Quercetin Prevents LPS-Induced Oxidative Stress and Inflammation by Modulating NOX2/ROS/NF-kB in Lung Epithelial Cells
Abstract
:1. Introduction
2. Materials and Methods
2.1. Reagents and Antibodies
2.2. Cell Culture
2.3. Cell Viability Assay
2.4. RNA Isolation and Quantitative Polymerase Chain Reaction
2.5. Determination of Intracellular ROS
2.6. Nuclear and Cytosolic Fractionation
2.7. Western Blot Analysis
2.8. Enzyme-Linked Immunosorbent Assay
2.9. Statistical Analyses
3. Results
3.1. Effects of Quercetin on Cell Viability
3.2. Quercetin Prevents LPS-Induced Oxidative Stress in Lung Epithelial Cells
3.3. Quercetin Prevents LPS-Induced Oxidative Stress by Suppressing NOX2 Production
3.4. Quercetin Inhibits LPS-Induced Inflammation in Lung Epithelial Cells
3.5. Quercetin Significantly Decreases LPS-Induced Nuclear Translocation of NF-κB in Lung Epithelial Cells
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Sample Availability
References
- Matthay, M.A.; Zemans, R.L. The acute respiratory distress syndrome: Pathogenesis and treatment. Annu. Rev. Pathol. 2011, 6, 147–163. [Google Scholar] [CrossRef] [Green Version]
- Herrero, R.; Sanchez, G.; Lorente, J.A. New insights into the mechanisms of pulmonary edema in acute lung injury. Ann. Transl. Med. 2018, 6, 32. [Google Scholar] [CrossRef] [PubMed]
- Matthay, M.A.; Zimmerman, G.A. Acute lung injury and the acute respiratory distress syndrome: Four decades of inquiry into pathogenesis and rational management. Am. J. Respir. Cell Mol. Biol. 2005, 33, 319–327. [Google Scholar] [CrossRef] [PubMed]
- Kellner, M.; Noonepalle, S.; Lu, Q.; Srivastava, A.; Zemskov, E.; Black, S.M. ROS Signaling in the pathogenesis of acute lung injury (ALI) and acute respiratory distress syndrome (ARDS). Adv. Exp. Med. Biol. 2017, 967, 105–137. [Google Scholar]
- Lee, I.T.; Yang, C.M. Role of NADPH oxidase/ROS in pro-inflammatory mediators-induced airway and pulmonary diseases. Biochem. Pharmacol. 2012, 84, 581–590. [Google Scholar] [CrossRef] [PubMed]
- Pendyala, S.; Usatyuk, P.V.; Gorshkova, I.A.; Garcia, J.G.; Natarajan, V. Regulation of NADPH oxidase in vascular endothelium: The role of phospholipases, protein kinases, and cytoskeletal proteins. Antioxid. Redox Signal. 2009, 11, 841–860. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Segal, B.H.; Davidson, B.A.; Hutson, A.D.; Russo, T.A.; Holm, B.A.; Mullan, B.; Habitzruther, M.; Holland, S.M.; Knight, P.R., 3rd. Acid aspiration-induced lung inflammation and injury are exacerbated in NADPH oxidase-deficient mice. Am. J. Physiol. Lung Cell Mol. Physiol. 2007, 292, L760–L768. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rahman, I.; Adcock, I.M. Oxidative stress and redox regulation of lung inflammation in COPD. Eur. Respir. J. 2006, 28, 219–242. [Google Scholar] [CrossRef] [PubMed]
- Park, H.S.; Kim, S.R.; Lee, Y.C. Impact of oxidative stress on lung diseases. Respirology 2009, 14, 27–38. [Google Scholar] [CrossRef] [PubMed]
- Li, Q.; Verma, I.M. NF-κB regulation in the immune system. Nat. Rev. Immunol. 2002, 2, 725–734. [Google Scholar] [CrossRef]
- Wright, J.G.; Christman, J.W. The role of nuclear factor kappa B in the pathogenesis of pulmonary diseases: Implications for therapy. Am. J. Respir. Med. 2003, 2, 211–219. [Google Scholar] [CrossRef]
- Pietta, P.G. Flavonoids as antioxidants. J. Nat. Prod. 2000, 63, 1035–1042. [Google Scholar] [CrossRef] [PubMed]
- Hu, X.T.; Ding, C.; Zhou, N.; Xu, C. Quercetin protects gastric epithelial cell from oxidative damage in vitro and in vivo. Eur. J. Pharmacol. 2015, 754, 115–124. [Google Scholar] [CrossRef] [PubMed]
- Zerin, T.; Kim, Y.S.; Hong, S.Y.; Song, H.Y. Quercetin reduces oxidative damage induced by paraquat via modulating expression of antioxidant genes in A549 cells. J. Appl. Toxicol. 2013, 33, 1460–1467. [Google Scholar] [CrossRef] [PubMed]
- Wu, W.; Li, R.; Li, X.; He, J.; Jiang, S.; Liu, S.; Yang, J. Quercetin as an antiviral agent inhibits influenza A virus (IAV) entry. Viruses 2015, 8, 6. [Google Scholar] [CrossRef]
- Rauf, A.; Imran, M.; Khan, I.A.; Ur-Rehman, M.; Gilani, S.A.; Mehmood, Z.; Mubarak, M.S. Anticancer potential of quercetin: A comprehensive review. Phytother. Res. 2018, 32, 2109–2130. [Google Scholar] [CrossRef]
- Lesjak, M.; Beara, I.; Simin, N.; Pintać, D.; Majkić, T.; Bekvalac, K.; Orčić, D.; Mimica-Dukić, N. Antioxidant and anti-inflammatory activities of quercetin and its derivatives. J. Funct. Foods. 2018, 40, 68–75. [Google Scholar] [CrossRef]
- Lin, H.Y.; Juan, S.H.; Shen, S.C.; Hsu, F.L.; Chen, Y.C. Inhibition of lipopolysaccharide-induced nitric oxide production by flavonoids in RAW264.7 macrophages involves heme oxygenase-1. Biochem. Pharmacol. 2003, 66, 1821–1832. [Google Scholar] [CrossRef]
- Endale, M.; Park, S.C.; Kim, S.; Kim, S.H.; Yang, Y.; Cho, J.Y.; Rhee, M.H. Quercetin disrupts tyrosine-phosphorylated phosphatidylinositol 3-kinase and myeloid differentiation factor-88 association, and inhibits MAPK/AP-1 and IKK/NF-kappaB-induced inflammatory mediators production in RAW 264.7 cells. Immunobiology 2013, 218, 1452–1467. [Google Scholar] [CrossRef]
- Chekalina, N.; Burmak, Y.; Petrov, Y.; Borisova, Z.; Manusha, Y.; Kazakov, Y.; Kaidashev, I. Quercetin reduces the transcriptional activity of NF-kB in stable coronary artery disease. Indian Heart J. 2018, 70, 593–597. [Google Scholar] [CrossRef]
- Luo, M.; Tian, R.; Yang, Z.; Peng, Y.Y.; Lu, N. Quercetin suppressed NADPH oxidase-derived oxidative stress via heme oxygenase-1 induction in macrophages. Arch. Biochem. Biophys. 2019, 671, 69–76. [Google Scholar] [CrossRef] [PubMed]
- Al-Mehdi, A.B.; Zhao, G.; Dodia, C.; Tozawa, K.; Costa, K.; Muzykantov, V.; Ross, C.; Blecha, F.; Dinauer, M.; Fisher, A.B. Endothelial NADPH oxidase as the source of oxidants in lungs exposed to ischemia or high K+. Circ. Res. 1998, 83, 730–737. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fisher, A.B.; Al-Mehdi, A.B.; Wei, Z.; Song, C.; Manevich, Y. Lung ischemia: Endothelial cell signaling by reactive oxygen species. A progress report. Adv. Exp. Med. Biol. 2003, 510, 343–347. [Google Scholar] [PubMed]
- Barnes, P.J. The cytokine network in asthma and chronic obstructive pulmonary disease. J. Clin. Investig. 2008, 118, 3546–3556. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Takizawa, H. Airway epithelial cells as regulators of airway inflammation. Int. J. Mol. Med. 1998, 1, 367–378. [Google Scholar] [CrossRef]
- Gao, X.H.; Zhang, S.D.; Wang, L.T.; Yu, L.; Zhao, X.L.; Ni, H.Y.; Wang, Y.Q.; Wang, J.D.; Shan, C.H.; Fu, Y. Anti-inflammatory effects of neochlorogenic acid extract from mulberry leaf (Morus alba L.) against LPS-stimulated inflammatory response through mediating the AMPK/Nrf2 signaling pathway in A549 Cells. Molecules 2020, 25, 1385. [Google Scholar] [CrossRef] [Green Version]
- Stringer, B.; Kobzik, L. Environmental particulate-mediated cytokine production in lung epithelial cells (A549): Role of preexisting inflammation and oxidant stress. J. Toxicol. Environ. Health A 1998, 55, 31–44. [Google Scholar]
- Luo, Y.; Che, W.; Zhao, M. Ulinastatin post-treatment attenuates lipopolysaccharide-induced acute lung injury in rats and human alveolar epithelial cells. Int. J. Mol. Med. 2017, 39, 297–306. [Google Scholar] [CrossRef] [Green Version]
- Griffith, B.; Pendyala, S.; Hecker, L.; Lee, P.J.; Natarajan, V.; Thannickal, V.J. NOX enzymes and pulmonary disease. Antioxid. Redox Signal. 2009, 11, 2505–2516. [Google Scholar] [CrossRef] [Green Version]
- Yao, H.; Yang, S.R.; Kode, A.; Rajendrasozhan, S.; Caito, S.; Adenuga, D.; Henry, R.; Edirisinghe, I.; Rahman, I. Redox regulation of lung inflammation: Role of NADPH oxidase and NF-kappaB signalling. Biochem. Soc. Trans. 2007, 35, 1151–1155. [Google Scholar] [CrossRef]
- Rocksén, D.; Lilliehöök, B.; Larsson, R.; Johansson, T.; Bucht, A. Differential anti-inflammatory and anti-oxidative effects of dexamethasone and N-acetylcysteine in endotoxin-induced lung inflammation. Clin. Exp. Immunol. 2000, 122, 249–256. [Google Scholar] [CrossRef] [PubMed]
- Veith, C.; Drent, M.; Bast, A.; van Schooten, F.J.; Boots, A.W. The disturbed redox-balance in pulmonary fibrosis is modulated by the plant flavonoid quercetin. Toxicol. Appl. Pharmacol. 2017, 336, 40–48. [Google Scholar] [CrossRef] [PubMed]
- Xiao, X.; Shi, D.; Liu, L.; Wang, J.; Xie, X.; Kang, T.; Wuguo, D. Quercetin suppresses cyclooxygenase-2 expression and angiogenesis through inactivation of P300 signaling. PLoS ONE 2011, 6, e22934. [Google Scholar] [CrossRef]
- Warren, C.A.; Paulhill, K.J.; Davidson, L.A.; Lupton, J.R.; Taddeo, S.S.; Hong, M.Y.; Carroll, R.J.; Chapkin, R.S.; Turner, N.D. Quercetin may suppress rat aberrant crypt foci formation by suppressing inflammatory mediators that influence proliferation and apoptosis. J. Nutr. 2009, 139, 101–105. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kao, T.K.; Ou, Y.C.; Raung, S.L.; Lai, C.Y.; Liao, S.L.; Chen, C.J. Inhibition of nitric oxide production by quercetin in endotoxin/cytokine-stimulated microglia. Life Sci. 2010, 86, 315–321. [Google Scholar] [CrossRef]
- Xiong, G.; Ji, W.; Wang, F.; Zhang, F.; Xue, P.; Cheng, M.; Sun, Y.; Wang, X.; Zhang, T. Quercetin Inhibits Inflammatory Response Induced by LPS from Porphyromonas gingivalis in Human Gingival Fibroblasts via Suppressing NF-kappaB Signaling Pathway. Biomed. Res. Int. 2019, 2016, 6282635. [Google Scholar]
- Edwards, M.R.; Bartlett, N.W.; Clarke, D.; Birrell, M.; Belvisi, M.; Johnston, S.L. Targeting the NF-kappaB pathway in asthma and chronic obstructive pulmonary disease. Pharmacol. Ther. 2009, 121, 1–13. [Google Scholar] [CrossRef]
- Choi, J.S.; Lee, H.S.; Seo, K.H.; Na, J.O.; Kim, Y.H.; Uh, S.T.; Park, C.S.; Oh, M.H.; Lee, S.H.; Kim, Y.T. The effect of post-treatment N-acetylcysteine in LPS-induced acute lung injury of rats. Tuberc. Respir. Dis. 2012, 73, 22–31. [Google Scholar] [CrossRef] [Green Version]
- Farrag, Y.; Ide, W.; Montero, B.; Rico, M.; Rodriguez-Llamazares, S.; Barral, L.; Bouza, R. Preparation of starch nanoparticles loaded with quercetin using nanoprecipitation technique. Int. J. Biol. Macromol. 2018, 114, 426–433. [Google Scholar] [CrossRef]
- Malayeri, A.R.; Hemmati, A.A.; Arzi, A.; Rezaie, A.; Ghafurian-Boroojerdnia, M.; Khalili, H.R. A comparison of the effects of quercetin hydrate with those of vitamin E on the levels of IL-13, PDGF, TNF-α, and INF-γ in bleomycin-induced pulmonary fibrosis in rats. Jundishapur J. Nat. Pharm. Prod. 2016, 11, e27705. [Google Scholar] [CrossRef] [Green Version]
- Bidian, C.; Mitrea, D.R.; Vasile, O.G.; Filip, A.; Cătoi, A.F.; Moldovan, R.; Decea, N.; Albu, A. Quercetin and curcumin effects in experimental pleural inflammation. Med. Pharm. Rep. 2020, 93, 260–266. [Google Scholar] [CrossRef] [PubMed]
Gene Name | Forward Primer Sequence (5′-3′) | Reverse Primer Sequence (5′-3′) |
---|---|---|
NOX2 | GCAGCCTGCCTGAATTTCA | TGAGCAGCACGCACTGGA |
TNFα | CTCTCTCTAATCAGCCCTCTG | GAGGACCTGGGAGTAGATGAG |
IL-1β | AGCTACGAATCTCCGACCAC | CGTTATCCCATGTGTCGAAGAA |
IL-6 | ACTCACCTCTTCAGAACGAATTG | CCATCTTTGGAAGGTTCAGGTTG |
RPS3 | GCTGAAGATGGCTACTCTGGA | ACAGCAGTCAGTTCCCGAATCC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sul, O.-J.; Ra, S.W. Quercetin Prevents LPS-Induced Oxidative Stress and Inflammation by Modulating NOX2/ROS/NF-kB in Lung Epithelial Cells. Molecules 2021, 26, 6949. https://doi.org/10.3390/molecules26226949
Sul O-J, Ra SW. Quercetin Prevents LPS-Induced Oxidative Stress and Inflammation by Modulating NOX2/ROS/NF-kB in Lung Epithelial Cells. Molecules. 2021; 26(22):6949. https://doi.org/10.3390/molecules26226949
Chicago/Turabian StyleSul, Ok-Joo, and Seung Won Ra. 2021. "Quercetin Prevents LPS-Induced Oxidative Stress and Inflammation by Modulating NOX2/ROS/NF-kB in Lung Epithelial Cells" Molecules 26, no. 22: 6949. https://doi.org/10.3390/molecules26226949
APA StyleSul, O.-J., & Ra, S. W. (2021). Quercetin Prevents LPS-Induced Oxidative Stress and Inflammation by Modulating NOX2/ROS/NF-kB in Lung Epithelial Cells. Molecules, 26(22), 6949. https://doi.org/10.3390/molecules26226949