Effect of Hydrolyzable Tannins on Glucose-Transporter Expression and Their Bioavailability in Pig Small-Intestinal 3D Cell Model
Abstract
:1. Introduction
2. Results
2.1. Viability of Cells Exposed to Wood Extracts
2.2. Gene Expression in CLAB Cells Exposed to Wood Extracts
2.3. Glucose Bioavailability
2.4. Hydrolyzable-Tannin Bioavailability
3. Discussion
3.1. Gene Expression and Glucose Transport
3.2. Tannin Bioavailability
4. Materials and Methods
4.1. Cell Cultures
4.2. Hydrolyzable Tannins
4.3. Viability of Cells Exposed to Wood Extracts
4.4. Gene-Expression Assay
4.5. RNA Concentration, Purity, and Transcription into cDNA
4.6. Primer Design and RNA Sequence Retrieval
4.7. Quantitative Real-Time PCR
4.8. Glucose Bioavailability
4.9. Hydrolyzable-Tannin Bioavailability
4.10. LC–MS/MS Analysis of Hydrolyzable Tannins
4.11. Statistical Analysis
5. Conclusions
- -
- Tanex at 4 µg/mL significantly increases the expression of GLUT2 in CLAB cells.
- -
- Tanex at 1 µg/mL significantly facilitated glucose transport in the CLAB 3D cell model.
- -
- Glucose uptake in CLAB cells is influenced by the origin of the wood extract.
- -
- Gallic acid passes through the enterocyte in the PSI cell line 3D model, which is most pronounced with Tanex.
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Sample Availability
Ethics Approval and Consent to Participate
References
- Thacker, P.A. Alternatives to antibiotics as growth promoters for use in swine production: A review. J. Anim. Sci. Biotechnol. 2013, 4, 35–47. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Valenzuela-Grijalva, N.V.; Pinelli-Saavedra, A.; Muhlia-Almazan, A.; Dominguez-Diaz, D.; Gonzalez-Rios, H. Dietary inclusion effects of phytochemicals as growth promoters in animal production. J. Anim. Sci. Technol. 2017, 59, 8. [Google Scholar] [CrossRef] [Green Version]
- Li, M.; Kai, Y.; Qiang, H.; Dongying, J. Biodegradation of gallotannins and ellagitannins. J. Basic Microbiol. 2006, 46, 68–84. [Google Scholar] [CrossRef]
- Khanbabaee, K.; Van Ree, T. Tannins: Classification and definition. Nat. Prod. Rep. 2001, 18, 641–649. [Google Scholar] [PubMed]
- Mangan, J.L. Nutritional effects of tannins in animal feeds. Nutr. Res. Rev. 1988, 1, 209–231. [Google Scholar]
- Saura-Calixto, F.; Pérez-Jiménez, J. Tannins: Bioavailability and mechanisms of action. In Chemoprevention of Cancer and DNA Damage by Dietary Factors; Knasmüller, P.D.S., De Marini, D.D.M., Johnson, P.I., Gerhäuser, D.C., Eds.; Wiley-VCH Verlag GmbH & Co.: Weinheim, Germany, 2009; pp. 499–508. [Google Scholar] [CrossRef]
- Smeriglio, A.; Barreca, D.; Bellocco, E.; Trombetta, D. Proanthocyanidins and hydrolysable tannins: Occurrence, dietary intake and pharmacological effects. Br. J. Pharmacol. 2017, 174, 1244–1262. [Google Scholar] [CrossRef] [PubMed]
- Ueda, K.; Kawabata, R.; Irie, T.; Nakai, Y.; Tohya, Y.; Sakaguchi, T. Inactivation of pathogenic viruses by plant-derived tannins: Strong effects of extracts from persimmon (Diospyros kaki) on a broad range of viruses. PLoS ONE 2013, 8, e55343. [Google Scholar] [CrossRef]
- Whitley, A.C.; Stoner, G.D.; Darby, M.V.; Walle, T. Intestinal epithelial cell accumulation of the cancer preventive polyphenol ellagic acid—Extensive binding to protein and DNA. Biochem. Pharmacol. 2003, 66, 907–915. [Google Scholar] [CrossRef]
- Brus, M.; Langerholc, T.; Škorjanc, D. Effect of hydrolysable tannins on proliferation of small intestinal porcine and human enterocytes. In Proceedings of the 8th International Symposium on the Mediterranean Pig, Ljubljana, Slovenia, 10−12 October 2013; pp. 131–134. [Google Scholar]
- Walgren, R.A.; Walle, U.K.; Walle, T. Transport of quercetin and its glucosides across human intestinal epithelial Caco-2 cells. Biochem. Pharmacol. 1998, 55, 1721–1727. [Google Scholar]
- Deprez, S.; Mila, I.; Huneau, J.F.; Tome, D.; Scalbert, A. Transport of proanthocyanidin dimer, trimer, and polymer across monolayers of human intestinal epithelial Caco-2 cells. Antioxid. Redox Signal. 2001, 3, 957–967. [Google Scholar] [CrossRef]
- Tarahovsky, Y.S. Plant polyphenols in cell–cell interaction and communication. Plant Signal Behav. 2008, 3, 609–611. [Google Scholar] [CrossRef] [PubMed]
- Soares, S.; Mateus, N.; de Freitas, V. Interaction of different classes of salivary proteins with food tannins. Food Res. Int. 2012, 49, 807–813. [Google Scholar] [CrossRef]
- Cowan, M.M. Plant products as antimicrobial agents. Clin. Microbiol. Rev. 1999, 12, 564–582. [Google Scholar] [PubMed] [Green Version]
- Cho, K.W.Y.; Khalili, K.; Zandomeni, R.; Weinma, R. The Gene Encoding the large subunit of human RNA polymerase II. J. Biol. Chem. 1985, 260, 15204–15210. [Google Scholar]
- Ten Asbroek, A.L.M.A.; Fluiter, K.; van Groenigen, M.; Nooij, M.; Baas, F. Polymorphisms in the large subunit of human RNA polymerase II as target for allele-specific inhibition. Nucleic Acids Res. 2000, 28, 1133–1138. [Google Scholar]
- Mueckler, M. Facilitative glucose transporters. Eur. J. Biochem. 1994, 219, 713–725. [Google Scholar] [CrossRef]
- Wright, E.M.; Loo, D.D.F.; Hirayama, B.A. Biology of human sodium glucose transporters. Physiol. Rev. 2011, 91, 733–794. [Google Scholar] [CrossRef] [Green Version]
- Ait-Omar, A.; Monteiro-Sepulveda, M.; Poitou, C.; Le Gall, M.; Cotillard, A.; Gilet, J.; Garbin, K.; Houllier, A.; Chateau, D.; Lacombe, A.; et al. GLUT2 accumulation in enterocyte apical and intracellular membranes: A study in morbidly obese human subjects and ob/ob and high fat-fed mice. Diabetes 2011, 60, 2598–2607. [Google Scholar] [CrossRef] [Green Version]
- Kellett, G.L.; Helliwell, P.A. The diffusive component of intestinal glucose absorption is mediated by the glucose-induced recruitment of GLUT2 to the brush–border membrane. Biochem. J. 2000, 350, 155–162. [Google Scholar]
- Zheng, Y.; Scow, J.S.; Duenes, J.A.; Sarr, M.G. Mechanisms of glucose uptake in intestinal cell lines: Role of GLUT2. Surgery 2012, 151, 13–25. [Google Scholar] [CrossRef] [Green Version]
- Kellett, G.L. The facilitated component of intestinal glucose absorption. J. Physiol. 2001, 531, 585–595. [Google Scholar] [CrossRef] [PubMed]
- Kellett, G.L.; Brot-Laroche, E. Apical GLUT2: A major pathway of intestinal sugar absorption. Diabetes 2005, 54, 3056–3062. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gorboulev, V.; Schurmann, A.; Vallon, V.; Kipp, H.; Jaschke, A.; Klessen, D.; Friedrich, A.; Scherneck, S.; Rieg, T.; Cunard, R.; et al. Na(+)-D-glucose cotransporter SGLT1 is pivotal for intestinal glucose absorption and glucose-dependent incretin secretion. Diabetes 2012, 61, 187–196. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Röder, P.V.; Geillinger, K.E.; Zietek, T.S.; Thorens, B.; Koepsell, H.; Daniel, H. The role of SGLT1 and GLUT2 in intestinal glucose transport and sensing. PLoS ONE 2014, 9, e89977. [Google Scholar] [CrossRef]
- Cermak, R.; Landgraf, S.; Wolffram, S. Quercetin glucosides inhibit glucose uptake into brush-border-membrane vesicles of porcine jejunum. Br. J. Nutr. 2004, 91, 849–855. [Google Scholar] [CrossRef] [Green Version]
- Kwon, O.; Eck, P.; Chen, S.L.; Corpe, C.P.; Lee, J.H.; Kruhlak, M.; Levine, M. Inhibition of the intestinal glucose transporter GLUT2 by flavonoids. FASEB J. 2007, 21, 366–377. [Google Scholar] [CrossRef] [Green Version]
- Aschenbach, J.R.; Steglich, K.; Gabel, G.; Honscha, K.U. Expression of mRNA for glucose transport proteins in jejunum, liver, kidney and skeletal muscle of pigs. J. Physiol. Biochem. 2009, 65, 251–266. [Google Scholar] [CrossRef]
- Pinent, M.; Blay, M.; Blade, M.C.; Salvado, M.J.; Arola, L.; Ardevol, A. Grape seed-derived procyanidins have an antihyperglycemic effect in streptozotocin-induced diabetic rats and insulinomimetic activity in insulin-sensitive cell lines. Endocrinology 2004, 145, 4985–4990. [Google Scholar] [CrossRef] [Green Version]
- Cencic, A.; Langerholc, T. Functional cell models of the gut and their applications in food microbiology—A review. Int. J. Food Microbiol. 2010, 141, S4–S14. [Google Scholar] [CrossRef]
- Gorenjak, M.; Skok, P.; Cencic, A. Novel promising functional cell models to study molecular events in metabolic syndrome. Nutr. Ther. Metab. 2012, 30, 34–41. [Google Scholar]
- Gradisnik, L.; Filipic, B.; De Vaureix, C.; Lefevre, F.; La Bonnardiere, C.; Cencic, A. Establishment of a functional cell culture model of the pig small intestine. ALTEX 2006, 23, 94. [Google Scholar]
- Manzano, S.; Williamson, G. Polyphenols and phenolic acids from strawberry and apple decrease glucose uptake and transport by human intestinal Caco-2 cells. Mol. Nutr. Food Res. 2010, 54, 1773–1780. [Google Scholar] [CrossRef] [PubMed]
- Oliveira, D.M.; Freitas, H.S.; Souza, M.F.F.; Arçari, D.P.; Ribeiro, M.L.; Carvalho, P.O.; Bastos, D.H.M. Yerba mate’(Ilex paraguariensis) aqueous extract decreases intestinal SGLT1 Gene expression but does not affect other biochemical parameters in alloxan-diabetic Wistar rats. J. Agric. Food Chem. 2008, 56, 10527–10532. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Li, L.; Kim, S.H.; Hagerman, A.E.; Lu, J. Anti-cancer, anti-diabetic and other pharmacologic and biological activities of penta-galloyl-glucose. Pharm. Res. 2009, 26, 2066–2080. [Google Scholar] [CrossRef] [Green Version]
- Bai, N.; He, K.; Roller, M.; Zheng, B.; Chen, X.; Shao, Z.; Peng, T.; Zheng, Q. Active compounds from Lagerstroemia speciosa, insulin-like glucose uptake-stimulatory/inhibitory and adipocyte differentiation-inhibitory activities in 3T3-L1 cells. J. Agric. Food Chem. 2008, 56, 11668–11674. [Google Scholar] [CrossRef]
- Cao, Y.; Himmeldirk, K.B.; Qian, Y.; Ren, Y.; Malki, A.; Chen, X. Biological and biomedical functions of penta-O-galloyl-D-glucose and its derivatives. J. Nat. Med. 2014, 68, 465–472. [Google Scholar] [CrossRef]
- Liu, X.; Kim, J.K.; Li, Y.; Li, J.; Liu, F.; Chen, X. Tannic acid stimulates glucose transport and inhibits adipocyte differentiation in 3T3-L1 cells. J. Nutr. 2005, 135, 165–171. [Google Scholar] [CrossRef] [Green Version]
- Prasad, C.N.; Anjana, T.; Banerji, A.; Gopalakrishnapillai, A. Gallic acid induces GLUT4 translocation and glucose uptake activity in 3T3-L1 cells. FEBS Lett. 2010, 584, 531–536. [Google Scholar] [CrossRef] [Green Version]
- Zanotti, I.; Dall’Asta, M.; Mena, P.; Mele, L.; Bruni, R.; Ray, S.; Del Rio, D. Atheroprotective effects of (poly)phenols: A focus on cell cholesterol metabolism. Food Funct. 2015, 6, 13–31. [Google Scholar] [CrossRef]
- Cai, K.; Hagerman, A.E.; Minto, R.E.; Bennick, A. Decreased polyphenol transport across cultured intestinal cells by a salivary proline-rich protein. Biochem. Pharmacol. 2006, 71, 1570–1580. [Google Scholar] [CrossRef]
- Cai, K.; Bennick, A. Effect of salivary proteins on the transport of tannin and quercetin across intestinal epithelial cells in culture. Biochem. Pharmacol. 2006, 72, 974–980. [Google Scholar] [CrossRef] [PubMed]
- Matsui, T.; Ueda, T.; Oki, T.; Sugita, K.; Terahara, N.; Matsumoto, K. Alpha-glucosidase inhibitory action of natural acylated anthocyanins. 1. Survey of natural pigments with potent inhibitory activity. J. Agric. Food Chem. 2001, 49, 1948–1951. [Google Scholar] [CrossRef] [PubMed]
- Sevgi, K.; Tepe, B.; Sarikurkcu, C. Antioxidant and DNA damage protection potentials of selected phenolic acids. Food Chem. Toxicol. 2015, 77, 12–21. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
Major Components (%) | Tanex | Farmatan | Contan |
---|---|---|---|
Hydrolyzable tannins | 63.8 | 74.3 | 69.2 |
Vescalin | 0.47 | 0.9 | 0.64 |
Castalin | 2.11 | 1.7 | 0.94 |
Roburin A | 0.62 | 0.2 | 1.86 |
Gallic acid | 2.03 | 2.4 | 1.17 |
Roburin B/C | 1.17 | 2.1 | 3.57 |
Grandinin | 0.49 | 0.9 | 1.21 |
Roburin D | 0.60 | 1.0 | 0.26 |
Vescalagin | 0.45 | 4.7 | 6.54 |
Roburin E | 2.45 | 1.5 | 2.55 |
Castalagin | 2.93 | 4.1 | 6.22 |
Ellagic acid | 2.38 | 0.8 | 0.42 |
Gene | Gene Name | Accession Number | Primer Sequence 5′ → 3′ |
---|---|---|---|
SGLT1 | Solute carrier family 5 member 1 | NM_001164021.1 | AGTGGGCAGCTCTTCGATTA CCAGCCCAATCATACATCCT Amplicon size: 148 bp |
GLUT2 | Solute carrier family 2 member 2 | NM_001097417.1 | ATTCTTTGGTGGGATGCTTG ATGAGATGGTCCCAATTTCG Amplicon size: 118 bp |
GLUT4 | Solute carrier family 2 member 4 | NM_001128433.1 | TCATCATCGGCATGAGTTTC CGGGTTTCAGGCACTTTTAG Amplicon size: 121 bp |
POLR2A | Polymerase II, polypeptide A | XM_005669224.1 | ACCATCAAGCGAGTGCAGTT TCGGTTGTCTCTGGGTATTTG Amplicon size: 95 bp |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Brus, M.; Frangež, R.; Gorenjak, M.; Kotnik, P.; Knez, Ž.; Škorjanc, D. Effect of Hydrolyzable Tannins on Glucose-Transporter Expression and Their Bioavailability in Pig Small-Intestinal 3D Cell Model. Molecules 2021, 26, 345. https://doi.org/10.3390/molecules26020345
Brus M, Frangež R, Gorenjak M, Kotnik P, Knez Ž, Škorjanc D. Effect of Hydrolyzable Tannins on Glucose-Transporter Expression and Their Bioavailability in Pig Small-Intestinal 3D Cell Model. Molecules. 2021; 26(2):345. https://doi.org/10.3390/molecules26020345
Chicago/Turabian StyleBrus, Maksimiljan, Robert Frangež, Mario Gorenjak, Petra Kotnik, Željko Knez, and Dejan Škorjanc. 2021. "Effect of Hydrolyzable Tannins on Glucose-Transporter Expression and Their Bioavailability in Pig Small-Intestinal 3D Cell Model" Molecules 26, no. 2: 345. https://doi.org/10.3390/molecules26020345
APA StyleBrus, M., Frangež, R., Gorenjak, M., Kotnik, P., Knez, Ž., & Škorjanc, D. (2021). Effect of Hydrolyzable Tannins on Glucose-Transporter Expression and Their Bioavailability in Pig Small-Intestinal 3D Cell Model. Molecules, 26(2), 345. https://doi.org/10.3390/molecules26020345