Protective Effects of Baicalin on Peritoneal Tight Junctions in Piglets Challenged with Glaesserella parasuis
Abstract
1. Introduction
2. Results
2.1. Effects of Baicalin on the Expression of Tight Junctions Genes in Peritoneum of G. parasuis Challenged Piglets
2.2. Effect of Baicalin on the Distibution Patterns of Tight Junctions in Peritoneum of G. parasuis Challenged Piglets
2.3. Effect of Baicalin on PKC and MLCK/MLC Signaling Pathways in Peritoneum of G. parasuis Infected Piglets
2.4. Histopathological Analysis
3. Discussion
4. Materials and Methods
4.1. Bacterial Strains
4.2. Experimental Products
4.3. Experimental Animals, Management, and Design
4.4. Experimental Sample Collection
4.5. RNA Extraction and RT-PCR
4.6. Immunofluorescence Microscopy
4.7. Western Blotting Analysis
4.8. Histopathology
4.9. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Sample Availability
References
- Dickerman, A.; Bandara, A.B.; Inzana, T.J. Phylogenomic analysis of Haemophilus parasuis and proposed reclassification to Glaesserella parasuis, gen. nov., comb. nov. Int. J. Syst. Evol. Microbiol. 2020, 70, 180–186. [Google Scholar] [CrossRef]
- Macedo, N.; Rovira, A.; Torremorell, M. Haemophilus parasuis: Infection, immunity and enrofloxacin. Vet. Res. 2015, 46, 128. [Google Scholar] [CrossRef]
- Ni, H.B.; Gong, Q.L.; Zhao, Q.; Li, X.Y.; Zhang, X.X. Prevalence of Haemophilus parasuis “Glaesserella parasuis” in pigs in China: A systematic review and meta-analysis. Prev. Vet. Med. 2020, 182, 105083. [Google Scholar] [CrossRef]
- Costa-Hurtado, M.; Barba-Vidal, E.; Maldonado, J.; Aragon, V. Update on Glässer’s disease: How to control the disease under restrictive use of antimicrobials. Vet. Microbiol. 2020, 242, 108595. [Google Scholar] [CrossRef]
- Awad, W.A.; Hess, C.; Hess, M. Enteric pathogens and their toxin-induced disruption of the intestinal barrier through alteration of tight junctions in chickens. Toxins 2017, 9, 60. [Google Scholar] [CrossRef]
- Blackburn, S.C.; Stanton, M.P. Anatomy and physiology of the peritoneum. Semin. Pediatr. Surg. 2014, 23, 326–330. [Google Scholar] [CrossRef]
- Markov, A.G.; Amasheh, S. Tight junction physiology of pleural mesothelium. Front. Physiol. 2014, 5, 221. [Google Scholar] [CrossRef] [PubMed]
- Bhat, A.A.; Uppada, S.; Achkar, I.W.; Hashem, S.; Yadav, S.K.; Shanmugakonar, M.; Al-Naemi, H.A.; Haris, M.; Uddin, S. Tight Junction proteins and signaling pathways in cancer and inflammation: A functional crosstalk. Front. Physiol. 2019, 9, 1942. [Google Scholar] [CrossRef]
- Cereijido, M.; Contreras, R.G.; Shoshani, L.; Flores-Benitez, D.; Larre, I. Tight junction and polarity interaction in the transporting epithelial phenotype. Biochim. Biophys. Acta. 2008, 1778, 770–793. [Google Scholar] [CrossRef] [PubMed]
- Lu, R.Y.; Yang, W.X.; Hu, Y.J. The role of epithelial tight junctions involved in pathogen infections. Mol. Biol. Rep. 2014, 41, 6591–6610. [Google Scholar] [CrossRef] [PubMed]
- Ulluwishewa, D.; Anderson, R.C.; McNabb, W.C.; Moughan, P.J.; Wells, J.M.; Roy, N.C. Regulation of tight junction permeability by intestinal bacteria and dietary components. J. Nutr. 2011, 141, 769–776. [Google Scholar] [CrossRef] [PubMed]
- Clarke, H.; Marano, C.W.; Soler, A.P.; Mullin, J.M. Modification of tight junction function by protein kinase C isoforms. Adv. Drug Deliv. Rev. 2000, 41, 283–301. [Google Scholar] [CrossRef]
- Cheng, X.; Wang, X.; Wan, Y.; Zhou, Q.; Zhu, H.; Wang, Y. Myosin light chain kinase inhibitor ML7 improves vascular endothelial dysfunction via tight junction regulation in a rabbit model of atherosclerosis. Mol. Med. Rep. 2015, 12, 4109–4116. [Google Scholar] [CrossRef] [PubMed]
- Zhou, H.Y.; Zhu, H.; Yao, X.M.; Qian, J.P.; Yang, J.; Pan, X.D.; Chen, X.D. Metformin regulates tight junction of intestinal epithelial cells via MLCK-MLC signaling pathway. Eur. Rev. Med. Pharmacol. Sci. 2017, 21, 5239–5246. [Google Scholar] [CrossRef]
- Pan, M.H.; Lai, C.S.; Ho, C.T. Anti-inflammatory activity of natural dietary flavonoids. Food Funct. 2010, 1, 15–31. [Google Scholar] [CrossRef]
- Maleki, S.J.; Crespo, J.F.; Cabanillas, B. Anti-inflammatory effects of flavonoids. Food Chem. 2019, 299, 125124. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.; Zhang, R.; Wang, J.; Yu, P.; Liu, Q.; Zeng, D.; Song, H.; Kuang, Z. Protective effects of baicalin on LPS-induced injury in intestinal epithelial cells and intercellular tight junctions. Can. J. Physiol. Pharmacol. 2015, 93, 233–237. [Google Scholar] [CrossRef] [PubMed]
- Nakashima, M.; Hisada, M.; Goda, N.; Tenno, T.; Kotake, A.; Inotsume, Y.; Kameoka, I.; Hiroaki, H. Opposing effect of naringenin and quercetin on the junctional compartment of MDCK II cells to modulate the tight junction. Nutrients 2020, 12, 3285. [Google Scholar] [CrossRef]
- Suzuki, T.; Hara, H. Role of flavonoids in intestinal tight junction regulation. J. Nutr. Biochem. 2011, 22, 401–408. [Google Scholar] [CrossRef]
- Sharma, S.; Tripathi, P.; Sharma, J.; Dixit, A. Flavonoids modulate tight junction barrier functions in hyperglycemic human intestinal Caco-2 cells. Nutrition 2020, 78, 110792. [Google Scholar] [CrossRef]
- Peng, L.Y.; Yuan, M.; Wu, Z.M.; Song, K.; Zhang, C.L.; An, Q.; Xia, F.; Yu, J.L.; Yi, P.F.; Fu, B.D.; et al. Anti-bacterial activity of baicalin against APEC through inhibition of quorum sensing and inflammatory responses. Sci. Rep. 2019, 9, 4063. [Google Scholar] [CrossRef]
- Lee, W.; Ku, S.K.; Bae, J.S. Anti-inflammatory effects of Baicalin, Baicalein, and Wogonin in vitro and in vivo. Inflammation 2015, 38, 110–125. [Google Scholar] [CrossRef]
- Orzechowska, B.U.; Wróbel, G.; Turlej, E.; Jatczak, B.; Sochocka, M.; Chaber, R. Antitumor effect of baicalin from the Scutellaria baicalensis radix extract in B-acute lymphoblastic leukemia with different chromosomal rearrangements. Int. Immunopharmacol. 2020, 79, 106114. [Google Scholar] [CrossRef] [PubMed]
- Paudel, K.R.; Kim, D.W. Microparticles-mediated vascular inflammation and its amelioration by antioxidant activity of Baicalin. Antioxidants 2020, 9, 890. [Google Scholar] [CrossRef] [PubMed]
- Fu, S.; Liu, H.; Chen, X.; Qiu, Y.; Ye, C.; Liu, Y.; Wu, Z.; Guo, L.; Hou, Y.; Hu, C.A. Baicalin inhibits Haemophilus parasuis-induced high-mobility group box 1 release during inflammation. Int. J. Mol. Sci. 2018, 19, 1307. [Google Scholar] [CrossRef]
- Fu, S.; Liu, H.; Xu, L.; Qiu, Y.; Liu, Y.; Wu, Z.; Ye, C.; Hou, Y.; Hu, C.A. Baicalin modulates NF-κB and NLRP3 inflammasome signaling in porcine aortic vascular endothelial cells infected by Haemophilus parasuis causing Glässer’s disease. Sci. Rep. 2018, 8, 807. [Google Scholar] [CrossRef]
- Ye, C.; Li, R.; Xu, L.; Qiu, Y.; Fu, S.; Liu, Y.; Wu, Z.; Hou, Y.; Hu, C.A. Effects of Baicalin on piglet monocytes involving PKC-MAPK signaling pathways induced by Haemophilus parasuis. BMC Vet. Res. 2019, 15, 98. [Google Scholar] [CrossRef]
- Fu, S.; Yin, R.; Zuo, S.; Liu, J.; Zhang, Y.; Guo, L.; Qiu, Y.; Ye, C.; Liu, Y.; Wu, Z.; et al. The effects of Baicalin on piglets challenged with Glaesserella parasuis. Vet. Res. 2020, 51, 102. [Google Scholar] [CrossRef] [PubMed]
- Zhu, H.; Wang, Z.; Xing, Y.; Gao, Y.; Ma, T.; Lou, L.; Lou, J.; Gao, Y.; Wang, S.; Wang, Y. Baicalin reduces the permeability of the blood-brain barrier during hypoxia in vitro by increasing the expression of tight junction proteins in brain microvascular endothelial cells. J. Ethnopharmacol. 2012, 141, 714–720. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Zhang, R.; Chen, J.; Wu, Q.; Kuang, Z. Baicalin protects against TNF-α-induced injury by down-regulating miR-191a that targets the tight junction protein ZO-1 in IEC-6 Cells. Biol. Pharm. Bull. 2017, 40, 435–443. [Google Scholar] [CrossRef]
- Hisada, M.; Hiranuma, M.; Nakashima, M.; Goda, N.; Tenno, T.; Hiroaki, H. High dose of Baicalin or baicalein can reduce tight junction integrity by partly targeting the first PDZ domain of zonula occludens-1 (ZO-1). Eur. J. Pharmacol. 2020, 887, 173436. [Google Scholar] [CrossRef]
- Zihni, C.; Mills, C.; Matter, K.; Balda, M.S. Tight junctions: From simple barriers to multifunctional molecular gates. Nat. Rev. Mol. Cell Biol. 2016, 17, 564–580. [Google Scholar] [CrossRef] [PubMed]
- Förster, C. Tight junctions and the modulation of barrier function in disease. Histochem. Cell Biol. 2008, 130, 55–70. [Google Scholar] [CrossRef]
- Buschmann, M.M.; Shen, L.; Rajapakse, H.; Raleigh, D.R.; Wang, Y.; Wang, Y.; Lingaraju, A.; Zha, J.; Abbott, E.; McAuley, E.M.; et al. Occludin OCEL-domain interactions are required for maintenance and regulation of the tight junction barrier to macromolecular flux. Mol. Biol. Cell 2013, 24, 3056–3068. [Google Scholar] [CrossRef]
- Saitou, M.; Furuse, M.; Sasaki, H.; Schulzke, J.D.; Fromm, M.; Takano, H.; Noda, T.; Tsukita, S. Complex phenotype of mice lacking occludin, a component of tight junction strands. Mol. Biol. Cell 2000, 11, 4131–4142. [Google Scholar] [CrossRef] [PubMed]
- Yamamoto-Furusho, J.K.; Mendivil, E.J.; Fonseca-Camarillo, G. Differential expression of occludin in patients with ulcerative colitis and healthy controls. Inflamm. Bowel. Dis. 2012, 18, E1999. [Google Scholar] [CrossRef] [PubMed]
- Stuart, R.O.; Nigam, S.K. Regulated assembly of tight junctions by protein kinase C. Proc. Natl. Acad. Sci. USA 1995, 92, 6072–6076. [Google Scholar] [CrossRef] [PubMed]
- Ogasawara, N.; Kojima, T.; Go, M.; Ohkuni, T.; Koizumi, J.; Kamekura, R.; Masaki, T.; Murata, M.; Tanaka, S.; Fuchimoto, J.; et al. PPARgamma agonists upregulate the barrier function of tight junctions via a PKC pathway in human nasal epithelial cells. Pharmacol. Res. 2010, 61, 489–498. [Google Scholar] [CrossRef] [PubMed]
- Mullin, J.M.; Laughlin, K.V.; Ginanni, N.; Marano, C.W.; Clarke, H.M.; Soler, A.P. Increased tight junction permeability can result from protein kinase C activation/translocation and act as a tumor promotional event in epithelial cancers. Ann. N. Y. Acad. Sci. 2000, 915, 231–236. [Google Scholar] [CrossRef]
- Jo, H.; Hwang, D.; Kim, J.K.; Lim, Y.H. Oxyresveratrol improves tight junction integrity through the PKC and MAPK signaling pathways in Caco-2 cells. Food Chem. Toxicol. 2017, 108, 203–213. [Google Scholar] [CrossRef]
- Andreeva, A.Y.; Krause, E.; Müller, E.C.; Blasig, I.E.; Utepbergenov, D.I. Protein kinase C regulates the phosphorylation and cellular localization of occludin. J. Biol. Chem. 2001, 276, 38480–38486. [Google Scholar] [CrossRef]
- Chai, J.; Long, B.; Liu, X.; Li, Y.; Han, N.; Zhao, P.; Chen, W. Effects of sevoflurane on tight junction protein expression and PKC-α translocation after pulmonary ischemia-reperfusion injury. Exp. Mol. Med. 2015, 47, e167. [Google Scholar] [CrossRef]
- Avila-Flores, A.; Rendón-Huerta, E.; Moreno, J.; Islas, S.; Betanzos, A.; Robles-Flores, M.; González-Mariscal, L. Tight-junction protein zonula occludens 2 is a target of phosphorylation by protein kinase C. Biochem. J. 2001, 360, 295–304. [Google Scholar] [CrossRef] [PubMed]
- Amaya, E.; Alarcón, L.; Martín-Tapia, D.; Cuellar-Pérez, F.; Cano-Cortina, M.; Ortega-Olvera, J.M.; Cisneros, B.; Rodriguez, A.J.; Gamba, G.; González-Mariscal, L. Activation of the Ca2+ sensing receptor and the PKC/WNK4 downstream signaling cascade induces incorporation of ZO-2 to tight junctions and its separation from 14-3-3. Mol. Biol. Cell. 2019, 30, 2377–2398. [Google Scholar] [CrossRef] [PubMed]
- Shi, L.; Hao, Z.; Zhang, S.; Wei, M.; Lu, B.; Wang, Z.; Ji, L. Baicalein and Baicalin alleviate acetaminophen-induced liver injury by activating Nrf2 antioxidative pathway: The involvement of ERK1/2 and PKC. Biochem. Pharmacol. 2018, 150, 9–23. [Google Scholar] [CrossRef]
- Wang, Q.; Xu, H.; Zhao, X. Baicalin inhibits human cervical cancer cells by suppressing protein kinase C/signal transducer and activator of transcription (PKC/STAT3) signaling pathway. Med. Sci. Monit. 2018, 24, 1955–1961. [Google Scholar] [CrossRef] [PubMed]
- Shou, X.; Wang, B.; Zhou, R.; Wang, L.; Ren, A.; Xin, S.; Zhu, L. Protective effects of Baicalin on oxygen/glucose deprivation- and NMDA-induced injuries in rat hippocampal slices. J. Pharm. Pharmacol. 2005, 57, 1019–1026. [Google Scholar] [CrossRef]
- Rossi, J.L.; Ranaivo, R.H.; Patel, F.; Chrzaszcz, M.; Venkatesan, C.; Wainwright, M.S. Albumin causes increased myosin light chain kinase expression in astrocytes via p38 mitogen-activated protein kinase. J. Neurosci. Res. 2011, 89, 852–861. [Google Scholar] [CrossRef]
- Cunningham, K.E.; Turner, J.R. Myosin light chain kinase: Pulling the strings of epithelial tight junction function. Ann. N. Y. Acad. Sci. 2012, 1258, 34–42. [Google Scholar] [CrossRef] [PubMed]
- Zhu, H.Q.; Zhou, Q.; Jiang, Z.K.; Gui, S.Y.; Wang, Y. Association of aorta intima permeability with myosin light chain kinase expression in hypercholesterolemic rabbits. Mol. Cell. Biochem. 2011, 347, 209–215. [Google Scholar] [CrossRef] [PubMed]
- Qasim, M.; Rahman, H.; Ahmed, R.; Oellerich, M.; Asif, A.R. Mycophenolic acid mediated disruption of the intestinal epithelial tight junctions. Exp. Cell Res. 2014, 322, 277–289. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Zhao, W.; Xu, J.; Yu, X.; Ye, C.; Fu, S.; Qiu, Y. Pharmacokinetics of sodium baicalin following intravenous and intramuscular administration to piglets. J. Vet. Pharmacol. Ther. 2019, 42, 580–584. [Google Scholar] [CrossRef] [PubMed]
Gene | Nucleotide Sequences (5’–3’) | Tm (°C) | Length (bp) | |
---|---|---|---|---|
β-actin | Forward | TGCGGGACATCAAGGAGAAG | 57.4 | 216 |
Reverse | AGTTGAAGGTGGTCTCGTGG | 57.4 | ||
Claudin-1 | Forward | CCTTGCTGAATCTGAACAC | 49.5 | 135 |
Reverse | GCACCTCATCATCTTCCAT | 50.0 | ||
JAM-1 | Forward | TGACAGAACAGGCGAATG | 50.1 | 167 |
Reverse | GCAGCATAGGCAGGAATT | 50.1 | ||
ZO-1 | Forward | GAAGATGATGAAGATGAGGATG | 50.3 | 184 |
Reverse | GGAGGATGCTGTTGTCTC | 49.9 | ||
Occludin | Forward | GAGTGATTCGGATTCTGTCT | 50.3 | 181 |
Reverse | TAGCCATAACCATAGCCATAG | 50.2 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, J.; Zhang, Z.; Xu, J.; Ye, C.; Fu, S.; Hu, C.-A.A.; Qiu, Y.; Liu, Y. Protective Effects of Baicalin on Peritoneal Tight Junctions in Piglets Challenged with Glaesserella parasuis. Molecules 2021, 26, 1268. https://doi.org/10.3390/molecules26051268
Zhang J, Zhang Z, Xu J, Ye C, Fu S, Hu C-AA, Qiu Y, Liu Y. Protective Effects of Baicalin on Peritoneal Tight Junctions in Piglets Challenged with Glaesserella parasuis. Molecules. 2021; 26(5):1268. https://doi.org/10.3390/molecules26051268
Chicago/Turabian StyleZhang, Jiacheng, Zhaoran Zhang, Jianfeng Xu, Chun Ye, Shulin Fu, Chien-An Andy Hu, Yinsheng Qiu, and Yu Liu. 2021. "Protective Effects of Baicalin on Peritoneal Tight Junctions in Piglets Challenged with Glaesserella parasuis" Molecules 26, no. 5: 1268. https://doi.org/10.3390/molecules26051268
APA StyleZhang, J., Zhang, Z., Xu, J., Ye, C., Fu, S., Hu, C.-A. A., Qiu, Y., & Liu, Y. (2021). Protective Effects of Baicalin on Peritoneal Tight Junctions in Piglets Challenged with Glaesserella parasuis. Molecules, 26(5), 1268. https://doi.org/10.3390/molecules26051268