Oregano Essential Oil Attenuates RAW264.7 Cells from Lipopolysaccharide-Induced Inflammatory Response through Regulating NADPH Oxidase Activation-Driven Oxidative Stress
Abstract
1. Introduction
2. Materials and Methods
2.1. Chemicals and Reagents
2.2. MTT Assay
2.3. Lactate Dehydrogenase (LDH) Release Assay
2.4. Enzyme-Linked Immune Sorbent Assay for Quantification of Cytokines
2.5. Quantitative PCR
2.6. Western Blotting Analysis
2.7. Measurement of ROS Generation
2.8. Assessment of Lipid Peroxidation, Intracellular GSH and GSH: GSSG Ration, and NADPH Oxidase Activity
2.9. SiRNA Transfection in RAW264.7 Cells
2.10. Statistical Analysis
3. Results
3.1. OEO and LPS Induces Cytotoxicity in RAW264.7 Cells
3.2. OEO Reduces LPS-Induced Expression of Inflammatory Mediators in RAW264.7 Cells
3.3. OEO Inhibits LPS-Induced Activation of Protein Kinase B (AKT), MAPKs, and NF-κB in RAW264.7 Cells
3.4. OEO Inhibits LPS-Induced Oxidative Stress in RAW264.7 Cells
3.5. Inflammation Activation Induced by LPS Is Modulated by Nox2 in RAW264.7 Cells
4. Discussion
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Fujiwara, N.; Kobayashi, K. Macrophages in inflammation. Curr. Drug Targets-Inflamm. Allergy 2005, 4, 281–286. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kawai, T.; Adachi, O.; Ogawa, T.; Takeda, K.; Akira, S. Unresponsiveness of MyD88-Deficient Mice to Endotoxin. Immunity 1999, 11, 115–122. [Google Scholar] [CrossRef] [Scilit]
- Xu, X.; Yin, P.; Wan, C.; Chong, X.; Liu, M.; Cheng, P.; Chen, J.; Liu, F.; Xu, J. Punicalagin inhibits inflammation in LPS-induced RAW264. 7 macrophages via the suppression of TLR4-mediated MAPKs and NF-κB activation. Inflammation 2014, 37, 956–965. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, I.T.; Yang, C.M. Role of NADPH oxidase/ROS in pro-inflammatory mediators-induced airway and pulmonary diseases. Biochem. Pharmacol. 2012, 84, 581. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Barrett, C.W.; Short, S.P.; Williams, C.S. Selenoproteins and oxidative stress-induced inflammatory tumorigenesis in the gut. Cell. Mol. Life Sci. 2017, 74, 607–616. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rahman, I.; Adcock, I.M. Oxidative stress and redox regulation of lung inflammation in COPD. Eur. Respir. J. 2006, 28, 219–242. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lam, G.Y.; Huang, J.; Brumell, J.H. The many roles of NOX2 NADPH oxidase-derived ROS in immunity. Semin. Immunopathol. 2010, 32, 415–430. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Milos, M.; Mastelic, J.; Jerkovic, I. Chemical composition and antioxidant effect of glycosidically bound volatile compounds from oregano (Origanum vulgare L. ssp. hirtum). Food Chem. 2000, 71, 79–83. [Google Scholar] [CrossRef] [Scilit]
- Bakkali, F.; Averbeck, S.; Averbeck, D.; Idaomar, M. Biological effects of essential oils—A review. Food Chem. Toxicol. 2008, 46, 446–475. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Foti, M.C.; Ingold, K.U. Mechanism of inhibition of lipid peroxidation by γ-terpinene, an unusual and potentially useful hydrocarbon antioxidant. J. Agric. Food Chem. 2003, 51, 2758–2765. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bukovská, A.; Cikoš, Š.; Juhás, Š.; Il’ková, G.; Rehák, P.; Koppel, J. Effects of a combination of thyme and oregano essential oils on TNBS-induced colitis in mice. Mediat. Inflamm. 2007, 2007, 23296. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ocana-Fuentes, A.; Arranz-Gutiérrez, E.; Senorans, F.J.; Reglero, G. Supercritical fluid extraction of oregano (Origanum vulgare) essentials oils: Anti-inflammatory properties based on cytokine response on THP-1 macrophages. Food Chem. Toxicol. 2010, 48, 1568–1575. [Google Scholar]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zou, Y.; Xiang, Q.; Wang, J.; Peng, J.; Wei, H. Oregano Essential Oil Improves Intestinal Morphology and Expression of Tight Junction Proteins Associated with Modulation of Selected Intestinal Bacteria and Immune Status in a Pig Model. BioMed Res. Int. 2016, 2016, 5436738. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Keshari, R.S.; Verma, A.; Barthwal, M.K.; Dikshit, M. Reactive oxygen species-induced activation of ERK and p38 MAPK mediates PMA-induced NETs release from human neutrophils. J. Cell. Biochem. 2013, 114, 532–540. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Laskin, D.L.; Pendino, K.J. Macrophages and inflammatory mediators in tissue injury. Annu. Rev. Pharmacol. Toxicol. 1995, 35, 655–677. [Google Scholar] [CrossRef] [PubMed]
- Rietschel, E.T.; Kirikae, T.; Schade, F.U.; Mamat, U.; Schmidt, G.; Loppnow, H.; Ulmer, A.J.; Zähringer, U.; Seydel, U.; di Padova, F. Bacterial endotoxin: Molecular relationships of structure to activity and function. FASEB J. 1994, 8, 217–225. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, H.G.; Shrestha, B.; Lim, S.Y.; Yoon, D.H.; Chang, W.C.; Shin, D.-J.; Han, S.K.; Park, S.M.; Park, J.H.; Park, H.I. Cordycepin inhibits lipopolysaccharide-induced inflammation by the suppression of NF-κB through Akt and p38 inhibition in RAW 264.7 macrophage cells. Eur. J. Pharmacol. 2006, 545, 192–199. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lamkanfi, M.; Dixit, V.M. Inflammasomes and their roles in health and disease. Annu. Rev. Cell Dev. Biol. 2012, 28, 137–161. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xavier, R.; Podolsky, D. Unravelling the pathogenesis of inflammatory bowel disease. Nature 2007, 448, 427–434. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zou, Y.; Wang, J.; Peng, J.; Wei, H. Oregano Essential Oil Induces SOD1 and GSH Expression through Nrf2 Activation and Alleviates Hydrogen Peroxide-Induced Oxidative Damage in IPEC-J2 Cells. Oxidative Med. Cell. Longev. 2016, 2016, 5987183. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kavoosi, G.; da Silva, J.A.T. Inhibitory effects of Zataria multiflora essential oil and its main components on nitric oxide and hydrogen peroxide production in glucose-stimulated human monocyte. Food Chem. Toxicol. 2012, 9, 3079–3085. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Intayoung, P.; Limtrakul, P.; Yodkeeree, S. Antiinflammatory Activities of Crebanine by Inhibition of NF-κB and AP-1 Activation through Suppressing MAPKs and Akt Signaling in LPS-Induced RAW264. 7 Macrophages. Biol. Pharm. Bull. 2016, 39, 54–61. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Neurath, M.F. Cytokines in inflammatory bowel disease. Nat. Rev. Immunol. 2014, 14, 329–342. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Heo, S.K.; Yi, H.S.; Yun, H.J.; Ko, C.H.; Choi, J.W.; Park, S.D. Ethylacetate extract from DraconisResina inhibits LPS-induced inflammatory responses in vascular smooth muscle cells and macrophages via suppression of ROS production. Food Chem. Toxicol. 2010, 48, 1129–1136. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Son, Y.; Cheong, Y.-K.; Kim, N.-H.; Chung, H.-T.; Kang, D.G.; Pae, H.-O. Mitogen-activated protein kinases and reactive oxygen species: How can ROS activate MAPK pathways? J. Signal. Transduct. 2011, 2011, 792639. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Qi, S.; Xin, Y.; Guo, Y.; Diao, Y.; Kou, X.; Luo, L.; Yin, Z. Ampelopsin reduces endotoxic inflammation via repressing ROS-mediated activation of PI3K/Akt/NF-κB signaling pathways. Int. Immunopharmacol. 2012, 12, 278–287. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kulisic, T.; Radonic, A.; Katalinic, V.; Milos, M. Use of different methods for testing antioxidative activity of oregano essential oil. Food Chem. 2004, 85, 633–640. [Google Scholar] [CrossRef] [Scilit]
- Ho, E.; Galougahi, K.K.; Liu, C.-C.; Bhindi, R.; Figtree, G.A. Biological markers of oxidative stress: Applications to cardiovascular research and practice. Redox Biol. 2013, 1, 483–491. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Valko, M.; Leibfritz, D.; Moncol, J.; Cronin, M.T.D.; Mazur, M.; Telser, J. Free radicals and antioxidants in normal physiological functions and human disease. Int. J. Biochem. Cell Biol. 2007, 39, 44–84. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bedard, K.; Krause, K.-H. The NOX family of ROS-generating NADPH oxidases: Physiology and pathophysiology. Physiol. Rev. 2007, 87, 245–313. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Menden, H.; Welak, S.; Cossette, S.; Ramchandran, R.; Sampath, V. Lipopolysaccharide (LPS)-mediated angiopoietin-2-dependent autocrine angiogenesis is regulated by NADPH oxidase 2 (Nox2) in human pulmonary microvascular endothelial cells. J. Biol. Chem. 2015, 290, 5449–5461. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sasaki, H.; Yamamoto, H.; Tominaga, K.; Masuda, K.; Kawai, T.; Teshima-Kondo, S.; Rokutan, K. NADPH oxidase-derived reactive oxygen species are essential for differentiation of a mouse macrophage cell line (RAW264. 7) into osteoclasts. J. Med. Investig. 2009, 56, 33–41. [Google Scholar] [CrossRef] [Scilit]
- O’Neill, H.C.; Rancourt, R.C.; White, C.W. Lipoic acid suppression of neutrophil respiratory burst: Effect of NADPH. Antioxid. Redox Signal. 2008, 10, 277–286. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, F.; Qian, L.H.; Deng, B.; Liu, Z.M.; Zhao, Y.; Le, Y.Y. Resveratrol Protects Vascular Endothelial Cells from High Glucose–Induced Apoptosis through Inhibition of NADPH Oxidase Activation–Driven Oxidative Stress. CNS Neurosci. Ther. 2013, 19, 675–681. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, I.T.; Shih, R.H.; Lin, C.C.; Chen, J.T.; Yang, C.M. Role of TLR4/NADPH oxidase/ROS-activated p38 MAPK in VCAM-1 expression induced by lipopolysaccharide in human renal mesangial cells. Cell Commun. Signal. 2012, 10, 33. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kavoosi, G.; da Silva, J.A.T.; Saharkhiz, M.J. Inhibitory effects of Zataria multiflora essential oil and its main components on nitric oxide and hydrogen peroxide production in lipopolysaccharide-stimulated macrophages. Food Chem. Toxicol. 2012, 64, 1491–1500. [Google Scholar]
Sample Availability: Samples of the compounds are not available from the authors. |




| Gene | Primer Sequence (Forward/Reverse 5′-3′) | Product Size (bp) |
|---|---|---|
| IL-1β | forward: ATGGCAACTGTCCCTGAACTCAACT reverse: CAGGACAGGTATAGATTCAACCCCTT | 560 |
| IL-6 | forward: CCAGTTGCCTTCTTGGGACTGATG reverse: ATTTTCTGACCACAGTGAGGAATG | 662 |
| TNF-α | forward: ATGAGCACGGAAAGCATGATCCGA reverse: CCAAAGTAGACCTGCCCGGACTC | 692 |
| β-actin | forward: GGAGATTACTGCCCTGGCTCCTA reverse: GACTCATCGTACTCCTGCTTGCTG | 101 |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cheng, C.; Zou, Y.; Peng, J. Oregano Essential Oil Attenuates RAW264.7 Cells from Lipopolysaccharide-Induced Inflammatory Response through Regulating NADPH Oxidase Activation-Driven Oxidative Stress. Molecules 2018, 23, 1857. https://doi.org/10.3390/molecules23081857
Cheng C, Zou Y, Peng J. Oregano Essential Oil Attenuates RAW264.7 Cells from Lipopolysaccharide-Induced Inflammatory Response through Regulating NADPH Oxidase Activation-Driven Oxidative Stress. Molecules. 2018; 23(8):1857. https://doi.org/10.3390/molecules23081857
Chicago/Turabian StyleCheng, Chuanshang, Yi Zou, and Jian Peng. 2018. "Oregano Essential Oil Attenuates RAW264.7 Cells from Lipopolysaccharide-Induced Inflammatory Response through Regulating NADPH Oxidase Activation-Driven Oxidative Stress" Molecules 23, no. 8: 1857. https://doi.org/10.3390/molecules23081857
APA StyleCheng, C., Zou, Y., & Peng, J. (2018). Oregano Essential Oil Attenuates RAW264.7 Cells from Lipopolysaccharide-Induced Inflammatory Response through Regulating NADPH Oxidase Activation-Driven Oxidative Stress. Molecules, 23(8), 1857. https://doi.org/10.3390/molecules23081857

