Silybin Modulates Collagen Turnover in an In Vitro Model of NASH
Abstract
:1. Introduction
2. Results
2.1. Effects of Silybin on Viability and Cell Proliferation
2.2. Effect of Silybin on Hepatic Stellate Cells Activation and Collagen Biosynthesis
2.3. Silybin Regulation of Metalloproteinases Activity
2.4. Antioxidant Properties of Silybin
3. Discussion
4. Materials and Methods
4.1. Chemicals
4.2. Cellular In Vitro Model and Treatment
4.3. Cell Viability
4.4. RNA Extraction, cDNA Synthesis, and Gene Expression Analysis by q-PCR
4.5. Collagen Quantification
4.6. MMP2/9 Activity
4.7. Total Protein Quantification
4.8. Quantification of Intracellular Reactive Oxygen Species (ROS)
4.9. Statistical Analysis
Author Contributions
Funding
Conflicts of Interest
References
- NCD Risk Factor Collaboration (NCD-RisC). Trends in adult body-mass index in 200 countries from 1975 to 2014: a pooled analysis of 1698 population-based measurement studies with 19·2 million participants. Lancet Lond. Engl. 2016, 387, 1377–1396. [Google Scholar] [CrossRef] [Green Version]
- Younossi, Z.; Anstee, Q.M.; Marietti, M.; Hardy, T.; Henry, L.; Eslam, M.; George, J.; Bugianesi, E. Global burden of NAFLD and NASH: trends, predictions, risk factors and prevention. Nat. Rev. Gastroenterol. Hepatol. 2018, 15, 11. [Google Scholar] [CrossRef]
- Araújo, A.R.; Rosso, N.; Bedogni, G.; Tiribelli, C.; Bellentani, S. Global epidemiology of non-alcoholic fatty liver disease/non-alcoholic steatohepatitis: What we need in the future. Liver Int. Off. J. Int. Assoc. Study Liver 2018, 38, 47–51. [Google Scholar] [CrossRef] [PubMed]
- Buzzetti, E.; Pinzani, M.; Tsochatzis, E.A. The multiple-hit pathogenesis of non-alcoholic fatty liver disease (NAFLD). Metabolism 2016, 65, 1038–1048. [Google Scholar] [CrossRef] [Green Version]
- Angulo, P.; Kleiner, D.E.; Dam-Larsen, S.; Adams, L.A.; Bjornsson, E.S.; Charatcharoenwitthaya, P.; Mills, P.R.; Keach, J.C.; Lafferty, H.D.; Stahler, A.; et al. Liver Fibrosis, but No Other Histologic Features, Is Associated With Long-term Outcomes of Patients With Nonalcoholic Fatty Liver Disease. Gastroenterology 2015, 149, 389–397. [Google Scholar] [CrossRef]
- Friedman, S.L. Hepatic stellate cells: protean, multifunctional, and enigmatic cells of the liver. Physiol. Rev. 2008, 88, 125–172. [Google Scholar] [CrossRef] [PubMed]
- Tsukada, S.; Parsons, C.J.; Rippe, R.A. Mechanisms of liver fibrosis. Clin. Chim. Acta 2006, 364, 33–60. [Google Scholar] [CrossRef]
- Tsuchida, T.; Friedman, S.L. Mechanisms of hepatic stellate cell activation. Nat. Rev. Gastroenterol. Hepatol. 2017, 14, 397–411. [Google Scholar] [CrossRef] [PubMed]
- Hellerbrand, C.; Schattenberg, J.M.; Peterburs, P.; Lechner, A.; Brignoli, R. The potential of silymarin for the treatment of hepatic disorders. Clin. Phytoscience 2016, 2, 7. [Google Scholar] [CrossRef]
- Federico, A.; Dallio, M.; Loguercio, C. Silymarin/Silybin and Chronic Liver Disease: A Marriage of Many Years. Molecules 2017, 22, 191. [Google Scholar] [CrossRef]
- Kara, E.; Coşkun, T.; Kaya, Y.; Yumuş, O.; Vatansever, S.; Var, A. Effects of silymarin and pentoxifylline on matrix metalloproteinase-1 and -2 expression and apoptosis in experimental hepatic fibrosis. Curr. Ther. Res. Clin. Exp. 2008, 69, 488–502. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jia, J.D.; Bauer, M.; Cho, J.J.; Ruehl, M.; Milani, S.; Boigk, G.; Riecken, E.O.; Schuppan, D. Antifibrotic effect of silymarin in rat secondary biliary fibrosis is mediated by downregulation of procollagen alpha1(I) and TIMP-1. J. Hepatol. 2001, 35, 392–398. [Google Scholar] [CrossRef]
- Di Sario, A.; Bendia, E.; Taffetani, S.; Omenetti, A.; Candelaresi, C.; Marzioni, M.; De Minicis, S.; Benedetti, A. Hepatoprotective and antifibrotic effect of a new silybin-phosphatidylcholine-Vitamin E complex in rats. Dig. Liver Dis. Off. J. Ital. Soc. Gastroenterol. Ital. Assoc. Study Liver 2005, 37, 869–876. [Google Scholar]
- Marin, V.; Gazzin, S.; Gambaro, S.E.; Dal Ben, M.; Calligaris, S.; Anese, M.; Raseni, A.; Avellini, C.; Giraudi, P.J.; Tiribelli, C.; et al. Effects of Oral Administration of Silymarin in a Juvenile Murine Model of Non-alcoholic Steatohepatitis. Nutrients 2017, 9, 1006. [Google Scholar] [CrossRef] [PubMed]
- Ni, X.; Wang, H. Silymarin attenuated hepatic steatosis through regulation of lipid metabolism and oxidative stress in a mouse model of nonalcoholic fatty liver disease (NAFLD). Am. J. Transl. Res. 2016, 8, 1073–1081. [Google Scholar]
- Gu, M.; Zhao, P.; Huang, J.; Zhao, Y.; Wang, Y.; Li, Y.; Li, Y.; Fan, S.; Ma, Y.-M.; Tong, Q.; et al. Silymarin Ameliorates Metabolic Dysfunction Associated with Diet-Induced Obesity via Activation of Farnesyl X Receptor. Front. Pharmacol. 2016, 7, 345. [Google Scholar] [CrossRef]
- Hajiaghamohammadi, A.A.; Ziaee, A.; Oveisi, S.; Masroor, H. Effects of metformin, pioglitazone, and silymarin treatment on non-alcoholic Fatty liver disease: a randomized controlled pilot study. Hepat. Mon. 2012, 12, e6099. [Google Scholar] [CrossRef]
- Solhi, H.; Ghahremani, R.; Kazemifar, A.M.; Hoseini Yazdi, Z. Silymarin in treatment of non-alcoholic steatohepatitis: A randomized clinical trial. Casp. J. Intern. Med. 2014, 5, 9–12. [Google Scholar]
- Wah Kheong, C.; Nik Mustapha, N.R.; Mahadeva, S. A Randomized Trial of Silymarin for the Treatment of Nonalcoholic Steatohepatitis. Clin. Gastroenterol. Hepatol. Off. Clin. Pract. J. Am. Gastroenterol. Assoc. 2017, 15, 1940–1949. [Google Scholar] [CrossRef]
- Loguercio, C.; Andreone, P.; Brisc, C.; Brisc, M.C.; Bugianesi, E.; Chiaramonte, M.; Cursaro, C.; Danila, M.; de Sio, I.; Floreani, A.; et al. Silybin combined with phosphatidylcholine and vitamin E in patients with nonalcoholic fatty liver disease: a randomized controlled trial. Free Radic. Biol. Med. 2012, 52, 1658–1665. [Google Scholar] [CrossRef] [PubMed]
- Abenavoli, L.; Greco, M.; Nazionale, I.; Peta, V.; Milic, N.; Accattato, F.; Foti, D.; Gulletta, E.; Luzza, F. Effects of Mediterranean diet supplemented with silybin-vitamin E-phospholipid complex in overweight patients with non-alcoholic fatty liver disease. Expert Rev. Gastroenterol. Hepatol. 2015, 9, 519–527. [Google Scholar] [CrossRef]
- Zhong, S.; Fan, Y.; Yan, Q.; Fan, X.; Wu, B.; Han, Y.; Zhang, Y.; Chen, Y.; Zhang, H.; Niu, J. The therapeutic effect of silymarin in the treatment of nonalcoholic fatty disease: A meta-analysis (PRISMA) of randomized control trials. Medicine 2017, 96, e9061. [Google Scholar] [CrossRef]
- Giraudi, P.J.; Becerra, V.J.B.; Marin, V.; Chavez-Tapia, N.C.; Tiribelli, C.; Rosso, N. The importance of the interaction between hepatocyte and hepatic stellate cells in fibrogenesis induced by fatty accumulation. Exp. Mol. Pathol. 2015, 98, 85–92. [Google Scholar] [CrossRef]
- Iredale, J.P.; Pellicoro, A.; Fallowfield, J.A. Liver Fibrosis: Understanding the Dynamics of Bidirectional Wound Repair to Inform the Design of Markers and Therapies. Dig. Dis. 2017, 35, 310–313. [Google Scholar] [CrossRef]
- Trappoliere, M.; Caligiuri, A.; Schmid, M.; Bertolani, C.; Failli, P.; Vizzutti, F.; Novo, E.; di Manzano, C.; Marra, F.; Loguercio, C.; et al. Silybin, a component of sylimarin, exerts anti-inflammatory and anti-fibrogenic effects on human hepatic stellate cells. J. Hepatol. 2009, 50, 1102–1111. [Google Scholar] [CrossRef] [PubMed]
- Hosseini, S.Y.; Kalantar, K.; Shahin, K.; Ghayour, M.; Bazl, M.R.; Fattahi, M.-R.; Moini, M.; Amirghofran, Z. Comparison of the In Vitro Antifibrogenic Effects of Silymarin, Silybin A and 18α-Glycyrrhizin on Activated Hepatic Stellate Cells. Jundishapur J. Nat. Pharm. Prod. 2016, 12, e40285. [Google Scholar] [CrossRef]
- Ezhilarasan, D.; Evraerts, J.; Sid, B.; Calderon, P.B.; Karthikeyan, S.; Sokal, E.; Najimi, M. Silibinin induces hepatic stellate cell cycle arrest via enhancing p53/p27 and inhibiting Akt downstream signaling protein expression. Hepatobiliary Pancreat. Dis. Int. HBPD INT 2017, 16, 80–87. [Google Scholar] [CrossRef]
- Zbodakova, O.; Chalupsky, K.; Tureckova, J.; Sedlacek, R. Metalloproteinases in liver fibrosis: current insights. Metalloproteinases Med. 2017, 4, 25–35. [Google Scholar] [CrossRef]
- Naim, A.; Pan, Q.; Baig, M.S. Matrix Metalloproteinases (MMPs) in Liver Diseases. J. Clin. Exp. Hepatol. 2017, 7, 367–372. [Google Scholar] [CrossRef]
- Rosso, N.; Marin, V.; Giordani, A.; Persiani, S.; Sala, F.; Cavicchioli, L.; Rovati, L.C.; Tiribelli, C. The Pros and the Cons for the Use of Silybin-Rich Oral Formulations in Treatment of Liver Damage (NAFLD in Particular). Curr. Med. Chem. 2015, 22, 2954–2971. [Google Scholar] [CrossRef]
- Barbero-Becerra, V.J.; Giraudi, P.J.; Chávez-Tapia, N.C.; Uribe, M.; Tiribelli, C.; Rosso, N. The interplay between hepatic stellate cells and hepatocytes in an in vitro model of NASH. Toxicol. Vitro Int. J. Publ. Assoc. BIBRA 2015, 29, 1753–1758. [Google Scholar] [CrossRef] [PubMed]
Sample Availability: Samples of the compounds are not available from the authors. |
Condition | LX2 Monoculture | Huh7 Monoculture | SCC (Huh7:LX2 – 5:1) |
---|---|---|---|
Control | vehicle | vehicle | vehicle |
FFA | 1200 µM | 1200 µM | 1200 µM |
Silybin | 5–7.5 µM | 5–7.5 µM | 5–7.5 µM |
FFA + Silybin | 1200 µM + (5–7.5) µM | 1200 µM + (5–7.5) µM | 1200 µM + (5–7.5) µM |
Gene Name | Accession Number | Forward | Reverse |
---|---|---|---|
ACTA2 (α-SMA) | NM_001141945 | TGTGAATGTCCTGTGGAATTATGC | ACACATAGGTAACGAGTCAGAGC |
COL1A1 | NM_000088 | CGGAGGAGAGTCAGGAAG | ACACAAGGAACAGAACAGTC |
18S | NR_003286.2 | TAACCCGTTGAACCCCATT | CCATCCAATCGGTAGTAGCG |
HPRT | NM_000194 | ACATCTGGAGTCCTATTGACATCG | CCGCCCAAAGGGAACTGATAG |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Anfuso, B.; Giraudi, P.J.; Tiribelli, C.; Rosso, N. Silybin Modulates Collagen Turnover in an In Vitro Model of NASH. Molecules 2019, 24, 1280. https://doi.org/10.3390/molecules24071280
Anfuso B, Giraudi PJ, Tiribelli C, Rosso N. Silybin Modulates Collagen Turnover in an In Vitro Model of NASH. Molecules. 2019; 24(7):1280. https://doi.org/10.3390/molecules24071280
Chicago/Turabian StyleAnfuso, Beatrice, Pablo J. Giraudi, Claudio Tiribelli, and Natalia Rosso. 2019. "Silybin Modulates Collagen Turnover in an In Vitro Model of NASH" Molecules 24, no. 7: 1280. https://doi.org/10.3390/molecules24071280
APA StyleAnfuso, B., Giraudi, P. J., Tiribelli, C., & Rosso, N. (2019). Silybin Modulates Collagen Turnover in an In Vitro Model of NASH. Molecules, 24(7), 1280. https://doi.org/10.3390/molecules24071280