| α-Bisabolol | OS | 515-69-5 | 1687 | 1685 1 | - | - | - | 0.8 | - | - | - | 0.1 |
| 14-Hydroxy-α-humulene | OS | 75678-90-9 | 1713 | 1713 1 | - | - | - | - | 1.2 | 0.1 | - | - |
| iso-Longifolol | OS | 1139-17-9 | 1728 | 1728 1 | - | - | - | - | 2.6 | 3.1 | - | - |
| (Z)-Lanceol | OS | 10067-28-4 | 1752 | 1760 1 | - | - | - | - | 0.2 | - | - | - |
| β-Acoradienol | OS | 149496-35-5 | 1762 | 1762 1 | - | - | - | - | 0.1 | 0.3 | - | - |
| Benzyl benzoate | BZ | 120-51-4 | 1769 | 1772 2 | - | - | - | 0.1 | 0.3 | 0.9 | - | 0.1 |
| Monoterpene Hydrocarbons | - | 7.4 | 50.3 | 47.7 | 0.6 | 1.5 | 88.8 | 70.4 | ||||
| Oxygenated monoterpenoids | 4.3 | 16.5 | 28.1 | 20.4 | 79.2 | 81.7 | 1.2 | 20.6 | ||||
| Sesquiterpene Hydrocarbons | 0.6 | 2.2 | 8.6 | 10.9 | 7.2 | 2.0 | 3.3 | 3.9 | ||||
| Oxygenated sesquiterpenoids | 3.0 | 0.9 | 11.0 | 19.2 | 9.3 | 9.2 | 4.2 | 3.9 | ||||
| Benzenoid compounds | 91.8 | 72.3 | 0.1 | 0.3 | 0.4 | 1.2 | 0.4 | 0.1 | ||||
| Others | - | - | 1.0 | - | 0.4 | - | - | - | ||||
| Total | 99.7 | 99.3 | 99.1 | 98.5 | 97.3 | 95.6 | 97.9 | 98.9 | ||||
| DNA Markers | Alignment Length (bp) | Number of Polymorphic Sites | Total Number of Sites * |
|---|---|---|---|
| matK | 286 | - | 300 |
| rbcL | 833 | 5 | 829 |
| psbA-trnH | 471 | 27 | 401 |
| ITS | 249 | 26 | 239 |
| matK + rbcL + psbA − trnH | 1590 | 32 | 1508 |
| matK + rbcL + ITS | 1368 | 31 | 1346 |
| matK + rbcL + psbA − trnH + ITS | 1839 | 58 | 1747 |
| Species | Vouchers | Plant Material | Sample Codes |
|---|---|---|---|
| Aniba canelilla (Kunth) Mez. | MG135105 | Leaves | AC-L |
| Twigs | AC-T | ||
| Aniba parviflora (Meisn.) Mez. | MG227333 | Leaves | AP-L |
| Twigs | AP-T | ||
| Aniba rosaeodora Ducke | MG229347 | Leaves | AR-L |
| Twigs | AR-T | ||
| Aniba terminalis Ducke | MG172694 | Leaves | AT-L |
| Twigs | AT-T |
| Region | Primers | Sequence(5′–3′) | Amplification Protocol |
|---|---|---|---|
| ITS | ITS 1F | GAGCTCCGAACAAACCCTCT | 95 °C 7 min; 95 °C 1 min, 52 °C 1 min, 72 °C 1 min, 35 cycles; 72 °C 7 min |
| ITS 1R | AAGACTCGATGGTTCACGGG | ||
| ITS 2F | CCCGTGAACCATCGAGTCTTT | ||
| ITS 2R | GACGGCTCGCCTCTCAAC | ||
| matKa | matK-Lau001 | TCCTTTCTTGAGCGAACACA | 5 °C 7 min; 95 °C 1 min, 56 °C 1 min, 72 °C 1 min, 35 cycles; 72 °C 7 min |
| matK-Lau002 | CTGACAAATCGGACCGAAAC | ||
| psbAb | psbA3_f F | GTTATGCATGAACGTAATGCT | 5 °C 7 min; 95 °C 1 min, 56 °C 1 min, 72 °C 1 min, 35 cycles; 72 °C 7 min |
| trnHc | trnHf_05 R | CGCGCATGGTGGATTCACAATCC | |
| rbcL | rbcL 1F | GGACAACTGTGTGGACCGAT | 95 °C 7 min; 95 °C 1 min, 61 °C 1 min, 72 °C 1 min, 35 cycles; 72 °C 7 min |
| rbcL 1R | AAACGGTCTCTCCAACGCAT | ||
| rbcL | rbcL 2F | ATGCGTTGGAGAGACCGTTT | 95 °C 5 min; 95 °C 1 min, 53 °C 1 min, 72 °C 1 min, 30 cycles; 72 °C 7 min |
| rbcL 2R | AAAGTGATGTCCCGTTCCCC | ||
| ycf1 d | ycf1bF | TCTCGACGAAAATCAGATTGTTGTGAAT | 95 °C 5 min; 95 °C 1 min, [50–57 °C] 1 min, 72 °C 1 min, 30 cycles; 72 °C 7 min |
| ycf1bR | ATACATGTCAAAGTGATGGAAAA |
| Species | ITS | psbA-trnH | rbcL | matK |
|---|---|---|---|---|
| Aniba canelilla (Kunth) Mez. | MW489499 | MW512551 | MW512547 | MW512555 |
| Aniba parviflora (Meisn.) Mez. | MW489500 | MW512552 | MW512548 | MW512556 |
| Aniba rosaeodora Ducke | MW489501 | MW512553 | MW512549 | MW512557 |
| Aniba terminalis Ducke | MW489502 | MW512554 | MW512550 | MW512558 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xavier, J.K.A.M.; Maia, L.; Figueiredo, P.L.B.; Folador, A.; Ramos, A.R.; Andrade, E.H.; Maia, J.G.S.; Setzer, W.N.; da Silva, J.K.R. Essential Oil Composition and DNA Barcode and Identification of Aniba species (Lauraceae) Growing in the Amazon Region. Molecules 2021, 26, 1914. https://doi.org/10.3390/molecules26071914
Xavier JKAM, Maia L, Figueiredo PLB, Folador A, Ramos AR, Andrade EH, Maia JGS, Setzer WN, da Silva JKR. Essential Oil Composition and DNA Barcode and Identification of Aniba species (Lauraceae) Growing in the Amazon Region. Molecules. 2021; 26(7):1914. https://doi.org/10.3390/molecules26071914
Chicago/Turabian StyleXavier, Júlia Karla A. M., Leonardo Maia, Pablo Luis B. Figueiredo, Adriana Folador, Alessandra R. Ramos, Eloísa H. Andrade, José Guilherme S. Maia, William N. Setzer, and Joyce Kelly R. da Silva. 2021. "Essential Oil Composition and DNA Barcode and Identification of Aniba species (Lauraceae) Growing in the Amazon Region" Molecules 26, no. 7: 1914. https://doi.org/10.3390/molecules26071914
APA StyleXavier, J. K. A. M., Maia, L., Figueiredo, P. L. B., Folador, A., Ramos, A. R., Andrade, E. H., Maia, J. G. S., Setzer, W. N., & da Silva, J. K. R. (2021). Essential Oil Composition and DNA Barcode and Identification of Aniba species (Lauraceae) Growing in the Amazon Region. Molecules, 26(7), 1914. https://doi.org/10.3390/molecules26071914

