Isolation of β-1,3-Glucanase-Producing Microorganisms from Poria cocos Cultivation Soil via Molecular Biology
Abstract
1. Introduction
2. Results and Discussion
2.1. Bacterial Community Analysis
2.2. Identification of Glucan-Degrading Microorganisms
2.3. Enzyme Activity Assay
2.4. Gene Clone and Analysis
2.5. Expression and Purification of Recombinant Enzymes
3. Materials and Methods
3.1. Materials
3.2. High-Throughput Sequencing
3.3. Isolation and Identification of Glucan-Degrading Microorganisms
3.4. Determination of the Enzyme Activity
3.5. Cloning and Expression of β-1,3-Glucanase Genes
3.6. Purification of the β-1,3-Glucanases
3.7. Bioinformatics Analysis
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Kobayashi, T.; Uchimura, K.; Kubota, T.; Nunoura, T.; Deguchi, S. Biochemical and genetic characterization of β-1,3 glucanase from a deep subseafloor Laceyella putida. Appl. Microbiol. Biotechnol. 2016, 100, 203–214. [Google Scholar] [CrossRef] [PubMed]
- Kusaykin, M.I.; Belik, A.A.; Kovalchuk, S.N.; Dmitrenok, P.S.; Rasskazov, V.A.; Isakov, V.V.; Zvyagintseva, T.N. A new recombinant endo-1,3-β-d-glucanase from the marine bacterium Formosa algae KMM 3553: enzyme characteristics and transglycosylation products analysis. World J. Microbiol. Biotechnol. 2017, 33, 40. [Google Scholar] [CrossRef] [PubMed]
- Jadhav, S.B.; Gupta, A. Studies on application of β-1,3 glucanase in the degradation of glucans produced by Botrytis cinerea and inhibition of fungal growth. Biocatal. Agric. Biotechnol. 2016, 7, 45–47. [Google Scholar] [CrossRef]
- Lee, S.Y. Biocontrol of anthracnose in pepper using chitinase, β-1,3 glucanase, and 2-furancarboxaldehyde produced by Streptomyces cavourensis SY224. J. Microbiol. Biotechnol. 2012, 22, 1359–1366. [Google Scholar] [CrossRef] [PubMed]
- Fu, Y.; Cheng, L.; Meng, Y.; Li, S.; Zhao, X.; Du, Y.; Yin, H. Cellulosimicrobium cellulans strain E4-5 enzymatic hydrolysis of curdlan for production of (1→3)-linked β-d-glucan oligosaccharides. Carbohydr. Polym. 2015, 134, 740–744. [Google Scholar] [CrossRef] [PubMed]
- Hida, T.H.; Ishibashi, K.; Miura, N.N.; Adachi, Y.; Shirasu, Y.; Ohno, N. Cytokine induction by a linear 1,3-glucan, curdlan-oligo, in mouse leukocytes in vitro. Inflamm. Res. 2009, 58, 9–14. [Google Scholar] [CrossRef] [PubMed]
- Ribeiro, T.C.; Weiblen, C.; de Azevedo, M.I.; de Avila Botton, S.; Robe, L.J.; Pereira, D.I.; Monteiro, D.U.; Lorensetti, D.M.; Santurio, J.M. Microevolutionary analyses of Pythium insidiosum isolates of Brazil and Thailand based on exo-1,3-β-glucanase gene. Infect. Genet. Evol. 2017, 48, 58–63. [Google Scholar] [CrossRef] [PubMed]
- Hong, T.Y.; Cheng, C.W.; Huang, J.W.; Meng, M. Isolation and biochemical characterization of an endo-1,3-β-glucanase from Streptomyces sioyaensis containing a C-terminal family 6 carbohydrate-binding module that binds to β-1,3-glucan. Microbiology 2002, 148, 1151–1159. [Google Scholar] [CrossRef] [PubMed]
- Pang, Z.; Kang, Y.-N.; Ban, M.; Oda, M.; Kobayashi, R.; Ohnishi, M.; Mikami, B. Crystallization and preliminary crystallographic analysis of endo-1,3-beta-glucanase from Arthrobacter sp. Acta Cryst. 2005, 61, 68–70. [Google Scholar]
- Okazaki, K.; Nishimura, N.; Matsuoka, F.; Hayakawa, S. Cloning and characterization of the gene encoding endo-β-1,3-glucanase from Arthrobacter sp. NHB-10. Biosci. Biotechnol. Biochem. 2007, 71, 1568–1571. [Google Scholar] [CrossRef] [PubMed]
- Tanabe, Y.; Oda, M. Molecular characterization of endo-1,3-β-glucanase from Cellulosimicrobium cellulans: effects of carbohydrate-binding module on enzymatic function and stability. BBA 2011, 1814, 1713–1719. [Google Scholar] [CrossRef] [PubMed]
- Masuda, S.; Endo, K.; Koizumi, N.; Hayami, T.; Fukazawa, T.; Yatsunami, R.; Fukui, T.; Nakamura, S. Molecular identification of a novel β-1,3-glucanase from alkaliphilic Nocardiopsis sp. strain F96. Extremophiles 2006, 10, 251–255. [Google Scholar] [CrossRef] [PubMed]
- Hong, T.Y.; Meng, M. Biochemical characterization and antifungal activity of an endo-1,3-β-glucanase of Paenibacillus sp. isolated from garden soil. Appl. Microbiol. Biotechnol. 2003, 61, 472–478. [Google Scholar] [CrossRef] [PubMed]
- Zverlov, V.V.; Volkov, I.Y.; Velikodvorskaya, T.V.; Schwarz, W.H. Highly thermostable endo-1,3-β-glucanase (laminarinase) LamA from Thermotoga neapolitana: Nucleotide sequence of the gene and characterization of the recombinant gene product. Microbiology 1997, 143, 1701–1708. [Google Scholar] [CrossRef] [PubMed]
- Asano, T.; Taki, J.; Yamamoto, M.; Aono, R. Cloning and structural analysis of bglm gene coding for the fungal cell wall-lytic β-1,3-glucan-hydrolase bglm of Bacillus circulans IAM1165. Biosci. Biotechnol. Biochem. 2014, 66, 1246–1255. [Google Scholar] [CrossRef]
- Park, J.K.; Kim, J.D.; Park, Y.I.; Kim, S.K. Purification and characterization of a 1,3-β-d-glucanase from Streptomyces torulosus PCPOK-0324. Carbohydr. Polym. 2012, 87, 1641–1648. [Google Scholar] [CrossRef]
- Mallikharjuna Rao, K.L.N.; Siva Raju, K.; Ravisankar, H. Cultural conditions on the production of extracellular enzymes by Trichoderma isolates from tobacco rhizosphere. Braz. J. Microbiol. 2016, 47, 25–32. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Zhang, M.; Ruan, D.; Shashkov, A.S.; Kilcoyne, M.; Savage, A.V.; Zhang, L. Chemical components and molecular mass of six polysaccharides isolated from the sclerotium of Poria cocos. Carbohydr. Res. 2004, 339, 327–334. [Google Scholar] [CrossRef] [PubMed]
- Marschner, P. Plant-Microbe Interactions in the Rhizosphere and nutrient cycling. In Soil Biology; Marschner, P., Rengel, Z., Eds.; Springer: Berlin/Heidelberg, Germany, 2007; Volume 10, pp. 60–182. ISBN 978-3-540-68027-7. [Google Scholar]
- Tourna, M.; Freitag, T.E.; Nicol, G.W.; Prosser, J.I. Growth, activity and temperature responses of ammonia-oxidizing archaea and bacteria in soil microcosms. Environ. Microbiol. 2008, 10, 1357–1364. [Google Scholar] [CrossRef] [PubMed]
- Quaiser, A.; Zivanovic, Y.; Moreira, D.; Lopez-Garcia, P. Comparative metagenomics of bathypelagic plankton and bottom sediment from the Sea of Marmara. ISME J. 2011, 5, 285–304. [Google Scholar] [CrossRef] [PubMed]
- Ahn, J.H.; Hong, I.P.; Bok, J.I.; Kim, B.Y.; Song, J.; Weon, H.Y. Pyrosequencing analysis of the bacterial communities in the guts of honey bees Apis cerana and Apis mellifera in Korea. J. Microbiol. 2012, 50, 735–745. [Google Scholar] [CrossRef] [PubMed]
- Cydzik-Kwiatkowska, A.; Zielinska, M. Bacterial communities in full-scale wastewater treatment systems. World J. Microbiol. Biotechnol. 2016, 32, 66. [Google Scholar] [CrossRef] [PubMed]
- Highlander, S.K. High throughput sequencing methods for microbiome profiling: Application to food animal systems. Anim. Health Res. Rev. 2012, 13, 40–53. [Google Scholar] [CrossRef] [PubMed]
- Li, Q.; Zhang, B.; Wang, L.; Ge, Q. Distribution and diversity of bacteria and fungi colonizing ancient buddhist statues analyzed by high-throughput sequencing. Int. Biodeter. Biodegr. 2017, 117, 245–254. [Google Scholar] [CrossRef]
- Liu, P.; Gao, Y.; Huang, W.; Shao, Z.; Shi, J.; Liu, Z. A novel bioassay for high-throughput screening microorganisms with N-acyl homoserine lactone degrading activity. Appl. Biochem. Biotechnol. 2012, 167, 73–80. [Google Scholar] [CrossRef] [PubMed]
- Van Dam, N.M.; Bouwmeester, H.J. Metabolomics in the rhizosphere: Tapping into belowground chemical communication. Trends Plant Sci. 2016, 21, 256–265. [Google Scholar] [CrossRef] [PubMed]
- Hashimoto, W.; Ochiai, A.; Momma, K.; Itoh, T.; Mikami, B.; Maruyama, Y.; Murata, K. Crystal structure of the glycosidase family 73 peptidoglycan hydrolase FlgJ. Biochem. Biophys. Res. Commun. 2009, 381, 16–21. [Google Scholar] [CrossRef] [PubMed]
- Zhang, R.; Zhou, J.; Gao, Y.; Guan, Y.; Li, J.; Tang, X.; Xu, B.; Ding, J.; Huang, Z. Molecular and biochemical characterizations of a new low-temperature active mannanase. Folia Microbiol. 2015, 60, 483–492. [Google Scholar] [CrossRef] [PubMed]
- Aylward, F.O.; McDonald, B.R.; Adams, S.M.; Valenzuela, A.; Schmidt, R.A.; Goodwin, L.A.; Woyke, T.; Currie, C.R.; Suen, G.; Poulsen, M. Comparison of 26 sphingomonad genomes reveals diverse environmental adaptations and biodegradative capabilities. Appl. Environ. Microbiol. 2013, 79, 3724–3733. [Google Scholar] [CrossRef] [PubMed]
- Ren, J.H.; Ye, J.R.; Liu, H.; Xu, X.L.; Wu, X.Q. Isolation and characterization of a new Burkholderia pyrrocinia strain JK-SH007 as a potential biocontrol agent. World J. Microbiol. Biotechnol. 2011, 27, 2203–2215. [Google Scholar] [CrossRef]
- Kitamura, E.; Kamei, Y. Molecular cloning of the gene encoding beta-1,3(4)-glucanase A from a marine bacterium, Pseudomonas sp. PE2, an essential enzyme for the degradation of Pythium porphyrae cell walls. Appl. Microbiol. Biotechnol. 2006, 71, 630–637. [Google Scholar] [CrossRef] [PubMed]
- Cui, C.H.; Liu, Q.M.; Kim, J.K.; Sung, B.H.; Kim, S.G.; Kim, S.C.; Im, W.T. Identification and characterization of a mucilaginibacter sp. strainqm49 β-glucosidase and its use in the production of the pharmaceutically active minor ginsenosides (s)-rh1 and (s)-rg2. Appl. Environ. Microbiol. 2013, 79, 5788–5798. [Google Scholar] [CrossRef] [PubMed]
- Wu, H.M.; Liu, S.W.; Hsu, M.T.; Hung, C.L.; Lai, C.C.; Cheng, W.C.; Wang, H.J.; Li, Y.K.; Wang, W.C. Structure, mechanistic action, and essential residues of a GH-64 enzyme, laminaripentaose-producing beta-1,3-glucanase. J. Biol. Chem. 2009, 284, 26708–26715. [Google Scholar] [CrossRef] [PubMed]
- Shi, P.; Yao, G.; Yang, P.; Li, N.; Luo, H.; Bai, Y.; Wang, Y.; Yao, B. Cloning, characterization, and antifungal activity of an endo-1,3-β-d-glucanase from Streptomyces sp. S27. Appl. Microbiol. Biotechnol. 2010, 85, 1483–1490. [Google Scholar] [CrossRef] [PubMed]
- Ferrer, P. Revisiting the Cellulosimicrobium cellulans yeast-lytic beta-1,3-glucanases toolbox: A review. Microb. Cell Fact. 2006, 5, 10. [Google Scholar] [CrossRef] [PubMed]
- Doumbou, C.L.; Hamby Salove, M.K.; Crawford, D.L.; Beaulieu, C. Actinomycetes, promising tools to control plant diseases and to promote plant growth. Phytoprotection 2001, 82, 85. [Google Scholar] [CrossRef]
- Girard, G.; Traag, B.A.; Sangal, V.; Mascini, N.; Hoskisson, P.A.; Goodfellow, M.; van Wezel, G.P. A novel taxonomic marker that discriminates between morphologically complex actinomycetes. Open Biol. 2013, 3, 130073. [Google Scholar] [CrossRef] [PubMed]
- Javmen, A.; Grigiskis, S.; Rudenkov, M.; Mauricas, M. Purification and partial characterization of a novel β-1,3-endoglucanase from Streptomyces rutgersensis. Protein J. 2013, 32, 411–417. [Google Scholar] [CrossRef] [PubMed]
- Hazes, B. The (QxW)3 domain: A flexible lectin scaffold. Protein Sci. 1996, 5, 1490–1501. [Google Scholar] [CrossRef] [PubMed]
- Fujimoto, Z.; Kuno, A.; Kaneko, S.; Yoshida, S.; Kobayashi, H.; Kusakabe, I.; Mizuno, H. Crystal structure of streptomyces olivaceoviridis e-86 β-xylanase containing xylan-binding domain. J. Mol. Biol. 2000, 300, 575–585. [Google Scholar] [CrossRef] [PubMed]
- Sun, J.L.; Sakka, K.; Karita, H.; Kimura, T.; Ohmiya, K. Adsorption of clostridium stercorarium xylanase a to insoluble xylan and the importance of the cbds to xylan hydrolysis. J. Ferment. Bioeng. 1998, 85, 63–68. [Google Scholar] [CrossRef]
- Van Bueren, A.L.; Morland, C.; Gilbert, H.J.; Boraston, A.B. Family 6 carbohydrate binding modules recognize the non-reducing end of β-1,3-linked glucans by presenting a unique ligand binding surface. J. Biol. Chem. 2005, 280, 530–537. [Google Scholar] [CrossRef] [PubMed]
- Hong, T.Y.; Hsiao, Y.Y.; Meng, M.; Li, T.T. The 1.5 A structure of endo-1,3-β-glucanase from Streptomyces sioyaensis: evolution of the active-site structure for β-1,3-glucan-binding specificity and hydrolysis. Acta Crystallogr. C 2008, 64, 964–970. [Google Scholar]
- Juncosa, M.; Pons, J.; Dot, T.; Querol, E.; Planas, A. Identification of active site carboxylic residues in bacizzus zicheniformis 1,3-1,4-β-d-glucan-4-glucanohydrolase by site-directed mutagenesis. J. Biol. Chem. 1994, 269, 14530–14535. [Google Scholar] [PubMed]
- Zhao, D.; Huang, R.; Zeng, J.; Yu, Z.; Liu, P.; Cheng, S.; Wu, Q.L. Pyrosequencing analysis of bacterial community and assembly in activated sludge samples from different geographic regions in China. Appl. Microbiol. Biotechnol. 2014, 98, 9119–9128. [Google Scholar] [CrossRef] [PubMed]
- Kunin, V.; Engelbrektson, A.; Ochman, H.; Hugenholtz, P. Wrinkles in the rare biosphere: pyrosequencing errors can lead to artificial inflation of diversity estimates. Environ. Microbiol. 2010, 12, 118–123. [Google Scholar] [CrossRef] [PubMed]
- Huse, S.M.; Welch, D.M.; Morrison, H.G.; Sogin, M.L. Ironing out the wrinkles in the rare biosphere through improved OTU clustering. Environ. Microbiol. 2010, 12, 1889–15898. [Google Scholar] [CrossRef] [PubMed]
- Wang, Q.; Garrity, G.M.; Tiedje, J.M.; Cole, J.R. Naive bayesian classifier for rapid assignment of rRNA sequences into the new bacterial taxonomy. Appl. Environ. Microbiol. 2007, 73, 5261–5267. [Google Scholar] [CrossRef] [PubMed]
- Williams, S.T.; Davies, F.L. Use of antibiotics for selective isolation and enumeration of actinomycetes in soil. J. Genet. Microbiol. 1965, 38, 251–261. [Google Scholar] [CrossRef] [PubMed]
- Mahasneh, A.M.; Stewart, D.J. A Medium for Detecting β-(1,3) Glucanase Activity in Bacteria. J. Appl. Microbiol. 1980, 48, 457–458. [Google Scholar]
- Bradford, M.M. Rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]
Sample Availability: Samples of the compounds are not available from the authors. |
Samples | Number of Effective Sequences | Number of OTUs | Coverage (%) | Chao1 | Shannon Index |
---|---|---|---|---|---|
FLT1 | 44,870 | 7737 | 88.51 | 25,534.52 | 6.95 |
FLT2 | 57,135 | 10,709 | 88.56 | 34,009.99 | 7.52 |
Isolate Name | 16S rRNA Gene Sequence Lengh (bp) | Best BLAST Hit(s) | Accession Number | Identity (%) |
---|---|---|---|---|
SYBCQL | 1345 | Kitasatospora phosalacinea JKCM-G-8A Kitasatospora phosalacinea NBRC 14372 a | LC010672.1 NR_112434.1 | 99 99 |
SYBCA | 1396 | Streptomyces cinerochromogenes MC10130 Streptomyces cinerochromogenes NBRC 13822 a Streptomyces coelescens CSSP420 Streptomyces cinerochromogenes 3CSSP87 | AB968639.1 NR_041153.1 NR_115375.1 NR_115366.1 | 99 99 99 99 |
SYBC6 | 1418 | Streptomyces cellostaticus HUBZM22 Streptomyces capoamus JCM 4734 a | HQ853021.1 NR_040856.1 | 99 99 |
SYBC7 | 1399 | Streptomyces cellostaticus HUBZM22 Streptomyces cellostaticus NBRC 12849 a | HQ853021.1 NR_112304.1 | 99 99 |
SYBC8 | 1416 | Streptomyces cinerochromogenes MC10130 Streptomyces cinerochromogenes NBRC 13822 a Streptomyces coelescens CSSP420 Streptomyces cinerochromogenes 3CSSP87 | AB968639.1 NR_041153.1 NR_115375.1 NR_115366.1 | 99 99 99 99 |
SYBC16 | 1417 | Streptomyces olivogriseus NBRC 13795 Streptomyces filipinensis NBRC 12860 a | AB184486.1 NR_041083.1 | 99 99 |
SYBC17 | 1389 | Streptomyces cellostaticus HUBZM22 Streptomyces capoamus JCM 4734 a | HQ853021.1 NR_040856.1 | 99 99 |
SYBC24 | 1393 | Streptomyces sp. X4-5 Streptomyces viridochromogenes NBRC 13347 a | KT581286.1 NR_112526.1 | 99 99 |
SYBC25 | 1393 | Streptomyces cellostaticus HUBZM22 Streptomyces capoamus JCM 4734 a | HQ853021.1 NR_040856.1 | 99 99 |
SYBC26 | 1393 | Streptomyces indiaensis LMG 19961 Streptomyces indiaensis NBRC 13964 a | AJ781344.1 NR_041155.1 | 99 99 |
SYBC27 | 1422 | Streptomyces cellostaticus HUBZM22 Streptomyces cellostaticus NBRC 12849 a | HQ853021.1 NR_112304.1 | 99 99 |
Isolates | Total Protein (mg) | Total Activity (U) | Specific Activity (U/mg) |
---|---|---|---|
SYBCQL | 31.22 | 3.75 | 0.12 |
SYBCA | 26.31 | 23.15 | 0.88 |
SYBC6 | 10.44 | 5.84 | 0.56 |
SYBC7 | 23.82 | 13.10 | 0.55 |
SYBC8 | 32.08 | 3.85 | 0.12 |
SYBC16 | 24.21 | 10.65 | 0.44 |
SYBC17 | 37.85 | 38.60 | 1.02 |
SYBC24 | 34.21 | 6.16 | 0.18 |
SYBC25 | 8.22 | 2.71 | 0.33 |
SYBC26 | 10.28 | 4.52 | 0.44 |
SYBC27 | 33.82 | 4.06 | 0.12 |
Organism | Protein Abbreviation | Accession No/PDB No |
---|---|---|
Streptomyces sioyaensis | Curd | AF217415 |
Streptomyces matensis ATCC 23935 | LPHase | AB019428 |
Streptomyces sp. S27 | BglS27 | FJ887899 |
Streptomyces clavuligerus ATCC | SCA1 | EFG04651 |
Streptomyces acidiscabies | SCA2 | WP_010357589 |
Streptomyces coelicoflavus | SCA55 | WP_007387290 |
Streptomyces avermitilis | SCA4 | WP_010988837 |
Streptomyces avermitilis | SCA5 | WP_010983203 |
Streptomyces azureus | SCA6 | GAP51072 |
Streptomyces bingchenggensis BCW-1 | SCA7 | ADI05411 |
Streptomyces canus | SCA8 | WP_020122288 |
Streptomyces canus | SCA9 | WP_020117105 |
Streptomyces cattleya | SCA10 | WP_014626989 |
Streptomyces chartreusis | SCA11 | WP_010043060 |
Streptomyces clavuligerus ATCC 27064 | SCA12 | EDY52285 |
Streptomyces clavuligerus | SCA13 | WP_003957976 |
Streptomyces collinus Tu 365 | SCA14 | AGS72893 |
Streptomyces collinus | SCA15 | WP_020943303 |
Streptomyces griseoaurantiacus | SCA16 | WP_006140385 |
Streptomyces griseoflavus Tu4000 | SCA17 | EFL37893 |
Streptomyces griseoflavus | SCA18 | WP_004921557 |
Streptomyces griseus | SCA19 | WP_012377737 |
Streptomyces himastatinicus | SCA20 | WP_009714916 |
Streptomyces hokutonensis | SCA21 | WP_019069886 |
Streptomyces hokutonensis | SCA22 | WP_019068505 |
Streptomyces hygroscopicus | SCA23 | WP_014676131 |
Streptomyces lincolnensis | SCA24 | ANS69291 |
Streptomyces malaysiensis | SCA25 | ATL81267 |
Streptomyces niveus | SCA26 | WP_023538571 |
Streptomyces olivochromogenes | SCA27 | GAX48907 |
Streptomyces pratensis | SCA28 | WP_014152186 |
Streptomyces prunicolor | SCA29 | WP_019057733 |
Streptomyces prunicolor | SCA30 | WP_019059013 |
Streptomyces roseochromogenus | SCA31 | WP_023545390 |
Streptomyces scopuliridis RB72 | SCA32 | PVE09807 |
Streptomyces sp. 351MFTsu5.1 | SCA33 | WP_020134833 |
Streptomyces sp. 351MFTsu5.1 | SCA34 | WP_020135556 |
Streptomyces sp. AA4 | SCA35 | EFL08653 |
Streptomyces sp. ACT-1 | SCA36 | WP_003964231 |
Streptomyces sp. SPB074 | SCA37 | WP_008747151 |
Streptomyces sp. SPB78 | SCA38 | EFL00779 |
Streptomyces sp. SPB78 | SCA39 | EFK98142 |
Streptomyces sparsogenes DSM 40356 | SCA40 | OMI34149 |
Streptomyces sviceus | SCA41 | WP_007386005 |
Streptomyces thermolilacinus | SCA42 | WP_023590036 |
Streptomyces violaceusniger | SCA43 | WP_014059092 |
Streptomyces viridochromogenes | SCA44 | WP_003994249 |
Streptomyces viridosporus ATCC 14672 | SCA45 | EFE71345 |
Streptomyces viridosporus ATCC 14672 | SCA46 | EFE68955 |
Streptomyces viridosporus | SCA47 | WP_004986925 |
Streptomyces viridosporus | SCA48 | WP_016827665 |
Streptomyces viridosporus | SCA49 | WP_016825877 |
Streptomyces violaceusniger Tu 4113 | SCA50 | AEM85607 |
Streptomyces sp. SCC 2136 | SCA51 | CAF31374 |
Streptomyces zinciresistens | SCA52 | WP_007495688 |
Streptomyces zinciresistens | SCA53 | WP_007501949 |
Streptomyces coelicoflavus | SCA54 | WP_007389367 |
Streptomyces lydicus | SlgC1SlgC2 | CBA11580CBA11566 |
Nocardiopsis sp. F96 | BglF | AB244275 |
Arthrobacter sp. Rue61a | Rue | WP_014920770 |
Streptomyces sp. SirexAA-E | SAE | G2NFJ9 |
Streptomyces hygroscopicus subsp. jinggangensis TL01 | TL01 | AEY93509 |
Arthrobacter sp. NHB-10 | GluA2 | AB289602 |
SYBC17 | 17-W | MH190407 |
SYBC17 | 17-Q | MH190408 |
SYBCQL | QLK1 | MH190409 |
Cellulosimicrobium cellulans DK-1 | DK-1 | EU589324 |
B. circulans | GlcA | P23903 |
T. maritima Msb8 | Msb8 | 3AZX |
B.circulans bglM | BglM | AB078775 |
Pseudomonas sp. PE2 | GluA1 | BAC16331 |
Zobellia galactanivorans | ZgLamA | 4BQ1 |
Paenibacillus sp. CCRC 17245 | LamA1 | ABJ15796 |
Corallococcus sp. | LamC | KX583630 |
Mycobacterium fortuitum | 4W65 | 4W65 |
Thermotoga neapolitana | BglB | Z77856 |
Thermotoga petrophila | TpLam | CP000702 |
Pyrococcus furiosus | pfLamA | 2VY0 |
Corallococcus sp. | LamC | KX583630 |
Rhodothermus marinus ITI278 | LamR | AAC69707 |
Aspergillus fumigatus | ENGL2 | AFUA_2G14360 |
Aspergillus fumigatus | BGT1 | AF038596 |
Aspergillus fumigatus | ENGL1 | AFUA_1G04260 |
Pseudoalteromonas sp. BB1 | ExoP | DQ361032 |
Actinosynnema mirum DSM 43827 | DSM | ACU35625 |
Micromonospora sp. L5 | MSL5 | ADU06434 |
Laceyella putida | LpGluA | LC060791 |
Streptomyces coelicolor A3(2) | CA31 | NP_630740 |
Streptomyces coelicolor A3(2) | CA32 | NP_625089 |
Named | Total Protein (mg) | Total Activity (U) | Specific Activity (U/mg) |
---|---|---|---|
QLK1 | 2.11 | 138.88 | 65.82 |
17-W | 1.31 | 174.09 | 132.90 |
17-Q | 2.33 | 34.26 | 14.70 |
Gene Name | Primer Name | Primer Sequences (5′-3′) | Restriction Site |
---|---|---|---|
17-W | 17-WF | GCCGAAGCTTATGGCCTCCCCCCGCCTGCTCC | Hind III |
17-WR | GCCGTCTAGATCAGCCGACCGTCCACTTCTGGTTGGC | Xba I | |
17-Q | 17-QF | GCCGAAGCTTATGAGTGAAACCTCCGGCATACCCA | Hind III |
17-QR | GCCGTCTAGATCAGTGACCGAAGTCGAACCAGTTCAC | Xba I | |
QLK1 | QLK1-F | GCCGAAGCTTATGGCTGCTGCCCCACGCACGCGC | Hind III |
QLK1-R | GCCGTCTAGATCAGCCCAGCGTCCACTTCTGCGCGCC | Xba I |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wu, Q.; Dou, X.; Wang, Q.; Guan, Z.; Cai, Y.; Liao, X. Isolation of β-1,3-Glucanase-Producing Microorganisms from Poria cocos Cultivation Soil via Molecular Biology. Molecules 2018, 23, 1555. https://doi.org/10.3390/molecules23071555
Wu Q, Dou X, Wang Q, Guan Z, Cai Y, Liao X. Isolation of β-1,3-Glucanase-Producing Microorganisms from Poria cocos Cultivation Soil via Molecular Biology. Molecules. 2018; 23(7):1555. https://doi.org/10.3390/molecules23071555
Chicago/Turabian StyleWu, Qiulan, Xin Dou, Qi Wang, Zhengbing Guan, Yujie Cai, and Xiangru Liao. 2018. "Isolation of β-1,3-Glucanase-Producing Microorganisms from Poria cocos Cultivation Soil via Molecular Biology" Molecules 23, no. 7: 1555. https://doi.org/10.3390/molecules23071555
APA StyleWu, Q., Dou, X., Wang, Q., Guan, Z., Cai, Y., & Liao, X. (2018). Isolation of β-1,3-Glucanase-Producing Microorganisms from Poria cocos Cultivation Soil via Molecular Biology. Molecules, 23(7), 1555. https://doi.org/10.3390/molecules23071555