Immunomodulatory Activities of Ammodytes personatus Egg Lipid in RAW264.7 Cells
Abstract
1. Introduction
2. Results
2.1. Fatty Acid Analysis of A. personatus Egg Lipid
2.2. Effect of A. personatus Egg Lipid on Cytotoxicity and NO Production in RAW264.7 Cells
2.3. Effect of A. personatus Egg Lipid on Immune-Related Gene Expression
2.4. Effect of A. personatus Egg Lipid on Phagocytic Uptake
2.5. Effect of A. personatus Egg Lipid on Inflammatory Cell Surface Molecule Expression
2.6. Effect of A. personatus Egg Lipid on MAPK and NF-κB Signaling Pathways
3. Discussion
4. Materials and Methods
4.1. Preparation of A. personatus Eggs
4.2. Lipid Extraction Method
4.3. Gas Chromatography
4.4. Animal Cell Culture
4.5. Cell Proliferation and NO Production Assay
4.6. RNA Extraction and cDNA Synthesis
4.7. Real-Time PCR Analysis of Immune-Associated Gene Expression
4.8. Determination of Phagocytic Uptake
4.9. Expression of Surface Molecules on RAW264.7 Cells
4.10. Western Blotting Assay
4.11. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Hooper, L.V.; Littman, D.R.; Macpherson, A.J. Interactions between the microbiota and the immune system. Science 2012, 336, 1268–1273. [Google Scholar] [CrossRef] [Scilit]
- Medzhitov, R.; Janeway, C., Jr. Innate immune recognition: Mechanisms and pathways. Immunol. Rev. 2000, 173, 89–97. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fujiwara, N.; Kobayashi, K. Macrophages in inflammation. Curr. Drug Targets Inflamm. Allergy 2005, 4, 281–286. [Google Scholar] [CrossRef] [Scilit]
- Monmai, C.; Go, S.H.; Shin, I.S.; You, S.G.; Lee, H.; Kang, S.B.; Park, W.J. Immune-enhancement and anti-inflammatory activities of fatty acids extracted from Halocynthia aurantium tunic in RAW264.7 cells. Mar. Drugs 2018, 16, 309. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Korhonen, R.; Lahti, A.; Kankaanranta, H.; Moilanen, E. Nitric oxide production and signaling in inflammation. Curr. Drug Targets Inflamm. Allergy 2005, 4, 471–479. [Google Scholar] [CrossRef] [Scilit]
- Inkanuwat, A.; Sukaboon, R.; Reamtong, O.; Asawanonda, P.; Pattaratanakun, A.; Saisavoey, T.; Sangtanoo, P.; Karnchanatat, A. Nitric oxide synthesis inhibition and anti-inflammatory effect of polypeptide isolated from chicken feather meal in lipopolysaccharide-stimulated RAW 264.7 macrophages. Food Technol. Biotechnol. 2019, 57, 200–212. [Google Scholar] [CrossRef] [Scilit]
- Palmieri, E.M.; McGinity, C.; Wink, D.A.; McVicar, D.W. Nitric oxide in macrophage immunometabolism: Hiding in plain sight. Metabolites 2020, 10, 429. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, Q.; Verma, I.M. NF-κB regulation in the immune system. Nat. Rev. Immunol. 2002, 2, 725–734. [Google Scholar] [CrossRef] [Scilit]
- Hommes, D.W.; Peppelenbosch, M.P.; van Deventer, S.J.H. Mitogen activated protein (MAP) kinase signal transduction pathways and novel anti-inflammatory targets. Gut 2003, 52, 144–151. [Google Scholar] [CrossRef] [Scilit]
- Roche, H.M. Unsaturated fatty acids. Proc. Nutr. Soc. 1999, 58, 397–401. [Google Scholar] [CrossRef] [Scilit]
- Wolfe, L.S. Eicosanoids: Prostaglandins, thromboxanes, leukotrienes, and other derivatives of carbon-20 unsaturated fatty acids. J. Neurochem. 1982, 38, 1–14. [Google Scholar] [CrossRef] [Scilit]
- Massey, K.A.; Nicolaou, A. Lipidomics of polyunsaturated-fatty-acid-derived oxygenated metabolites. Biochem. Soc. Trans. 2011, 39, 1240–1246. [Google Scholar] [CrossRef] [Scilit]
- Calder, P.C. Omega-3 polyunsaturated fatty acids and inflammatory processes: Nutrition or pharmacology? Br. J. Clin. Pharmacol. 2013, 75, 645–662. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rod-In, W.; Monmai, C.; Shin, I.-S.; You, S.; Park, W.J. Neutral lipids, glycolipids, and phospholipids, isolated from Sandfish (Arctoscopus japonicus) eggs, exhibitanti-inflammatory activity in LPS-stimulated RAW264.7 cells through NF-κB and MAPKs pathways. Mar. Drugs 2020, 18, 480. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Al-Sayed Mahmoud, K.; Linder, M.; Fanni, J.; Parmentier, M. Characterisation of the lipid fractions obtained by proteolytic and chemical extractions from rainbow trout (Oncorhynchus mykiss) roe. Process Biochem. 2008, 43, 376–383. [Google Scholar] [CrossRef] [Scilit]
- Yanes-Roca, C.; Rhody, N.; Nystrom, M.; Main, K.L. Effects of fatty acid composition and spawning season patterns on egg quality and larval survival in common snook (Centropomus undecimalis). Aquaculture 2009, 287, 335–340. [Google Scholar] [CrossRef] [Scilit]
- Wang, Q.; Xue, C.; Li, Z.; Xu, J. Analysis of DHA-rich phospholipids from egg of squid Sthenoteuthis oualaniensis. J. Food Compos. Anal. 2008, 21, 356–359. [Google Scholar] [CrossRef] [Scilit]
- Shirai, N.; Higuchi, T.; Suzuki, H. Analysis of lipid classes and the fatty acid composition of the salted fish roe food products, Ikura, Tarako, Tobiko and Kazunoko. Food Chem. 2006, 94, 61–67. [Google Scholar] [CrossRef] [Scilit]
- Salze, G.; Tocher, D.R.; Roy, W.J.; Robertson, D.A. Egg quality determinants in cod (Gadus morhua L.): Egg performance and lipids in eggs from farmed and wild broodstock. Aquac. Res. 2005, 36, 1488–1499. [Google Scholar] [CrossRef] [Scilit]
- Ishigaki, M.; Nishii, T.; Puangchit, P.; Yasui, Y.; Huck, C.W.; Ozaki, Y. Noninvasive, high-speed, near-infrared imaging of the biomolecular distribution and molecular mechanism of embryonic development in fertilized fish eggs. J. Biophotonics 2018, 11, e201700115. [Google Scholar] [CrossRef] [Scilit]
- Smith, W.L. The eicosanoids and their biochemical mechanisms of action. Biochem. J. 1989, 259, 315–324. [Google Scholar] [CrossRef] [Scilit]
- Rod-In, W.; Monmai, C.; Lee, S.M.; Jung, S.K.; You, S.; Park, W.J. Anti-inflammatory effects of lipids extracted from Arctoscopus japonicus eggs on LPS-stimulated RAW264.7 cells. Mar. Drugs 2019, 17, 580. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Han, L.; Yu, J.; Chen, Y.; Cheng, D.; Wang, X.; Wang, C. Immunomodulatory activity of docosahexenoic acid on RAW264.7 cells activation through GPR120-mediated signaling pathway. J. Agric. Food Chem. 2018, 66, 926–934. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, J.K.; Park, J.Y.; Kim, Y.S. Genetic diversity, relationships and demographic history of three geographic populations of Ammodytes personatus (Ammodytidae) from Korea inferred from mitochondrial DNA control region and 16S rRNA sequence data. Korean J. Genetics 2006, 28, 343–351. [Google Scholar]
- Kim, J.K.; Park, J.H.; Kim, Y.S.; Kim, Y.H.; Hwang, H.J.; Hwang, S.J.; Lee, S.I.; Kim, T.I. Geographic variations in Pacific sand eels Ammodytes personatus (Ammodytidae) from Korea and Japan using multivariate morphometric analysis. J. Ichthyol. 2008, 48, 904–910. [Google Scholar] [CrossRef] [Scilit]
- Kishi, M.J.; Kimura, S.; Nakata, H.; Yamashita, Y. A biomass-based model for the sand lance (Ammodytes personatus) in Seto Inland Sea, Japan. Ecol. Modell. 1991, 54, 247–263. [Google Scholar] [CrossRef] [Scilit]
- Conn, K.E.; Liedtke, T.L.; Takesue, R.K.; Dinicola, R.S. Legacy and current-use toxic contaminants in Pacific sand lance (Ammodytes personatus) from Puget Sound, Washington, USA. Mar. Pollut. Bull. 2020, 158, 111287. [Google Scholar] [CrossRef] [Scilit]
- Li, N.; Song, N.; Gao, T. The complete mitochondrial genome of Japanese Ammodytes personatus (Perciformes, Ammodytidae). Mitochondrial DNA 2015, 26, 781–782. [Google Scholar] [CrossRef] [Scilit]
- Okumura, S.; Kurihara, A.; Iwamoto, A.; Takeuchi, T. Improved survival and growth in Octopus vulgaris paralarvae by feeding large type Artemia and Pacific sandeel, Ammodytes personatus: Improved survival and growth of common octopus paralarvae. Aquaculture 2005, 244, 147–157. [Google Scholar] [CrossRef] [Scilit]
- Kurihara, A.; Okumura, S.; Iwamoto, A.; Takeuchi, T. Feeding Pacific sandeel enhances DHA level in common octopus paralarvae. Aquac. Sci. 2006, 54, 413–420. [Google Scholar]
- Arai, D.; Kurihara, A.; Komi, R.; Iwamoto, A.; Takeuchi, T. Effect of feeding various amounts of Pacific sandeel flakes on growth, survival and carcass fatty acid composition of common octopus Octopus vulgaris paralarvae. Aquac. Sci. 2008, 56, 595–600. [Google Scholar]
- Lee, J.M.; Lee, H.; Kang, S.; Park, W.J. Fatty acid desaturases, polyunsaturated fatty acid regulation, and biotechnological advances. Nutrients 2016, 8, 23. [Google Scholar] [CrossRef] [Scilit]
- Seki, H.; Tani, Y.; Arita, M. Omega-3 PUFA derived anti-inflammatory lipid mediator resolvin E1. Prostaglandins Other Lipid Mediat. 2009, 89, 126–130. [Google Scholar] [CrossRef] [Scilit]
- Schwab, J.M.; Chiang, N.; Arita, M.; Serhan, C.N. Resolvin E1 and protectin D1 activate inflammation-resolution programmes. Nature 2007, 447, 869–874. [Google Scholar] [CrossRef] [Scilit]
- Medeiros-de-Moraes, I.M.; Gonçalves-de-Albuquerque, C.F.; Kurz, A.R.M.; Oliveira, F.M.J.; de Abreu, V.H.P.; Torres, R.C.; Carvalho, V.F.; Estato, V.; Bozza, P.T.; Sperandio, M.; et al. Omega-9 oleic acid, the main compound of olive oil, mitigates inflammation during experimental sepsis. Oxid. Med. Cell. Longev. 2018, 2018, 6053492. [Google Scholar] [CrossRef] [Scilit]
- Hennig, B.; Lei, W.; Arzuaga, X.; Ghosh, D.D.; Saraswathi, V.; Toborek, M. Linoleic acid induces proinflammatory events in vascular endothelial cells via activation of PI3K/Akt and ERK1/2 signaling. J. Nutr. Biochem. 2006, 17, 766–772. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huynh, M.D.; Kitts, D.D.; Hu, C.; Trites, A.W. Comparison of fatty acid profiles of spawning and non-spawning Pacific herring, Clupea harengus pallasi. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 2007, 146, 504–511. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sargent, J.R.; Tocher, D.R.; Bell, J.G. 4—The Lipids. In Fish Nutrition, 3rd ed.; Halver, J.E., Hardy, R.W., Eds.; Academic Press: San Diego, CA, USA, 2003; pp. 181–257. [Google Scholar]
- Narayanan, B.A.; Narayanan, N.K.; Simi, B.; Reddy, B.S. Modulation of inducible nitric oxide synthase and related proinflammatory genes by the omega-3 fatty acid docosahexaenoic acid in human colon cancer cells. Cancer Res. 2003, 63, 972–979. [Google Scholar]
- Yanagisawa, N.; Shimada, K.; Miyazaki, T.; Kume, A.; Kitamura, Y.; Sumiyoshi, K.; Kiyanagi, T.; Iesaki, T.; Inoue, N.; Daida, H. Enhanced production of nitric oxide, reactive oxygen species, and pro-inflammatory cytokines in very long chain saturated fatty acid-accumulated macrophages. Lipids Health Dis. 2008, 7, 48. [Google Scholar] [CrossRef] [Scilit]
- Aldridge, C.; Razzak, A.; Babcock, T.A.; Helton, W.S.; Espat, N.J. Lipopolysaccharide-stimulated RAW 264.7 macrophage inducible nitric oxide synthase and nitric oxide production is decreased by an omega-3 fatty acid lipid emulsion. J. Surg. Res. 2008, 149, 296–302. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Si, T.L.; Liu, Q.; Ren, Y.F.; Li, H.; Xu, X.Y.; Li, E.H.; Pan, S.Y.; Zhang, J.L.; Wang, K.X. Enhanced anti-inflammatory effects of DHA and quercetin in lipopolysaccharide-induced RAW264.7 macrophages by inhibiting NF-κB and MAPK activation. Mol. Med. Rep. 2016, 14, 499–508. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yi, H.; Yu, C.; Zhang, H.; Song, D.; Jiang, D.; Du, H.; Wang, Y. Cathelicidin-BF suppresses intestinal inflammation by inhibiting the nuclear factor-κB signaling pathway and enhancing the phagocytosis of immune cells via STAT-1 in weanling piglets. Int. Immunopharmacol. 2015, 28, 61–69. [Google Scholar] [CrossRef] [Scilit]
- Yu, Q.; Nie, S.P.; Li, W.J.; Zheng, W.Y.; Yin, P.F.; Gong, D.M.; Xie, M.Y. Macrophage immunomodulatory activity of a purified polysaccharide isolated from Ganoderma atrum. Phytother. Res. 2013, 27, 186–191. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, J.K.; Oh, S.m.; Kwon, H.S.; Oh, Y.S.; Lim, S.S.; Shin, H.K. Anti-inflammatory effect of roasted licorice extracts on lipopolysaccharide-induced inflammatory responses in murine macrophages. Biochem. Biophys. Res. Commun. 2006, 345, 1215–1223. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Park, Y.K.; Rasmussen, H.E.; Ehlers, S.J.; Blobaum, K.R.; Lu, F.; Schlegal, V.L.; Carr, T.P.; Lee, J.Y. Repression of proinflammatory gene expression by lipid extract of Nostoc commune var sphaeroides Kützing, a blue-green alga, via inhibition of nuclear factor-κB in RAW264.7 macrophages. Nutr. Res. 2008, 28, 83–91. [Google Scholar] [CrossRef] [Scilit]
- Li, M.; Zhang, L.; Cai, R.L.; Gao, Y.; Qi, Y. Lipid-soluble extracts from Salvia miltiorrhiza inhibit production of LPS-induced inflammatory mediators via NF-κB modulation in RAW264.7 cells and perform antiinflammatory effects in vivo. Phytother. Res. 2012, 26, 1195–1204. [Google Scholar] [CrossRef] [Scilit]
- Bligh, E.G.; Dyer, W.J. A rapid method of total lipid extraction and purification. Can. J. Biochem. Physiol. 1959, 37, 911–917. [Google Scholar] [CrossRef] [Scilit]
- Garces, R.; Mancha, M. One-step lipid extraction and fatty acid methyl esters preparation from fresh plant tissues. Anal. Biochem. 1993, 211, 139–143. [Google Scholar] [CrossRef] [Scilit]
- Park, W.J.; Kothapalli, K.S.; Lawrence, P.; Tyburczy, C.; Brenna, J.T. An alternate pathway to long-chain polyunsaturates: The FADS2 gene product Delta8-desaturates 20:2n-6 and 20:3n-3. J. Lipid Res. 2009, 50, 1195–1202. [Google Scholar] [CrossRef] [Scilit]
- Cao, R.-A.; Lee, Y.; You, S. Water soluble sulfated-fucans with immune-enhancing properties from Ecklonia cava. Int. J. Biol. Macromol. 2014, 67, 303–311. [Google Scholar] [CrossRef] [Scilit]
- Kim, J.B.; Han, A.R.; Park, E.Y.; Kim, J.Y.; Cho, W.; Lee, J.; Seo, E.K.; Lee, K.T. Inhibition of LPS-induced iNOS, COX-2 and cytokines expression by poncirin through the NF-kappaB inactivation in RAW264.7 macrophage cells. Biol. Pharm. Bull. 2007, 30, 2345–2351. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ren, Z.; Qin, T.; Qiu, F.; Song, Y.; Lin, D.; Ma, Y.; Li, J.; Huang, Y. Immunomodulatory effects of hydroxyethylated Hericium erinaceus polysaccharide on macrophages RAW264.7. Int. J. Biol. Macromol. 2017, 105, 879–885. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rhule, A.; Navarro, S.; Smith, J.R.; Shepherd, D.M. Panax notoginseng attenuates LPS-induced pro-inflammatory mediators in RAW264.7 cells. J. Ethnopharmacol. 2006, 106, 121–128. [Google Scholar] [CrossRef] [Scilit] [PubMed]






| Gene | Accession No. | Sequence (5′ → 3′) |
|---|---|---|
| iNOS | BC062378.1 | Forward: TTCCAGAATCCCTGGACAAG Reverse: TGGTCAAACTCTTGGGGTTC |
| IL-1β | NM_008361.4 | Forward: GGGCCTCAAAGGAAAGAATC Reverse: TACCAGTTGGGGAACTCTGC |
| IL-6 | NM_031168.2 | Forward: AGTTGCCTTCTTGGGACTGA Reverse: CAGAATTGCCATTGCACAAC |
| COX-2 | NM_011198.4 | Forward: AGAAGGAAATGGCTGCAGAA Reverse: GCTCGGCTTCCAGTATTGAG |
| TNF-α | D84199.2 | Forward: ATGAGCACAGAAAGCATGATC Reverse: TACAGGCTTGTCACTCGAATT |
| β-actin | NM_007393.5 | Forward: CCACAGCTGAGAGGGAAATC Reverse: AAGGAAGGCTGGAAAAGAGC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lim, J.H.; Choi, G.S.; Monmai, C.; Rod-in, W.; Jang, A.-y.; Park, W.J. Immunomodulatory Activities of Ammodytes personatus Egg Lipid in RAW264.7 Cells. Molecules 2021, 26, 6027. https://doi.org/10.3390/molecules26196027
Lim JH, Choi GS, Monmai C, Rod-in W, Jang A-y, Park WJ. Immunomodulatory Activities of Ammodytes personatus Egg Lipid in RAW264.7 Cells. Molecules. 2021; 26(19):6027. https://doi.org/10.3390/molecules26196027
Chicago/Turabian StyleLim, Jun Hyeok, Gyoung Su Choi, Chaiwat Monmai, Weerawan Rod-in, A-yeong Jang, and Woo Jung Park. 2021. "Immunomodulatory Activities of Ammodytes personatus Egg Lipid in RAW264.7 Cells" Molecules 26, no. 19: 6027. https://doi.org/10.3390/molecules26196027
APA StyleLim, J. H., Choi, G. S., Monmai, C., Rod-in, W., Jang, A.-y., & Park, W. J. (2021). Immunomodulatory Activities of Ammodytes personatus Egg Lipid in RAW264.7 Cells. Molecules, 26(19), 6027. https://doi.org/10.3390/molecules26196027

