Ginsenoside Rb1 Mitigates Escherichia coli Lipopolysaccharide-Induced Endometritis through TLR4-Mediated NF-κB Pathway
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethical Approval
2.2. Chemicals and Reagents
2.3. Animal and Experimental Groups
- Control group (50 µL of Saline solution);
- LPS group (a volume of 50 µL having a concentration of 1 mg/mL);
- LPS + GnRb1 (25 mg/kg) group;
- LPS + GnRb1 (50 mg/kg) group.
2.4. Histological Assay
2.5. Wet to Dry (W/D) Weight Ratio MPO Assay
2.6. ELISA Assay
2.7. Real-Time Quantitative RCR Assay
2.8. Western Blot
2.9. Statistical Analysis
3. Results
3.1. GnRb1 Alleviates LPS-Induced Murine Endometritis
3.2. Effect of GnRb1 against LPS-Induced MPO Activity and W/D Ratio
3.3. Effect of GnRb1 against LPS-Induced Expression of Pro- and Anti-Inflammatory Markers
3.4. GnRb1 Represses LPS-Induced TLR4 Expression
3.5. GnRb1 Suppresses LPS-Induced Activation of NF-κB Signaling Pathway
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Sample Availability
References
- Wu, H.; Dai, A.; Chen, X.; Yang, X.; Li, X.; Huang, C.; Jiang, K.; Deng, G. Leonurine ameliorates the inflammatory responses in lipopolysaccharide-induced endometritis. Int. Immunopharmacol. 2018, 61, 156–161. [Google Scholar] [CrossRef] [Scilit]
- Wang, X.; Yuan, T.; Yin, N.; Ma, X.; Yang, Y.; Yang, J.; Shaukat, A.; Deng, G. Interferon-τ regulates the expression and function of bovine leukocyte antigen by downregulating bta-miR-204. Exp. Ther. Med. 2021, 21, 594. [Google Scholar] [CrossRef] [Scilit]
- Mohammed, Z.; Mann, G.; Robinson, R. Impact of endometritis on post-partum ovarian cyclicity in dairy cows. Vet. J. 2019, 248, 8–13. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liang, Y.; Shen, T.; Ming, Q.; Han, G.; Zhang, Y.; Liang, J.; Zhu, D. Alpinetin ameliorates inflammatory response in LPS-induced endometritis in mice. Int. Immunopharmacol. 2018, 62, 309–312. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, H.; Wu, Z.M.; Yang, Y.P.; Shaukat, A.; Yang, J.; Guo, Y.F.; Zhang, T.; Zhu, X.Y.; Qiu, J.X.; Deng, G.Z.; et al. Catalpol ameliorates LPS-induced endometritis by inhibiting inflammation and TLR4/NF-kappaB signaling. J. Zhejiang Univ. Sci. B 2019, 20, 816–827. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jiang, K.; Guo, S.; Yang, J.; Liu, J.; Shaukat, A.; Zhao, G.; Wu, H.; Deng, G. Matrine alleviates Staphylococcus aureus lipoteichoic acid-induced endometritis via suppression of TLR2-mediated NF-κB activation. Int. Immunopharmacol. 2019, 70, 201–207. [Google Scholar] [CrossRef] [Scilit]
- Yin, N.; Yang, Y.; Wang, X.; Yang, C.; Ma, X.; Shaukat, A.; Zhao, G.; Deng, G. MiR-19a mediates the negative regulation of the NF-κB pathway in lipopolysaccharide-induced endometritis by targeting TBK1. Inflamm. Res. 2019, 68, 231–240. [Google Scholar] [CrossRef] [Scilit]
- Yang, Y.; Yang, C.; Guo, Y.F.; Liu, P.; Guo, S.; Yang, J.; Zahoor, A.; Shaukat, A.; Deng, G. MiR-142a-3p alleviates Escherichia coli derived lipopolysaccharide-induced acute lung injury by targeting TAB2. Microbial Pathog. 2019, 136, 103721. [Google Scholar] [CrossRef] [Scilit]
- Guo, S.; Chen, Y.; Liu, J.; Yang, J.; Yang, C.; Zhang, T.; Jiang, K.; Wu, Z.; Shaukat, A.; Deng, G. miR-497a-5p attenuates lipopolysaccharide-induced inflammatory injury by targeting IRAK2. J. Cell. Physiol. 2019, 234, 22874–22883. [Google Scholar] [CrossRef] [Scilit]
- Liu, J.; Guo, S.; Jiang, K.; Zhang, T.; Zhiming, W.; Yaping, Y.; Jing, Y.; Shaukat, A.; Deng, G. miR-488 mediates negative regulation of the AKT/NF-κB pathway by targeting Rac1 in LPS-induced inflammation. J. Cell. Physiol. 2020, 235, 4766–4777. [Google Scholar] [CrossRef] [Scilit]
- Shaukat, A.; Guo, Y.F.; Jiang, K.; Zhao, G.; Wu, H.; Zhang, T.; Yang, Y.; Guo, S.; Yang, C.; Zahoor, A.; et al. Ginsenoside Rb1 ameliorates Staphylococcus aureus-induced Acute Lung Injury through attenuating NF-kappaB and MAPK activation. Microbial Pathog. 2019, 132, 302–312. [Google Scholar] [CrossRef] [Scilit]
- Yuan, Q.; Jiang, Y.W.; Ma, T.T.; Fang, Q.H.; Pan, L. Attenuating effect of Ginsenoside Rb1 on LPS-induced lung injury in rats. J. Inflamm. 2014, 11, 40. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, Y.; Yu, Y.; Szabo, A.; Han, M.; Huang, X.-F. Central inflammation and leptin resistance are attenuated by ginsenoside Rb1 treatment in obese mice fed a high-fat diet. PLoS ONE 2014, 9, e92618. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, J.S.; Song, J.H.; Sohn, N.W.; Shin, J.W. Inhibitory effects of ginsenoside Rb1 on neuroinflammation following systemic lipopolysaccharide treatment in mice. Phytother. Res. 2013, 27, 1270–1276. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhu, J.; Jiang, Y.; Wu, L.; Lu, T.; Xu, G.; Liu, X. Suppression of local inflammation contributes to the neuroprotective effect of ginsenoside Rb1 in rats with cerebral ischemia. Neuroscience 2012, 202, 342–351. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rajput, S.A.; Zhang, C.; Feng, Y.; Wei, X.T.; Khalil, M.M.; Rajput, I.R.; Baloch, D.M.; Shaukat, A.; Rajput, N.; Qamar, H.; et al. Proanthocyanidins Alleviates AflatoxinB₁-Induced Oxidative Stress and Apoptosis through Mitochondrial Pathway in the Bursa of Fabricius of Broilers. Toxins 2019, 11, 157. [Google Scholar] [CrossRef] [Scilit]
- Hu, X.; Li, D.; Wang, J.; Guo, J.; Li, Y.; Cao, Y.; Zhang, N.; Fu, Y. Melatonin inhibits endoplasmic reticulum stress-associated TXNIP/NLRP3 inflammasome activation in lipopolysaccharide-induced endometritis in mice. Int. Immunopharmacol. 2018, 64, 101–109. [Google Scholar] [CrossRef] [Scilit]
- Gugliandolo, E.; Fusco, R.; Licata, P.; Peritore, A.F.; D’amico, R.; Cordaro, M.; Siracusa, R.; Cuzzocrea, S.; Crupi, R. Protective Effect of Hydroxytyrosol on LPS-Induced Inflammation and Oxidative Stress in Bovine Endometrial Epithelial Cell Line. Vet. Sci. 2020, 7, 161. [Google Scholar] [CrossRef] [Scilit]
- Dong, H.; Ijaz, M.; Mehmood, K.; Ali, M.; Tian, F.; Li, J.; Ahmed, S.; Shaukat, A.; Chang, Z.; Wu, Q. Protective effects of salidroside and dexamethasone against E. coli-induced inflammatory response on endometrial epithelium cells in yaks. Pak. Vet. J. 2019, 39, 101–105. [Google Scholar] [CrossRef] [Scilit]
- Carneiro, L.C.; Cronin, J.G.; Sheldon, I.M. Mechanisms linking bacterial infections of the bovine endometrium to disease and infertility. Reprod. Biol. 2016, 16, 1–7. [Google Scholar] [CrossRef] [Scilit]
- Wu, H.; Zhao, G.; Jiang, K.; Li, C.; Qiu, C.; Deng, G. Engeletin alleviates lipopolysaccharide-induced endometritis in mice by inhibiting TLR4-mediated NF-κB activation. J. Agric. Food Chem. 2016, 64, 6171–6178. [Google Scholar] [CrossRef] [Scilit]
- Zhao, G.; Jiang, K.; Yang, Y.; Zhang, T.; Wu, H.; Shaukat, A.; Qiu, C.; Deng, G. The potential therapeutic role of miR-223 in bovine endometritis by targeting the NLRP3 inflammasome. Front. Immunol. 2018, 9, 1916. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jiang, K.; Guo, S.; Zhang, T.; Yang, Y.; Zhao, G.; Shaukat, A.; Wu, H.; Deng, G. Downregulation of TLR4 by miR-181a provides negative feedback regulation to lipopolysaccharide-induced inflammation. Front. Pharmacol. 2018, 9, 142. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jiang, K.; Guo, S.; Yang, C.; Yang, J.; Chen, Y.; Shaukat, A.; Zhao, G.; Wu, H.; Deng, G. Barbaloin protects against lipopolysaccharide (LPS)-induced acute lung injury by inhibiting the ROS-mediated PI3K/AKT/NF-κB pathway. Int. Immunopharmacol. 2018, 64, 140–150. [Google Scholar] [CrossRef] [Scilit]
- Li, W.; Fu, K.; Lv, X.; Wang, Y.; Wang, J.; Li, H.; Tian, W.; Cao, R. Lactoferrin suppresses lipopolysaccharide-induced endometritis in mice via down-regulation of the NF-kappaB pathway. Int. Immunopharmacol. 2015, 28, 695–699. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zheng, X.; Wang, S.; Zou, X.; Jing, Y.; Yang, R.; Li, S.; Wang, F. Ginsenoside Rb1 improves cardiac function and remodeling in heart failure. Exp. Anim. 2017, 66, 217–228. [Google Scholar] [CrossRef] [Scilit]
- Liu, Z.; Song, L.; Zhang, P.; Cao, Z.; Hao, J.; Tian, Y.; Luo, A.; Zhang, P.; Ma, J. Ginsenoside Rb1 exerts antiarrhythmic effects by inhibiting I(Na) and I(CaL) in rabbit ventricular myocytes. Sci. Rep. 2019, 9, 20425. [Google Scholar] [CrossRef] [Scilit]
- Chen, H.; Shen, J.; Li, H.; Zheng, X.; Kang, D.; Xu, Y.; Chen, C.; Guo, H.; Xie, L.; Wang, G.; et al. Ginsenoside Rb1 exerts neuroprotective effects through regulation of Lactobacillus helveticus abundance and GABA(A) receptor expression. J. Ginseng. Res. 2020, 44, 86–95. [Google Scholar] [CrossRef] [Scilit]
- Ahmed, T.; Raza, S.H.; Maryam, A.; Setzer, W.N.; Braidy, N.; Nabavi, S.F.; de Oliveira, M.R.; Nabavi, S.M. Ginsenoside Rb1 as a neuroprotective agent: A review. Brain Res. Bull. 2016, 125, 30–43. [Google Scholar] [CrossRef] [Scilit]
- Liu, X.; Chen, J.; Sun, N.; Li, N.; Zhang, Z.; Zheng, T.; Li, Z. Ginsenoside Rb1 ameliorates autophagy via the AMPK/mTOR pathway in renal tubular epithelial cells in vitro and in vivo. Int. J. Biol. Macromol. 2020, 163, 996–1009. [Google Scholar] [CrossRef] [Scilit]
- Rajput, S.A.; Shaukat, A.; Rajput, I.R.; Kamboh, A.A.; Iqbal, Z.; Saeed, M.; Akhtar, R.W.; Shah, S.A.H.; Raza, M.A.; El Askary, A.; et al. Ginsenoside Rb1 prevents deoxynivalenol-induced immune injury via alleviating oxidative stress and apoptosis in mice. Ecotoxicol. Environ. Saf. 2021, 220, 112333. [Google Scholar] [CrossRef] [Scilit]
- Shaukat, A.; Yang, C.; Yang, Y.; Guo, Y.F.; Jiang, K.; Guo, S.; Liu, J.; Zhang, T.; Zhao, G.; Ma, X.; et al. Ginsenoside Rb 1: A novel therapeutic agent in Staphylococcusaureus-induced Acute Lung Injury with special reference to Oxidative stress and Apoptosis. Microbial Pathog. 2020, 143, 104109. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Akhtar, M.; Shaukat, A.; Zahoor, A.; Chen, Y.; Wang, Y.; Yang, M.; Umar, T.; Guo, M.; Deng, G. Hederacoside-C inhibition of Staphylococcus aureus-induced mastitis via TLR2 & TLR4 and their downstream signaling NF-κB and MAPKs pathways in vivo and in vitro. Inflammation 2019, 43, 579–594. [Google Scholar]
- Guo, J.; Wang, Y.; Jiang, P.; Yao, H.; Zhao, C.; Hu, X.; Cao, Y.; Zhang, N.; Fu, Y.; Shen, H. Sodium butyrate alleviates lipopolysaccharide-induced endometritis in mice through inhibiting inflammatory response. Microbial Pathog. 2019, 137, 103792. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jiang, K.; Yang, J.; Yang, C.; Zhang, T.; Shaukat, A.; Yang, X.; Dai, A.; Wu, H.; Deng, G. miR-148a suppresses inflammation in lipopolysaccharide-induced endometritis. J. Cell. Mol. Med. 2020, 24, 405–417. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Umar, T.; Yin, B.; Umer, S.; Ma, X.; Jiang, K.; Umar, Z.; Akhtar, M.; Shaukat, A.; Deng, G. MicroRNA: Could It Play a Role in Bovine Endometritis? Inflammation 2021, 44, 1683–1695. [Google Scholar] [CrossRef] [Scilit]
- Zhou, M.; Yi, Y.; Hong, L. Oridonin Ameliorates Lipopolysaccharide-Induced Endometritis in Mice via Inhibition of the TLR-4/NF-κBpathway. Inflammation 2019, 42, 81–90. [Google Scholar] [CrossRef] [Scilit]
- Wu, H.; Jiang, K.; Yin, N.; Ma, X.; Zhao, G.; Qiu, C.; Deng, G. Thymol mitigates lipopolysaccharide-induced endometritis by regulating the TLR4-and ROS-mediated NF-κB signaling pathways. Oncotarget 2017, 8, 20042. [Google Scholar] [CrossRef] [Scilit]
- Fu, K.; Lv, X.; Li, W.; Wang, Y.; Li, H.; Tian, W.; Cao, R. Berberine hydrochloride attenuates lipopolysaccharide-induced endometritis in mice by suppressing activation of NF-κB signal pathway. Int. Immunopharmacol. 2015, 24, 128–132. [Google Scholar] [CrossRef] [Scilit]
- Shaukat, A.; Hanif, S.; Shaukat, I.; Shukat, R.; Rajput, S.A.; Jiang, K.; Akhtar, M.; Yang, Y.; Guo, S.; Shaukat, I. Upregulated-gene expression of pro-inflammatory cytokines, oxidative stress and apoptotic markers through inflammatory, oxidative and apoptosis mediated signaling pathways in bovine pneumonia. Microbial Pathog. 2021, 155, 104935. [Google Scholar] [CrossRef] [Scilit]
- Akhtar, M.; Guo, S.; Guo, Y.-f.; Zahoor, A.; Shaukat, A.; Chen, Y.; Umar, T.; Deng, G.; Guo, M. Upregulated-gene expression of Pro-inflammatory cytokines (TNF-α, IL-1β and IL-6) via TLRs following NF-κB and MAPKs in bovine mastitis. Acta Trop. 2020, 207, 105458. [Google Scholar] [CrossRef] [Scilit]
- Zahoor, A.; Yang, Y.; Yang, C.; Akhtar, M.; Guo, Y.; Shaukat, A.; Guo, M.Y.; Deng, G. Gas6 negatively regulates the Staphylococcus aureus-induced inflammatory response via TLR signaling in the mouse mammary gland. J. Cell. Physiol. 2020, 235, 7081–7093. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Akhtar, M.; Shaukat, A.; Zahoor, A.; Chen, Y.; Wang, Y.; Yang, M.; Umar, T.; Guo, M.; Deng, G. Anti-inflammatory effects of Hederacoside-C on Staphylococcus aureus induced inflammation via TLRs and their downstream signal pathway in vivo and in vitro. Microbial Pathog. 2019, 137, 103767. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, X.; Yuan, T.; Yin, N.; Ma, X.; Zhang, Z.; Zhu, Z.; Shaukat, A.; Deng, G. Luteoloside Protects the Uterus from Staphylococcus aureus-Induced Inflammation, Apoptosis, and Injury. Inflammation 2018, 41, 1702–1716. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Akira, S.; Hirano, T.; Taga, T.; Kishimoto, T. Biology of multifunctional cytokines: IL 6 and related molecules (IL 1 and TNF). FASEB J. 1990, 4, 2860–2867. [Google Scholar] [CrossRef] [Scilit]
- Dinarello, C.A. A clinical perspective of IL-1β as the gatekeeper of inflammation. Eur. J. Immunol. 2011, 41, 1203–1217. [Google Scholar] [CrossRef] [Scilit]
- Chen, C.-Y.; Peng, W.-H.; Tsai, K.-D.; Hsu, S.-L. Luteolin suppresses inflammation-associated gene expression by blocking NF-κB and AP-1 activation pathway in mouse alveolar macrophages. Life Sci. 2007, 81, 1602–1614. [Google Scholar] [CrossRef] [Scilit]








| Target Gene | Primer | Primer Sequence (5′→3′) | Accession No. | Product Size |
|---|---|---|---|---|
| TLR4 | Forward | TTCAGAGCCGTTGGTGTATC | NM_021297.2 | 170 |
| Reverse | CTCCCATTCCAGGTAGGTGT | |||
| TNF-α | Forward | CTTCTCATTCCTGCTTGTG | NM_013693.3 | 198 |
| Reverse | ACTTGGTGGTTTGCTACG | |||
| IL-1β | Forward | CCTGGGCTGTCCTGATGAGAG | NM_008361.4 | 131 |
| Reverse | TCCACGGGAAAGACACAGGTA | |||
| IL-6 | Forward | GGCGGATCGGATGTTGTGAT | NM_031168.1 | 199 |
| Reverse | GGACCCCAGACAATCGGTTG | |||
| IL-10 | Forward | ACAGCCGGGAAGACAATAACT | NM_010548.2 | 66 |
| Reverse | GCAGCTCTAGGAGCATGTGG | |||
| GAPDH | Forward | GTGGCAAAGTGGAGATTGTTG | NM_001289726.1 | 109 |
| Reverse | TTGACTGTGCCGTTGAATTTG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Shaukat, A.; Shaukat, I.; Rajput, S.A.; Shukat, R.; Hanif, S.; Shaukat, I.; Zhang, X.; Chen, C.; Sun, X.; Ye, T.; et al. Ginsenoside Rb1 Mitigates Escherichia coli Lipopolysaccharide-Induced Endometritis through TLR4-Mediated NF-κB Pathway. Molecules 2021, 26, 7089. https://doi.org/10.3390/molecules26237089
Shaukat A, Shaukat I, Rajput SA, Shukat R, Hanif S, Shaukat I, Zhang X, Chen C, Sun X, Ye T, et al. Ginsenoside Rb1 Mitigates Escherichia coli Lipopolysaccharide-Induced Endometritis through TLR4-Mediated NF-κB Pathway. Molecules. 2021; 26(23):7089. https://doi.org/10.3390/molecules26237089
Chicago/Turabian StyleShaukat, Aftab, Irfan Shaukat, Shahid Ali Rajput, Rizwan Shukat, Sana Hanif, Imran Shaukat, Xinxin Zhang, Chao Chen, Xuyang Sun, Tingzhu Ye, and et al. 2021. "Ginsenoside Rb1 Mitigates Escherichia coli Lipopolysaccharide-Induced Endometritis through TLR4-Mediated NF-κB Pathway" Molecules 26, no. 23: 7089. https://doi.org/10.3390/molecules26237089
APA StyleShaukat, A., Shaukat, I., Rajput, S. A., Shukat, R., Hanif, S., Shaukat, I., Zhang, X., Chen, C., Sun, X., Ye, T., Niu, K., Yao, Z., Shaukat, S., Safdar, M., Abdelrahman, M., Riaz, U., Zhao, J., Gu, X., & Yang, L. (2021). Ginsenoside Rb1 Mitigates Escherichia coli Lipopolysaccharide-Induced Endometritis through TLR4-Mediated NF-κB Pathway. Molecules, 26(23), 7089. https://doi.org/10.3390/molecules26237089

