Combination Effect of Silver Nanoparticles and Histone Deacetylases Inhibitor in Human Alveolar Basal Epithelial Cells
Abstract
1. Introduction
2. Results and Discussion
2.1. Synthesis and Characterization of Silver Nanoparticles Using Wogonin
2.2. Size-Dependent Toxic Effect of AgNPs on Cell Viability of A549 Cells
2.3. Effect of Acetamide and MS-275 on Cell Viability of A549 Cells
2.4. Combination Effect of AgNPs and MS-275 on Cell Survival
2.5. AgNPs and MS-275 Enhances Cytotoxicity
2.6. Effect of AgNPs and MS-275 on Oxidative and Anti-Oxidative Stress Markers
2.7. Effects of AgNPs and MS-275 on Cell Structure
2.8. AgNPs and MS-275 Cause Mitochondrial Sysfunction in A549 Cells
2.9. AgNPs and MS-275 Activate Caspase 9 and 3 in A549 Cells
2.10. Effect of AgNPs and MS-275 on Expression of Pro- and Anti-apoptotic Genes in A549 Cells
2.11. AgNPs and MS-275 Cause Apoptosis in A549 Cells
3. Materials and Methods
3.1. Materials
3.2. Synthesis and Characterization of AgNPs
3.3. Cell Viability Assays
3.4. Cell Proliferation Assay
3.5. Cell Morphology
3.6. Determination of Reactive Oxygen Species (ROS)
3.7. Membrane Integrity
3.8. Measurement of TNF α
3.9. Assessment of Dead-Cell Protease Activity
3.10. Measurement of ATP
3.11. Determination of MDA, NO, GSH, and GSSG
3.12. Measurement of Mitochondrial Dysfunction
3.13. Transmission Electron Microscopy
3.14. Quantitative RT-PCR Analysis
3.15. Measurement of Caspase 9/3 Activity
3.16. TUNEL Analysis
3.17. Statistical Analysis
4. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Torre, L.A.; Bray, F.; Siegel, R.L.; Ferlay, J.; Lortet-Tieulent, J.; Jemal, A. Global cancer statistics. 2012. CA Cancer J. Clin. 2015, 65, 87–108. [Google Scholar] [CrossRef] [PubMed]
- Islami, F.; Torre, L.A.; Jemal, A. Global trends of lung cancer mortality and smoking prevalence. Transl. Lung Cancer Res. 2015, 4, 327–338. [Google Scholar] [PubMed]
- Khan, F.; Khan, A.; Kazmi, S.U. Prevalence and Susceptibility Pattern of Multi Drug Resistant Clinical Isolates of Pseudomonas aeruginosa in Karachi. Pak. J. Med. Sci. 2014, 30, 951–954. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.H.; Nan, A. Combination drug delivery approaches in metastatic breast cancer. J. Drug Deliv. 2012, 2012, 915375. [Google Scholar] [CrossRef] [PubMed]
- Choi, Y.J.; Park, J.H.; Han, J.W.; Kim, E.; Jae-Wook, O.; Lee, S.Y.; Kim, J.H.; Gurunathan, S. Differential Cytotoxic Potential of Silver Nanoparticles in Human Ovarian Cancer Cells and Ovarian Cancer Stem Cells. Int. J. Mol. Sci. 2016, 17, 2077. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.F.; Gurunathan, S. Combination of salinomycin and silver nanoparticles enhances apoptosis and autophagy in human ovarian cancer cells: An effective anticancer therapy. Int. J. Nanomed. 2016, 11, 3655–3675. [Google Scholar]
- Yuan, Y.G.; Peng, Q.L.; Gurunathan, S. Silver nanoparticles enhance the apoptotic potential of gemcitabine in human ovarian cancer cells: Combination therapy for effective cancer treatment. Int. J. Nanomed. 2017, 12, 6487–6502. [Google Scholar] [CrossRef] [PubMed]
- Thapa, R.K.; Nguyen, H.T.; Gautam, M.; Shrestha, A.; Lee, E.S.; Ku, S.K.; Choi, H.G.; Yong, C.S.; Kim, J.O. Hydrophobic binding peptide-conjugated hybrid lipid-mesoporous silica nanoparticles for effective chemo-photothermal therapy of pancreatic cancer. Drug Deliv. 2017, 24, 1690–1702. [Google Scholar] [CrossRef] [PubMed]
- Fan, J.; Fang, G.; Zeng, F.; Wang, X.; Wu, S. Water-dispersible fullerene aggregates as a targeted anticancer prodrug with both chemo- and photodynamic therapeutic actions. Small 2013, 9, 613–621. [Google Scholar] [CrossRef] [PubMed]
- Ropero, S.; Esteller, M. The role of histone deacetylases (HDACs) in human cancer. Mol. Oncol. 2007, 1, 19–25. [Google Scholar] [CrossRef] [PubMed]
- Walkinshaw, D.R.; Yang, X.J. Histone deacetylase inhibitors as novel anticancer therapeutics. Curr. Oncol. 2008, 15, 237–243. [Google Scholar] [PubMed]
- Wang, H.; Zhou, W.; Zheng, Z.; Zhang, P.; Tu, B.; He, Q.; Zhu, W.G. The HDAC inhibitor depsipeptide transactivates the p53/p21 pathway by inducing DNA damage. DNA Repair 2012, 11, 146–156. [Google Scholar] [CrossRef] [PubMed]
- Kelly, W.K.; Marks, P.A. Drug insight: Histone deacetylase inhibitors—development of the new targeted anticancer agent suberoylanilide hydroxamic acid. Nat. Clin. Pract. Oncol. 2005, 2, 150–157. [Google Scholar] [CrossRef] [PubMed]
- Drummond, D.C.; Noble, C.O.; Kirpotin, D.B.; Guo, Z.; Scott, G.K.; Benz, C.C. Clinical development of histone deacetylase inhibitors as anticancer agents. Annu. Rev. pharmacol. 2005, 45, 495–528. [Google Scholar] [CrossRef] [PubMed]
- Lin, H.Y.; Chen, C.S.; Lin, S.P.; Weng, J.R.; Chen, C.S. Targeting histone deacetylase in cancer therapy. Med. Res. Rev. 2006, 26, 397–413. [Google Scholar] [CrossRef] [PubMed]
- Jaboin, J.; Wild, J.; Hamidi, H.; Khanna, C.; Kim, C.J.; Robey, R.; Bates, S.E.; Thiele, C.J. MS-27-275, an inhibitor of histone deacetylase, has marked in vitro and in vivo antitumor activity against pediatric solid tumors. Cancer Res. 2002, 62, 6108–6115. [Google Scholar] [PubMed]
- Kato, Y.; Yoshimura, K.; Shin, T.; Verheul, H.; Hammers, H.; Sanni, T.B.; Salumbides, B.C.; Van Erp, K.; Schulick, R.; Pili, R. Synergistic in vivo antitumor effect of the histone deacetylase inhibitor MS-275 in combination with interleukin 2 in a murine model of renal cell carcinoma. Clin. Cancer Res. 2007, 13, 4538–4546. [Google Scholar] [CrossRef] [PubMed]
- Srivastava, R.K.; Kurzrock, R.; Shankar, S. MS-275 sensitizes TRAIL-resistant breast cancer cells, inhibits angiogenesis and metastasis, and reverses epithelial-mesenchymal transition in vivo. Mol. Cancer Ther. 2010, 9, 3254–3266. [Google Scholar] [CrossRef] [PubMed]
- Thurn, K.T.; Thomas, S.; Moore, A.; Munster, P.N. Rational therapeutic combinations with histone deacetylase inhibitors for the treatment of cancer. Future Oncol. 2011, 7, 263–283. [Google Scholar] [CrossRef] [PubMed]
- Frumm, S.M.; Fan, Z.P.; Ross, K.N.; Duvall, J.R.; Gupta, S.; VerPlank, L.; Suh, B.C.; Holson, E.; Wagner, F.F.; Smith, W.B.; et al. Selective HDAC1/HDAC2 inhibitors induce neuroblastoma differentiation. Chem. Biol. 2013, 20, 713–725. [Google Scholar] [CrossRef] [PubMed]
- Groh, T.; Hrabeta, J.; Khalil, M.A.; Doktorova, H.; Eckschlager, T.; Stiborova, M. The synergistic effects of DNA-damaging drugs cisplatin and etoposide with a histone deacetylase inhibitor valproate in high-risk neuroblastoma cells. Int. J. Oncol. 2015, 47, 343–352. [Google Scholar] [CrossRef] [PubMed]
- Yar Saglam, A.S.; Yilmaz, A.; Onen, H.I.; Alp, E.; Kayhan, H.; Ekmekci, A. HDAC inhibitors, MS-275 and salermide, potentiates the anticancer effect of EF24 in human pancreatic cancer cells. EXCLI J. 2016, 15, 246–255. [Google Scholar] [PubMed]
- Bernardo, G.D.; Squillaro, T.; Dell’Aversana, C.; Miceli, M.; Cipollaro, M.; Cascino, A.; Altucci, L.; Galderisi, U. Histone Deacetylase Inhibitors Promote Apoptosis and Senescence in Human Mesenchymal Stem Cells. Stem. Cells Dev. 2009, 18, 573–582. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.F.; Liu, Z.G.; Shen, W.; Gurunathan, S. Silver Nanoparticles: Synthesis, Characterization, Properties, Applications, and Therapeutic Approaches. Int. J. Mol. Sci. 2016, 17, 1534. [Google Scholar] [CrossRef] [PubMed]
- Sriram, M.I.; Kanth, S.B.; Kalishwaralal, K.; Gurunathan, S. Antitumor activity of silver nanoparticles in Dalton’s lymphoma ascites tumor model. Int. J. Nanomed. 2010, 5, 753–762. [Google Scholar] [PubMed]
- Gurunathan, S.; Kalishwaralal, K.; Vaidyanathan, R.; Venkataraman, D.; Pandian, S.R.; Muniyandi, J.; Hariharan, N.; Eom, S.H. Biosynthesis, purification and characterization of silver nanoparticles using Escherichia coli. Colloids Surf. B Biointerfaces 2009, 74, 328–335. [Google Scholar] [CrossRef] [PubMed]
- Gurunathan, S.; Han, J.W.; Eppakayala, V.; Jeyaraj, M.; Kim, J.H. Cytotoxicity of biologically synthesized silver nanoparticles in MDA-MB-231 human breast cancer cells. Biomed. Res. Int. 2013, 2013, 535796. [Google Scholar] [CrossRef] [PubMed]
- Hsin, Y.H.; Chen, C.F.; Huang, S.; Shih, T.S.; Lai, P.S.; Chueh, P.J. The apoptotic effect of nanosilver is mediated by a ROS- and JNK-dependent mechanism involving the mitochondrial pathway in NIH3T3 cells. Toxicol. Lett. 2008, 179, 130–139. [Google Scholar] [CrossRef] [PubMed]
- Jeong, J.K.; Gurunathan, S.; Kang, M.H.; Han, J.W.; Das, J.; Choi, Y.J.; Kwon, D.N.; Cho, S.G.; Park, C.; Seo, H.G.; et al. Hypoxia-mediated autophagic flux inhibits silver nanoparticle-triggered apoptosis in human lung cancer cells. Sci. Rep. 2016, 6, 21688. [Google Scholar] [CrossRef] [PubMed]
- Gurunathan, S.; Jeong, J.K.; Han, J.W.; Zhang, X.F.; Park, J.H.; Kim, J.H. Multidimensional effects of biologically synthesized silver nanoparticles in Helicobacter pylori, Helicobacter felis, and human lung (L132) and lung carcinoma A549 cells. Nanoscale Res. Lett. 2015, 10, 35. [Google Scholar] [CrossRef] [PubMed]
- Gurunathan, S.; Park, J.H.; Han, J.W.; Kim, J.H. Comparative assessment of the apoptotic potential of silver nanoparticles synthesized by Bacillus tequilensis and Calocybe indica in MDA-MB-231 human breast cancer cells: Targeting p53 for anticancer therapy. Int. J. Nanomed. 2015, 10, 4203–4222. [Google Scholar] [CrossRef] [PubMed]
- Matai, I.; Sachdev, A.; Gopinath, P. Multicomponent 5-fluorouracil loaded PAMAM stabilized-silver nanocomposites synergistically induce apoptosis in human cancer cells. Biomater. Sci. 2015, 3, 457–468. [Google Scholar] [CrossRef] [PubMed]
- Hekmat, A.; Saboury, A.A.; Divsalar, A. The effects of silver nanoparticles and doxorubicin combination on DNA structure and its antiproliferative effect against T47D and MCF7 cell lines. J. Biomed. Nanotechnol. 2012, 8, 968–982. [Google Scholar] [CrossRef] [PubMed]
- Yuan, Y.G.; Peng, Q.L.; Gurunathan, S. Effects of Silver Nanoparticles on Multiple Drug-Resistant Strains of Staphylococcus aureus and Pseudomonas aeruginosa from Mastitis-Infected Goats: An Alternative Approach for Antimicrobial Therapy. Int. J. Mol. Sci. 2017, 18, 569. [Google Scholar] [CrossRef] [PubMed]
- Hussain, S.M.; Hess, K.L.; Gearhart, J.M.; Geiss, K.T.; Schlager, J.J. In vitro toxicity of nanoparticles in BRL 3A rat liver cells. Toxicol. In Vitro 2005, 19, 975–983. [Google Scholar] [CrossRef] [PubMed]
- Bar-Ilan, O.; Albrecht, R.M.; Fako, V.E.; Furgeson, D.Y. Toxicity assessments of multisized gold and silver nanoparticles in zebrafish embryos. Small 2009, 5, 1897–1910. [Google Scholar] [CrossRef] [PubMed]
- Kalimuthu, K.; Suresh Babu, R.; Venkataraman, D.; Bilal, M.; Gurunathan, S. Biosynthesis of silver nanocrystals by Bacillus licheniformis. Colloids Surf. B Biointerfaces 2008, 65, 150–153. [Google Scholar] [CrossRef] [PubMed]
- Deepak, V.; Umamaheshwaran, P.S.; Guhan, K.; Nanthini, R.A.; Krithiga, B.; Jaithoon, N.M.; Gurunathan, S. Synthesis of gold and silver nanoparticles using purified URAK. Colloids Surf. B Biointerfaces 2011, 86, 353–358. [Google Scholar] [CrossRef] [PubMed]
- Gurunathan, S.; Han, J.W.; Kwon, D.N.; Kim, J.H. Enhanced antibacterial and anti-biofilm activities of silver nanoparticles against Gram-negative and Gram-positive bacteria. Nanoscale Res. Lett. 2014, 9, 373. [Google Scholar] [CrossRef] [PubMed]
- Hui, K.M.; Huen, M.S.; Wang, H.Y.; Zheng, H.; Sigel, E.; Baur, R.; Ren, H.; Li, Z.W.; Wong, J.T.; Xue, H. Anxiolytic effect of wogonin, a benzodiazepine receptor ligand isolated from Scutellaria baicalensis Georgi. Biochem. Pharmacol. 2002, 64, 1415–1424. [Google Scholar] [CrossRef]
- Bhattacharjee, S. DLS and zeta potential—What they are and what they are not? J. Control. Release 2016, 235, 337–351. [Google Scholar] [CrossRef] [PubMed]
- Jiang, H.; Wang, C.; Guo, Z.; Wang, Z.; Liu, L. Silver nanocrystals mediated combination therapy of radiation with magnetic hyperthermia on glioma cells. J. Nanosci. Nanotechnol. 2012, 12, 8276–8281. [Google Scholar] [CrossRef] [PubMed]
- Park, M.V.; Neigh, A.M.; Vermeulen, J.P.; de la Fonteyne, L.J.; Verharen, H.W.; Briede, J.J.; van Loveren, H.; de Jong, W.H. The effect of particle size on the cytotoxicity, inflammation, developmental toxicity and genotoxicity of silver nanoparticles. Biomaterials 2011, 32, 9810–9817. [Google Scholar] [CrossRef] [PubMed]
- Lu, J.; Liong, M.; Li, Z.; Zink, J.I.; Tamanoi, F. Biocompatibility, biodistribution, and drug-delivery efficiency of mesoporous silica nanoparticles for cancer therapy in animals. Small 2010, 6, 1794–1805. [Google Scholar] [CrossRef] [PubMed]
- He, Q.; Shi, J. Mesoporous silica nanoparticle based nano drug delivery systems: Synthesis, controlled drug release and delivery, pharmacokinetics and biocompatibility. J. Mater. Chem. 2011, 21, 5845–5855. [Google Scholar] [CrossRef]
- Bayat Mokhtari, R.; Baluch, N.; Ka Hon Tsui, M.; Kumar, S.; Homayouni, T.S.; Aitken, K.; Das, B.; Baruchel, S.; Yeger, H. Acetazolamide potentiates the anti-tumor potential of HDACi, MS-275, in neuroblastoma. BMC Cancer 2017, 17, 156. [Google Scholar] [CrossRef] [PubMed]
- Han, J.W.; Jeong, J.K.; Gurunathan, S.; Choi, Y.J.; Das, J.; Kwon, D.N.; Cho, S.G.; Park, C.; Seo, H.G.; Park, J.K.; et al. Male- and female-derived somatic and germ cell-specific toxicity of silver nanoparticles in mouse. Nanotoxicology 2016, 10, 361–373. [Google Scholar] [CrossRef] [PubMed]
- Mackmull, M.T.; Iskar, M.; Parca, L.; Singer, S.; Bork, P.; Ori, A.; Beck, M. Histone Deacetylase Inhibitors (HDACi) Cause the Selective Depletion of Bromodomain Containing Proteins (BCPs). Mol. Cell. Proteom. 2015, 14, 1350–1360. [Google Scholar] [CrossRef] [PubMed]
- Nel, A.; Xia, T.; Madler, L.; Li, N. Toxic potential of materials at the nanolevel. Science 2006, 311, 622–627. [Google Scholar] [CrossRef] [PubMed]
- Cornago, M.; Garcia-Alberich, C.; Blasco-Angulo, N.; Vall-Llaura, N.; Nager, M.; Herreros, J.; Comella, J.X.; Sanchis, D.; Llovera, M. Histone deacetylase inhibitors promote glioma cell death by G2 checkpoint abrogation leading to mitotic catastrophe. Cell Death Dis. 2014, 5, e1435. [Google Scholar] [CrossRef] [PubMed]
- Jacobson, M.D.; Raff, M.C. Programmed cell death and Bcl-2 protection in very low oxygen. Nature 1995, 374, 814. [Google Scholar] [CrossRef] [PubMed]
- Shimizu, S.; Eguchi, Y.; Kosaka, H.; Kamiike, W.; Matsuda, H.; Tsujimoto, Y. Prevention of hypoxia-induced cell death by Bcl-2 and Bcl-xL. Nature 1995, 374, 811–813. [Google Scholar] [CrossRef] [PubMed]
- Ko, C.H.; Shen, S.-C.; Hsu, C.-S.; Chen, Y.-C. Mitochondrial-dependent, reactive oxygen species-independent apoptosis by myricetin: Roles of protein kinase C, cytochrome c, and caspase cascade. Biochem. Pharmacol. 2005, 69, 913–927. [Google Scholar] [CrossRef] [PubMed]
- Baradari, V.; Huether, A.; Hopfner, M.; Schuppan, D.; Scherubl, H. Antiproliferative and proapoptotic effects of histone deacetylase inhibitors on gastrointestinal neuroendocrine tumor cells. Endocr. Relat. Cancer 2006, 13, 1237–1250. [Google Scholar] [CrossRef] [PubMed]
- Lohman, R.J.; Iyer, A.; Fairlie, T.J.; Cotterell, A.; Gupta, P.; Reid, R.C.; Vesey, D.A.; Sweet, M.J.; Fairlie, D.P. Differential Anti-inflammatory Activity of HDAC Inhibitors in Human Macrophages and Rat Arthritis. J. Pharmacol. Exp. Ther. 2016, 356, 387–396. [Google Scholar] [CrossRef] [PubMed]
- Satyavani, K.; Gurudeeban, S.; Ramanathan, T.; Balasubramanian, T. Toxicity Study of Silver Nanoparticles Synthesized from Suaeda monoica on Hep-2 Cell Line. Avicenna J. Med. Biotechnol. 2012, 4, 35–39. [Google Scholar] [PubMed]
- Gliga, A.R.; Skoglund, S.; Wallinder, I.O.; Fadeel, B.; Karlsson, H.L. Size-dependent cytotoxicity of silver nanoparticles in human lung cells: the role of cellular uptake, agglomeration and Ag release. Part. Fibre Toxicol. 2014, 11, 11. [Google Scholar] [CrossRef] [PubMed]
- Park, E.J.; Yi, J.; Kim, Y.; Choi, K.; Park, K. Silver nanoparticles induce cytotoxicity by a Trojan-horse type mechanism. Toxicol. In Vitro 2010, 24, 872–878. [Google Scholar] [CrossRef] [PubMed]
- Jayaraman, T.; Paget, A.; Shin, Y.S.; Li, X.; Mayer, J.; Chaudhry, H.; Niimi, Y.; Silane, M.; Berenstein, A. TNF-alpha-mediated inflammation in cerebral aneurysms: A potential link to growth and rupture. Vasc. Health Risk Manag. 2008, 4, 805–817. [Google Scholar] [CrossRef] [PubMed]
- Carlson, C.; Hussain, S.M.; Schrand, A.M.; Braydich-Stolle, L.K.; Hess, K.L.; Jones, R.L.; Schlager, J.J. Unique cellular interaction of silver nanoparticles: Size-dependent generation of reactive oxygen species. J. Phys. Chem. B 2008, 112, 13608–13619. [Google Scholar] [CrossRef] [PubMed]
- Adams, J.M. Ways of dying: Multiple pathways to apoptosis. Genes Dev. 2003, 17, 2481–2495. [Google Scholar] [CrossRef] [PubMed]
- Thannickal, V.J.; Fanburg, B.L. Reactive oxygen species in cell signaling. Am. J. Physiol Lung Cell. Mol. Physiol. 2000, 279, L1005–L1028. [Google Scholar] [CrossRef] [PubMed]
- Park, E.J.; Yoon, J.; Choi, K.; Yi, J.; Park, K. Induction of chronic inflammation in mice treated with titanium dioxide nanoparticles by intratracheal instillation. Toxicology 2009, 260, 37–46. [Google Scholar] [CrossRef] [PubMed]
- Park, E.J.; Yi, J.; Chung, K.H.; Ryu, D.Y.; Choi, J.; Park, K. Oxidative stress and apoptosis induced by titanium dioxide nanoparticles in cultured BEAS-2B cells. Toxicol. Lett. 2008, 180, 222–229. [Google Scholar] [CrossRef] [PubMed]
- Park, E.J.; Park, K. Oxidative stress and pro-inflammatory responses induced by silica nanoparticles in vivo and in vitro. Toxicol. Lett. 2009, 184, 18–25. [Google Scholar] [CrossRef] [PubMed]
- Maurer-Jones, M.A.; Lin, Y.S.; Haynes, C.L. Functional assessment of metal oxide nanoparticle toxicity in immune cells. ACS Nano 2010, 4, 3363–3373. [Google Scholar] [CrossRef] [PubMed]
- Valko, M.; Rhodes, C.J.; Moncol, J.; Izakovic, M.; Mazur, M. Free radicals, metals and antioxidants in oxidative stress-induced cancer. Chem. Biol. Interact. 2006, 160, 1–40. [Google Scholar] [CrossRef] [PubMed]
- Marrocco, I.; Altieri, F.; Peluso, I. Measurement and Clinical Significance of Biomarkers of Oxidative Stress in Humans. Oxid. Med. Cell. Longev. 2017, 2017, 6501046. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Y.T.; He, W.; Lo, Y.M.; Hu, X.; Wu, X.; Yin, J.J. Effect of silver nanomaterials on the activity of thiol-containing antioxidants. J. Agric. Food Chem. 2013, 61, 7855–7862. [Google Scholar] [CrossRef] [PubMed]
- Hall, A.G. The role of glutathione in the regulation of apoptosis. Eur. J. Clin. Investig. 1999, 29, 238–245. [Google Scholar] [CrossRef]
- Govender, R.; Phulukdaree, A.; Gengan, R.M.; Anand, K.; Chuturgoon, A.A. Silver nanoparticles of Albizia adianthifolia: The induction of apoptosis in human lung carcinoma cell line. J. Nanobiotechnol. 2013, 11, 5. [Google Scholar] [CrossRef] [PubMed]
- Navarro, E.; Piccapietra, F.; Wagner, B.; Marconi, F.; Kaegi, R.; Odzak, N.; Sigg, L.; Behra, R. Toxicity of silver nanoparticles to Chlamydomonas reinhardtii. Environ. Sci. Technol. 2008, 42, 8959–8964. [Google Scholar] [CrossRef] [PubMed]
- Foldbjerg, R.; Olesen, P.; Hougaard, M.; Dang, D.A.; Hoffmann, H.J.; Autrup, H. PVP-coated silver nanoparticles and silver ions induce reactive oxygen species, apoptosis and necrosis in THP-1 monocytes. Toxicol. Lett. 2009, 190, 156–162. [Google Scholar] [CrossRef] [PubMed]
- Sasada, T.; Nakamura, H.; Masutani, H.; Ueda, S.; Sono, H.; Takabayashi, A.; Yodoi, J. Thioredoxin-mediated redox control of human T cell lymphotropic virus type I (HTLV-I) gene expression. Mol. Immun. 2002, 38, 723–732. [Google Scholar] [CrossRef]
- Button, R.W.; Luo, S. The formation of autophagosomes during lysosomal defect: A new source of cytotoxicity. Autophagy 2017, 13, 1797–1798. [Google Scholar] [CrossRef] [PubMed]
- Pan, T.; Kondo, S.; Le, W.; Jankovic, J. The role of autophagy-lysosome pathway in neurodegeneration associated with Parkinson’s disease. Brain 2008, 131, 1969–1978. [Google Scholar] [CrossRef] [PubMed]
- Park, J.H.; Gurunathan, S.; Choi, Y.-J.; Han, J.W.; Song, H.; Kim, J.-H. Silver nanoparticles suppresses brain-derived neurotrophic factor-induced cell survival in the human neuroblastoma cell line SH-SY5Y. J. Ind. Eng. Chem. 2017, 47, 62–73. [Google Scholar] [CrossRef]
- Park, J.K.; Sultana, T.; Lee, S.H.; Kang, S.; Kim, H.K.; Min, G.S.; Eom, K.S.; Nadler, S.A. Monophyly of clade III nematodes is not supported by phylogenetic analysis of complete mitochondrial genome sequences. BMC Genom. 2011, 12, 392. [Google Scholar] [CrossRef] [PubMed]
- Sitarz, K.S.; Elliott, H.R.; Karaman, B.S.; Relton, C.; Chinnery, P.F.; Horvath, R. Valproic acid triggers increased mitochondrial biogenesis in POLG-deficient fibroblasts. Mol. Genet. Metab. 2014, 112, 57–63. [Google Scholar] [CrossRef] [PubMed]
- McMahon, S.J.; Paganetti, H.; Prise, K.M. Optimising element choice for nanoparticle radiosensitisers. Nanoscale 2016, 8, 581–589. [Google Scholar] [CrossRef] [PubMed]
- Chairuangkitti, P.; Lawanprasert, S.; Roytrakul, S.; Aueviriyavit, S.; Phummiratch, D.; Kulthong, K.; Chanvorachote, P.; Maniratanachote, R. Silver nanoparticles induce toxicity in A549 cells via ROS-dependent and ROS-independent pathways. Toxicol. In Vitro 2013, 27, 330–338. [Google Scholar] [CrossRef] [PubMed]
- Bao, L.; Diao, H.; Dong, N.; Su, X.; Wang, B.; Mo, Q.; Yu, H.; Wang, X.; Chen, C. Histone deacetylase inhibitor induces cell apoptosis and cycle arrest in lung cancer cells via mitochondrial injury and p53 up-acetylation. Cell. Biol. Toxicol. 2016, 32, 469–482. [Google Scholar] [CrossRef] [PubMed]
- Martin, D.S.; Spriggs, D.; Koutcher, J.A. A concomitant ATP-depleting strategy markedly enhances anticancer agent activity. Apoptosis 2001, 6, 125–131. [Google Scholar] [CrossRef] [PubMed]
- AshaRani, P.V.; Low Kah Mun, G.; Hande, M.P.; Valiyaveettil, S. Cytotoxicity and genotoxicity of silver nanoparticles in human cells. ACS Nano 2009, 3, 279–290. [Google Scholar] [CrossRef] [PubMed]
- Mignotte, B.; Vayssiere, J.L. Mitochondria and apoptosis. Eur. J. Biochem. 1998, 252, 1–15. [Google Scholar] [CrossRef] [PubMed]
- Parrish, A.B.; Freel, C.D.; Kornbluth, S. Cellular mechanisms controlling caspase activation and function. Cold Spring Harb. Perspect. Biol. 2013, 5, 239–249. [Google Scholar] [CrossRef] [PubMed]
- Wang, C.; Youle, R.J. The Role of Mitochondria in Apoptosis (). Annu. Rev. Genet. 2009, 43, 95–118. [Google Scholar] [CrossRef] [PubMed]
- Dhandayuthapani, S.; Marimuthu, P.; Hormann, V.; Kumi-Diaka, J.; Rathinavelu, A. Induction of apoptosis in HeLa cells via caspase activation by resveratrol and genistein. J. Med. Food 2013, 16, 139–146. [Google Scholar] [CrossRef] [PubMed]
- Lucas, D.M.; Davis, M.E.; Parthun, M.R.; Mone, A.P.; Kitada, S.; Cunningham, K.D.; Flax, E.L.; Wickham, J.; Reed, J.C.; Byrd, J.C.; et al. The histone deacetylase inhibitor MS-275 induces caspase-dependent apoptosis in B-cell chronic lymphocytic leukemia cells. Leukemia 2004, 18, 1207–1214. [Google Scholar] [CrossRef] [PubMed]
- Brentnall, M.; Rodriguez-Menocal, L.; De Guevara, R.L.; Cepero, E.; Boise, L.H. Caspase-9, caspase-3 and caspase-7 have distinct roles during intrinsic apoptosis. BMC Cell Biol. 2013, 14, 32. [Google Scholar] [CrossRef] [PubMed]
- Vaux, D.L.; Korsmeyer, S.J. Cell death in development. Cell 1999, 96, 245–254. [Google Scholar] [CrossRef]
- Selvakumaran, M.; Lin, H.K.; Miyashita, T.; Wang, H.G.; Krajewski, S.; Reed, J.C.; Hoffman, B.; et al. Immediate early up-regulation of bax expression by p53 but not TGF β 1: A paradigm for distinct apoptotic pathways. Oncogene 1994, 9, 1791–1798. [Google Scholar] [PubMed]
- Yan, J.; Menendez, D.; Yang, X.P.; Resnick, M.A.; Jetten, A.M. A regulatory loop composed of RAP80-HDM2-p53 provides RAP80-enhanced p53 degradation by HDM2 in response to DNA damage. J. Biol. Chem. 2009, 284, 19280–19289. [Google Scholar] [CrossRef] [PubMed]
- Gui, C.Y.; Ngo, L.; Xu, W.S.; Richon, V.M.; Marks, P.A. Histone deacetylase (HDAC) inhibitor activation of p21WAF1 involves changes in promoter-associated proteins, including HDAC1. Proc. Natl. Acad. Sci. USA 2004, 101, 1241–1246. [Google Scholar] [CrossRef] [PubMed]
- Cao, X.X.; Mohuiddin, I.; Ece, F.; McConkey, D.J.; Smythe, W.R. Histone deacetylase inhibitor downregulation of bcl-xl gene expression leads to apoptotic cell death in mesothelioma. Am. J. Respir. Cell Mol. Biol. 2001, 25, 562–568. [Google Scholar] [CrossRef] [PubMed]
- Danial, N.N.; Korsmeyer, S.J. Cell death: Critical control points. Cell 2004, 116, 205–219. [Google Scholar] [CrossRef]
- Scorrano, L.; Korsmeyer, S.J. Mechanisms of cytochrome c release by proapoptotic BCL-2 family members. Biochem. Biophys. Res. Commun. 2003, 304, 437–444. [Google Scholar] [CrossRef]
- Gross, A.; McDonnell, J.M.; Korsmeyer, S.J. BCL-2 family members and the mitochondria in apoptosis. Genes Dev. 1999, 13, 1899–1911. [Google Scholar] [CrossRef] [PubMed]
- Wei, M.C.; Zong, W.X.; Cheng, E.H.; Lindsten, T.; Panoutsakopoulou, V.; Ross, A.J.; Roth, K.A.; MacGregor, G.R.; Thompson, C.B.; Korsmeyer, S.J. Proapoptotic BAX and BAK: A requisite gateway to mitochondrial dysfunction and death. Science 2001, 292, 727–730. [Google Scholar] [CrossRef] [PubMed]
- Xu, H.W.; Huang, Y.J.; Xie, Z.Y.; Lin, L.; Guo, Y.C.; Zhuang, Z.R.; Lin, X.P.; Zhou, W.; Li, M.; Huang, H.H.; et al. The expression of cytoglobin as a prognostic factor in gliomas: A retrospective analysis of 88 patients. BMC Cancer 2013, 13, 247. [Google Scholar] [CrossRef] [PubMed]
- Gopinath, P.; Gogoi, S.K.; Sanpui, P.; Paul, A.; Chattopadhyay, A.; Ghosh, S.S. Signaling gene cascade in silver nanoparticle induced apoptosis. Colloids Surf. B Biointerfaces 2010, 77, 240–245. [Google Scholar] [CrossRef] [PubMed]
- Neeley, W.L.; Essigmann, J.M. Mechanisms of formation, genotoxicity, and mutation of guanine oxidation products. Chem. Res. Toxicol. 2006, 19, 491–505. [Google Scholar] [CrossRef] [PubMed]
- Johnson, N.L.; Gardner, A.M.; Diener, K.M.; Lange-Carter, C.A.; Gleavy, J.; Jarpe, M.B.; Minden, A.; Karin, M.; Zon, L.I.; Johnson, G.L. Signal transduction pathways regulated by mitogen-activated/extracellular response kinase kinase kinase induce cell death. J. Biol. Chem. 1996, 271, 3229–3237. [Google Scholar] [CrossRef] [PubMed]
- Ungerstedt, J.S.; Sowa, Y.; Xu, W.S.; Shao, Y.; Dokmanovic, M.; Perez, G.; Ngo, L.; Holmgren, A.; Jiang, X.; Marks, P.A. Role of thioredoxin in the response of normal and transformed cells to histone deacetylase inhibitors. Proc. Natl. Acad. Sci. USA 2005, 102, 673–678. [Google Scholar] [CrossRef] [PubMed]
- Tate, C.M.; Lee, J.H.; Skalnik, D.G. CXXC finger protein 1 restricts the Setd1A histone H3K4 methyltransferase complex to euchromatin. FEBS J. 2010, 277, 210–223. [Google Scholar] [CrossRef] [PubMed]
- Gurunathan, S.; Han, J.W.; Eppakayala, V.; Kim, J.H. Green synthesis of graphene and its cytotoxic effects in human breast cancer cells. Int. J. Nanomed. 2013, 8, 1015–1027. [Google Scholar] [CrossRef] [PubMed]
| Sample Availability: Samples of the compounds are not available from the authors. | 












| Gene | Primer | 
|---|---|
| Bax | F: GAG AGG TCT TTT TCC GAG TGG | 
| R: GGA GGA AGT CCA ATG TCC AG | |
| p53 | F: AGG AAA TTT GCG TGT GGA GTA T | 
| R: TCC GTC CCA GTA GAT TAC CAC T | |
| Bak | F: CTC AGA GTT CCA GAC CAT GTT G | 
| R: CAT GCT GGT AGA CGT GTA GGG | |
| Bcl-2 | F: CTG AGT ACC TGA ACC GGC A | 
| R: GAG AAA TCA AAC AGA GGC CG | |
| p21 | F: ATG TGG ACC TGT CAC TGT CTT G | 
| R: CTT CCT CTT GGA GAA GAT CAG C | |
| Cyt C | F: GCGTGTCCTTGGACTTAGAG | 
| R: GGCGGCTGTGTAAGAGTATC | |
| Bid | F: CCTTGCTCCGTGATGTCTTTC | 
| R: GTAGGTGCGTAGGTTCTGGT | |
| Bcl-xL | F: GTAAACTGGGGTCGCATTGT | 
| R: CGATCCGACTCACCAATACC | |
| GAPDH | F: AACGGATTTGGTCGTATTGGG | 
| R: TCGCTCCTGGAAGATGGTGAT | 
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gurunathan, S.; Kang, M.-h.; Kim, J.-H. Combination Effect of Silver Nanoparticles and Histone Deacetylases Inhibitor in Human Alveolar Basal Epithelial Cells. Molecules 2018, 23, 2046. https://doi.org/10.3390/molecules23082046
Gurunathan S, Kang M-h, Kim J-H. Combination Effect of Silver Nanoparticles and Histone Deacetylases Inhibitor in Human Alveolar Basal Epithelial Cells. Molecules. 2018; 23(8):2046. https://doi.org/10.3390/molecules23082046
Chicago/Turabian StyleGurunathan, Sangiliyandi, Min-hee Kang, and Jin-Hoi Kim. 2018. "Combination Effect of Silver Nanoparticles and Histone Deacetylases Inhibitor in Human Alveolar Basal Epithelial Cells" Molecules 23, no. 8: 2046. https://doi.org/10.3390/molecules23082046
APA StyleGurunathan, S., Kang, M.-h., & Kim, J.-H. (2018). Combination Effect of Silver Nanoparticles and Histone Deacetylases Inhibitor in Human Alveolar Basal Epithelial Cells. Molecules, 23(8), 2046. https://doi.org/10.3390/molecules23082046
 
        

 
       