JAK2 Inhibition by Fedratinib Reduces Osteoblast Differentiation and Mineralisation of Human Mesenchymal Stem Cells
Abstract
1. Introduction
2. Results
2.1. Effect of Fedratinib on hMSC-TERT Cell Proliferation
2.2. Fedratinib Inhibits the Osteoblastic Differentiation of hMSC-TERT Cells
2.3. Fedratinib Affects Multiple Signalling Pathways During the Osteoblastic Differentiation of hMSC-TERT Cells
3. Discussion
4. Materials and Methods
4.1. Cell Culture
4.2. Osteoblastic Differentiation
4.3. Cell Viability Assay
4.4. Measurement of Apoptosis
4.5. Quantification of Alkaline Phosphatase Activity
4.6. Alkaline Phosphatase Staining
4.7. Alizarin Red S Staining of Mineralised Matrix Formation
4.8. RNA Extraction and cDNA Synthesis
4.9. Quantitative Real Time-Polymerase Chain Reaction
4.10. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Sample Availability
References
- Darvin, P.; Joung, Y.H.; Yang, Y.M. JAK2-STAT5B pathway and osteoblast differentiation. JAKSTAT 2013, 2, e24931. [Google Scholar] [CrossRef] [PubMed]
- Adam, S.; Simon, N.; Steffen, U.; Andes, F.T.; Scholtysek, C.; Muller, D.I.H.; Weidner, D.; Andreev, D.; Kleyer, A.; Culemann, S.; et al. JAK inhibition increases bone mass in steady-state conditions and ameliorates pathological bone loss by stimulating osteoblast function. Sci. Transl. Med. 2020, 12. [Google Scholar] [CrossRef] [PubMed]
- Li, J. JAK-STAT and bone metabolism. JAKSTAT 2013, 2, e23930. [Google Scholar] [CrossRef] [PubMed]
- Jatiani, S.S.; Baker, S.J.; Silverman, L.R.; Reddy, E.P. Jak/STAT pathways in cytokine signaling and myeloproliferative disorders: Approaches for targeted therapies. Genes Cancer 2010, 1, 979–993. [Google Scholar] [CrossRef]
- Ji, J.; Wu, Y.; Meng, Y.; Zhang, L.; Feng, G.; Xia, Y.; Xue, W.; Zhao, S.; Gu, Z.; Shao, X. JAK-STAT signaling mediates the senescence of bone marrow-mesenchymal stem cells from systemic lupus erythematosus patients. Acta Biochim. Biophys. Sin. 2017, 49, 208–215. [Google Scholar] [CrossRef]
- Rawlings, J.S.; Rosler, K.M.; Harrison, D.A. The JAK/STAT signaling pathway. J. Cell Sci. 2004, 117, 1281–1283. [Google Scholar] [CrossRef]
- Moresi, V.; Adamo, S.; Berghella, L. The JAK/STAT Pathway in Skeletal Muscle Pathophysiology. Front. Physiol 2019, 10, 500. [Google Scholar] [CrossRef]
- Jin, W. Role of JAK/STAT3 Signaling in the Regulation of Metastasis, the Transition of Cancer Stem Cells, and Chemoresistance of Cancer by Epithelial-Mesenchymal Transition. Cells 2020, 9, 217. [Google Scholar] [CrossRef]
- Thomas, S.J.; Snowden, J.A.; Zeidler, M.P.; Danson, S.J. The role of JAK/STAT signalling in the pathogenesis, prognosis and treatment of solid tumours. Br. J. Cancer 2015, 113, 365–371. [Google Scholar] [CrossRef]
- Haan, C.; Kreis, S.; Margue, C.; Behrmann, I. Jaks and cytokine receptors--an intimate relationship. Biochem. Pharmacol. 2006, 72, 1538–1546. [Google Scholar] [CrossRef]
- Aldahmash, A.; Zaher, W.; Al-Nbaheen, M.; Kassem, M. Human stromal (mesenchymal) stem cells: Basic biology and current clinical use for tissue regeneration. Ann. Saudi Med. 2012, 32, 68–77. [Google Scholar] [CrossRef] [PubMed]
- Al-Nbaheen, M.; Vishnubalaji, R.; Ali, D.; Bouslimi, A.; Al-Jassir, F.; Megges, M.; Prigione, A.; Adjaye, J.; Kassem, M.; Aldahmash, A. Human stromal (mesenchymal) stem cells from bone marrow, adipose tissue and skin exhibit differences in molecular phenotype and differentiation potential. Stem Cell Rev. Rep. 2013, 9, 32–43. [Google Scholar] [CrossRef] [PubMed]
- Huang, W.; Yang, S.; Shao, J.; Li, Y.P. Signaling and transcriptional regulation in osteoblast commitment and differentiation. Front. Biosci. 2007, 12, 3068. [Google Scholar] [CrossRef] [PubMed]
- Abdallah, B.M.; Jafari, A.; Zaher, W.; Qiu, W.; Kassem, M. Skeletal (stromal) stem cells: An update on intracellular signaling pathways controlling osteoblast differentiation. Bone 2015, 70, 28–36. [Google Scholar] [CrossRef]
- AlMuraikhi, N.; Ali, D.; Alshanwani, A.; Vishnubalaji, R.; Manikandan, M.; Atteya, M.; Siyal, A.; Alfayez, M.; Aldahmash, A.; Kassem, M.; et al. Stem cell library screen identified ruxolitinib as regulator of osteoblastic differentiation of human skeletal stem cells. Stem Cell Res. Ther. 2018, 9, 319. [Google Scholar] [CrossRef]
- Zhong, Z.; Ethen, N.J.; Williams, B.O. WNT signaling in bone development and homeostasis. Wiley Interdiscip. Rev. Dev. Biol. 2014, 3, 489–500. [Google Scholar] [CrossRef]
- Elsafadi, M.; Manikandan, M.; Almalki, S.; Mobarak, M.; Atteya, M.; Iqbal, Z.; Hashmi, J.A.; Shaheen, S.; Alajez, N.; Alfayez, M.; et al. TGFbeta1-Induced Differentiation of Human Bone Marrow-Derived MSCs Is Mediated by Changes to the Actin Cytoskeleton. Stem Cells Int. 2018, 2018, 6913594. [Google Scholar] [CrossRef]
- Pramojanee, S.N.; Phimphilai, M.; Chattipakorn, N.; Chattipakorn, S.C. Possible roles of insulin signaling in osteoblasts. Endocr. Res. 2014, 39, 144–151. [Google Scholar] [CrossRef]
- Nakayamada, S.; Okada, Y.; Saito, K.; Tamura, M.; Tanaka, Y. Beta1 integrin/focal adhesion kinase-mediated signaling induces intercellular adhesion molecule 1 and receptor activator of nuclear factor kappaB ligand on osteoblasts and osteoclast maturation. J. Biol. Chem. 2003, 278, 45368–45374. [Google Scholar] [CrossRef]
- AlMuraikhi, N.; Ali, D.; Vishnubalaji, R.; Manikandan, M.; Atteya, M.; Siyal, A.; Alfayez, M.; Aldahmash, A.; Kassem, M.; Alajez, N.M. Notch Signaling Inhibition by LY411575 Attenuates Osteoblast Differentiation and Decreased Ectopic Bone Formation Capacity of Human Skeletal (Mesenchymal) Stem Cells. Stem Cells Int. 2019, 2019, 3041262. [Google Scholar] [CrossRef]
- Xie, Z.; Tang, S.; Ye, G.; Wang, P.; Li, J.; Liu, W.; Li, M.; Wang, S.; Wu, X.; Cen, S.; et al. Interleukin-6/interleukin-6 receptor complex promotes osteogenic differentiation of bone marrow-derived mesenchymal stem cells. Stem Cell Res. Ther. 2018, 9, 13. [Google Scholar] [CrossRef]
- AlMuraikhi, N.; Almasoud, N.; Binhamdan, S.; Younis, G.; Ali, D.; Manikandan, M.; Vishnubalaji, R.; Atteya, M.; Siyal, A.; Alfayez, M.; et al. Hedgehog Signaling Inhibition by Smoothened Antagonist BMS-833923 Reduces Osteoblast Differentiation and Ectopic Bone Formation of Human Skeletal (Mesenchymal) Stem Cells. Stem Cells Int. 2019, 2019, 3435901. [Google Scholar] [CrossRef] [PubMed]
- Wang, P.; Zhang, Z. Bone marrow-derived mesenchymal stem cells promote healing of rabbit tibial fractures via JAK-STAT signaling pathway. Exp. Ther. Med. 2020, 19, 2310–2316. [Google Scholar] [CrossRef] [PubMed]
- Lu, B.; Atala, A. Small molecules and small molecule drugs in regenerative medicine. Drug Discov. Today 2014, 19, 801–808. [Google Scholar] [CrossRef] [PubMed]
- Ali, D.; Hamam, R.; Alfayez, M.; Kassem, M.; Aldahmash, A.; Alajez, N.M. Epigenetic Library Screen Identifies Abexinostat as Novel Regulator of Adipocytic and Osteoblastic Differentiation of Human Skeletal (Mesenchymal) Stem Cells. Stem Cells Transl. Med. 2016, 5, 1036–1047. [Google Scholar] [CrossRef] [PubMed]
- Elsafadi, M.; Manikandan, M.; Dawud, R.A.; Alajez, N.M.; Hamam, R.; Alfayez, M.; Kassem, M.; Aldahmash, A.; Mahmood, A. Transgelin is a TGFbeta-inducible gene that regulates osteoblastic and adipogenic differentiation of human skeletal stem cells through actin cytoskeleston organization. Cell Death Dis. 2016, 7, e2321. [Google Scholar] [CrossRef]
- Almasoud, N.; Binhamdan, S.; Younis, G.; Alaskar, H.; Alotaibi, A.; Manikandan, M.; Alfayez, M.; Kassem, M.; AlMuraikhi, N. Tankyrase inhibitor XAV-939 enhances osteoblastogenesis and mineralization of human skeletal (mesenchymal) stem cells. Sci. Rep. 2020, 10, 16746. [Google Scholar] [CrossRef]
- Singer, J.W.; Al-Fayoumi, S.; Taylor, J.; Velichko, S.; O’Mahony, A. Comparative phenotypic profiling of the JAK2 inhibitors ruxolitinib, fedratinib, momelotinib, and pacritinib reveals distinct mechanistic signatures. PLoS ONE 2019, 14, e0222944. [Google Scholar] [CrossRef]
- Bewersdorf, J.P.; Jaszczur, S.M.; Afifi, S.; Zhao, J.C.; Zeidan, A.M. Beyond Ruxolitinib: Fedratinib and Other Emergent Treatment Options for Myelofibrosis. Cancer Manag. Res. 2019, 11, 10777–10790. [Google Scholar] [CrossRef]
- Ragheb, M.; Harrison, C.N.; McLornan, D.P. Current and future role of fedratinib in the treatment of myelofibrosis. Future Oncol. 2020, 16, 175–186. [Google Scholar] [CrossRef]
- Clarke, J. JAK inhibitors boost bone formation. Nat. Rev. Rheumatol. 2020, 16, 249. [Google Scholar] [CrossRef] [PubMed]
- Jo, S.; Wang, S.E.; Lee, Y.L.; Kang, S.; Lee, B.; Han, J.; Sung, I.H.; Park, Y.S.; Bae, S.C.; Kim, T.H. IL-17A induces osteoblast differentiation by activating JAK2/STAT3 in ankylosing spondylitis. Arthritis Res. Ther. 2018, 20, 115. [Google Scholar] [CrossRef] [PubMed]
- Parganas, E.; Wang, D.; Stravopodis, D.; Topham, D.J.; Marine, J.C.; Teglund, S.; Vanin, E.F.; Bodner, S.; Colamonici, O.R.; van Deursen, J.M.; et al. Jak2 is essential for signaling through a variety of cytokine receptors. Cell 1998, 93, 385–395. [Google Scholar] [CrossRef]
- Stivala, S.; Codilupi, T.; Brkic, S.; Baerenwaldt, A.; Ghosh, N.; Hao-Shen, H.; Dirnhofer, S.; Dettmer, M.S.; Simillion, C.; Kaufmann, B.A.; et al. Targeting compensatory MEK/ERK activation increases JAK inhibitor efficacy in myeloproliferative neoplasms. J. Clin. Investig. 2019, 129, 1596–1611. [Google Scholar] [CrossRef]
- Zhang, M.; Xu, C.R.; Shamiyeh, E.; Liu, F.; Yin, J.Y.; von Moltke, L.L.; Smith, W.B. A randomized, placebo-controlled study of the pharmacokinetics, pharmacodynamics, and tolerability of the oral JAK2 inhibitor fedratinib (SAR302503) in healthy volunteers. J. Clin. Pharmacol. 2014, 54, 415–421. [Google Scholar] [CrossRef]
- Brachet-Botineau, M.; Polomski, M.; Neubauer, H.A.; Juen, L.; Hedou, D.; Viaud-Massuard, M.C.; Prie, G.; Gouilleux, F. Pharmacological Inhibition of Oncogenic STAT3 and STAT5 Signaling in Hematopoietic Cancers. Cancers 2020, 12, 240. [Google Scholar] [CrossRef]
- Hao, Y.; Chapuy, B.; Monti, S.; Sun, H.H.; Rodig, S.J.; Shipp, M.A. Selective JAK2 inhibition specifically decreases Hodgkin lymphoma and mediastinal large B-cell lymphoma growth in vitro and in vivo. Clin. Cancer Res. 2014, 20, 2674–2683. [Google Scholar] [CrossRef]
- Morgan, E.L.; Macdonald, A. JAK2 Inhibition Impairs Proliferation and Sensitises Cervical Cancer Cells to Cisplatin-Induced Cell Death. Cancers 2019, 11, 1934. [Google Scholar] [CrossRef]
- Wernig, G.; Kharas, M.G.; Okabe, R.; Moore, S.A.; Leeman, D.S.; Cullen, D.E.; Gozo, M.; McDowell, E.P.; Levine, R.L.; Doukas, J.; et al. Efficacy of TG101348, a selective JAK2 inhibitor, in treatment of a murine model of JAK2V617F-induced polycythemia vera. Cancer Cell 2008, 13, 311–320. [Google Scholar] [CrossRef]
- Talpaz, M.; Kiladjian, J.J. Fedratinib, a newly approved treatment for patients with myeloproliferative neoplasm-associated myelofibrosis. Leukemia 2020. [Google Scholar] [CrossRef]
- Pradhan, A.; Lambert, Q.T.; Griner, L.N.; Reuther, G.W. Activation of JAK2-V617F by components of heterodimeric cytokine receptors. J. Biol. Chem. 2010, 285, 16651–16663. [Google Scholar] [CrossRef] [PubMed]
- Hojo, H.; Ohba, S.; Chung, U.I. Signaling pathways regulating the specification and differentiation of the osteoblast lineage. Regen. Ther. 2015, 1, 57–62. [Google Scholar] [CrossRef] [PubMed]
- Zhao, B. TNF and Bone Remodeling. Curr. Osteoporos. Rep. 2017, 15, 126–134. [Google Scholar] [CrossRef]
- Skerry, T.M. The effects of the inflammatory response on bone growth. Eur. J. Clin. Nutr. 1994, 48 (Suppl. 1), S190–S197, discussion S198. [Google Scholar] [PubMed]
- Abdallah, B.M.; Haack-Sorensen, M.; Burns, J.S.; Elsnab, B.; Jakob, F.; Hokland, P.; Kassem, M. Maintenance of differentiation potential of human bone marrow mesenchymal stem cells immortalized by human telomerase reverse transcriptase gene despite [corrected] extensive proliferation. Biochem. Biophys. Res. Commun. 2005, 326, 527–538. [Google Scholar] [CrossRef]
- Simonsen, J.L.; Rosada, C.; Serakinci, N.; Justesen, J.; Stenderup, K.; Rattan, S.I.; Jensen, T.G.; Kassem, M. Telomerase expression extends the proliferative life-span and maintains the osteogenic potential of human bone marrow stromal cells. Nat. Biotechnol. 2002, 20, 592–596. [Google Scholar] [CrossRef]
- Vishnubalaji, R.; Elango, R.; Al-Toub, M.; Manikandan, M.; Al-Rikabi, A.; Harkness, L.; Ditzel, N.; Atteya, M.; Hamam, R.; Alfayez, M.; et al. Neoplastic Transformation of Human Mesenchymal Stromal Cells Mediated via LIN28B. Sci. Rep. 2019, 9, 8101. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
Gene Name | Forward Primer | Reverse Primer |
---|---|---|
ACTB | 5′AGCCATGTACGTTGCTA | 5′AGTCCGCCTAGAAGCA |
JAK2 | CTGGAGGTCGTTCAGAGCC | CTGCTTCTGAAACCCGGC |
STAT5 | CTGCGAGTCTGCTACTGCTA | TGCGTTCACAAACTCAGGGA |
STAT3 | CAGGAGCATCCTGAAGCTGA | TGCAGGTCGTTGGTGTCA |
ERK | ATCTTAAATTTGTCAGGACAAGGG | ACTGGGAAGAAGAACACCGAT |
AKT | ACTCTTTCCAGACCCACGAC | ACAGGTGGAAGAACAGCTCG |
ALPL | 5′GGAACTCCTGACCCTTGACC3′ | 5′TCCTGTTCAGCTCGTACTGC3′ |
ON | 5′GAGGAAACCGAAGAGGAGG3′ | 5′GGGGTGTTGTTCTCATCCAG3′ |
OC | GGCAGCGAGGTAGTGAAGAG | CTCACACACCTCCCTCCTG |
RUNX2 | 5′GTAGATGGACCTCGGGAACC3′ | 5′GAGGCGGTCAGAGAACAAAC3′ |
OPN | GGTGATGTCCTCGTCTGTA | CCAAGTAAGTCCAACGAAAG |
COL1A1 | 5′GAGTGCTGTCCCGTCTGC3′ | 5′TTTCTTGGTCGGTGGGTG3′ |
LIF | 5′GCCACCCATGTCACAACAAC | 5′CCCCCTGGGCTGTGTAATAG |
SOCS3 | 5′TTCGGGACCAGCCCCC3′ | 5′AAACTTGCTGTGGGTGACCA3′ |
RRAD | 5′GCGGAAACCCTAAAGTCCGA | 5′GTCCGGGACCGTCCACT |
NOTCH3 | 5′CCTGTGGCCCTCATGGTATC | 5′CATGGGTTGGGGTCACAGTC |
TNF | 5′ACTTTGGAGTGATCGGCC3′ | 5′GCTTGAGGGTTTGCTACAAC3′ |
COMP | 5′CCGACACCGCCTGCGTTCTT3′ | 5′AGCGCCGCGTTGGTTTCCTG3′ |
THBS2 | 5′TTGGCAAACCAGGAGCTCAG3′ | 5′GGTCTTGCGGTTGATGTTGC3′ |
IL6 | CGAGCCCACCGGGAACGAAA | GGACCGAAGGCGTTGTGGAG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
AlMuraikhi, N.; Alaskar, H.; Binhamdan, S.; Alotaibi, A.; Kassem, M.; Alfayez, M. JAK2 Inhibition by Fedratinib Reduces Osteoblast Differentiation and Mineralisation of Human Mesenchymal Stem Cells. Molecules 2021, 26, 606. https://doi.org/10.3390/molecules26030606
AlMuraikhi N, Alaskar H, Binhamdan S, Alotaibi A, Kassem M, Alfayez M. JAK2 Inhibition by Fedratinib Reduces Osteoblast Differentiation and Mineralisation of Human Mesenchymal Stem Cells. Molecules. 2021; 26(3):606. https://doi.org/10.3390/molecules26030606
Chicago/Turabian StyleAlMuraikhi, Nihal, Hanouf Alaskar, Sarah Binhamdan, Amal Alotaibi, Moustapha Kassem, and Musaad Alfayez. 2021. "JAK2 Inhibition by Fedratinib Reduces Osteoblast Differentiation and Mineralisation of Human Mesenchymal Stem Cells" Molecules 26, no. 3: 606. https://doi.org/10.3390/molecules26030606
APA StyleAlMuraikhi, N., Alaskar, H., Binhamdan, S., Alotaibi, A., Kassem, M., & Alfayez, M. (2021). JAK2 Inhibition by Fedratinib Reduces Osteoblast Differentiation and Mineralisation of Human Mesenchymal Stem Cells. Molecules, 26(3), 606. https://doi.org/10.3390/molecules26030606