CpG Methylation Changes G-Quadruplex Structures Derived from Gene Promoters and Interaction with VEGF and SP1
Abstract
1. Introduction
2. Results
2.1. Effect of CpG Methylation of VEGF G4 DNA on Binding Ability for VEGF165
2.2. Effect of CpG Methylation of Promoter-Derived G4-Forming DNA on DNA-Binding Ability of GST-SP1
2.3. Analysis of G4 Folding in the Presence or Absence of CpG Methylation
3. Discussion
4. Materials and Methods
4.1. Expression and Purification of GST Fused SP1
4.2. Binding Analysis of VEGF165 to VEGF G4 DNAs by SPR
4.3. Binding Analysis of SP1 to Methylated G4 DNAs by ELONA and SPR
4.4. Circular Dichroism Spectroscopy
4.5. Native-PAGE Analysis
Supplementary Materials
Author Contributions
Conflicts of Interest
References
- Burge, S.; Parkinson, G.N.; Hazel, P.; Todd, A.K.; Neidle, S. Quadruplex DNA: Sequence, topology and structure. Nucl. Acids Res. 2006, 34, 5402–5415. [Google Scholar] [CrossRef] [PubMed]
- Bhattacharyya, D.; Mirihana Arachchilage, G.; Basu, S. Metal Cations in G-Quadruplex Folding and Stability. Front. Chem. 2016, 4, 38. [Google Scholar] [CrossRef] [PubMed]
- Henderson, E.; Hardin, C.C.; Walk, S.K.; Tinoco, I., Jr.; Blackburn, E.H. Telomeric DNA oligonucleotides form novel intramolecular structures containing guanine-guanine base pairs. Cell 1987, 51, 899–908. [Google Scholar] [CrossRef]
- Wang, Y.; Patel, D.J. Solution structure of the human telomeric repeat d[AG3(T2AG3)3] G-tetraplex. Structure 1993, 1, 263–282. [Google Scholar] [CrossRef]
- Ambrus, A.; Chen, D.; Dai, J.; Bialis, T.; Jones, R.A.; Yang, D. Human telomeric sequence forms a hybrid-type intramolecular G-quadruplex structure with mixed parallel/antiparallel strands in potassium solution. Nucl. Acids Res. 2006, 34, 2723–2735. [Google Scholar] [CrossRef] [PubMed]
- Eddy, J.; Maizels, N. Gene function correlates with potential for G4 DNA formation in the human genome. Nucl. Acids Res. 2006, 34, 3887–3896. [Google Scholar] [CrossRef] [PubMed]
- Bochman, M.L.; Paeschke, K.; Zakian, V.A. DNA secondary structures: Stability and function of G-quadruplex structures. Nat. Rev. Genet. 2012, 13, 770–780. [Google Scholar] [CrossRef] [PubMed]
- Rhodes, D.; Lipps, H.J. G-quadruplexes and their regulatory roles in biology. Nucl. Acids Res. 2015, 43, 8627–8637. [Google Scholar] [CrossRef] [PubMed]
- Catasti, P.; Chen, X.; Moyzis, R.K.; Bradbury, E.M.; Gupta, G. Structure-function correlations of the insulin-linked polymorphic region. J. Mol. Biol. 1996, 264, 534–545. [Google Scholar] [CrossRef] [PubMed]
- Brooks, T.A.; Kendrick, S.; Hurley, L. Making sense of G-quadruplex and i-motif functions in oncogene promoters. FEBS J. 2010, 277, 3459–3469. [Google Scholar] [CrossRef] [PubMed]
- Onel, B.; Carver, M.; Wu, G.; Timonina, D.; Kalarn, S.; Larriva, M.; Yang, D. A New G-Quadruplex with Hairpin Loop Immediately Upstream of the Human BCL2 P1 Promoter Modulates Transcription. J. Am. Chem. Soc. 2016, 138, 2563–2570. [Google Scholar] [CrossRef] [PubMed]
- Bay, D.H.; Busch, A.; Lisdat, F.; Iida, K.; Ikebukuro, K.; Nagasawa, K.; Karube, I.; Yoshida, W. Identification of G-quadruplex structures that possess transcriptional regulating functions in the Dele and Cdc6 CpG islands. BMC Mol. Biol. 2017, 18, 17. [Google Scholar] [CrossRef] [PubMed]
- Huppert, J.L.; Balasubramanian, S. Prevalence of quadruplexes in the human genome. Nucleic Acids Res. 2005, 33, 2908–2916. [Google Scholar] [CrossRef] [PubMed]
- Todd, A.K.; Johnston, M.; Neidle, S. Highly prevalent putative quadruplex sequence motifs in human DNA. Nucleic Acids Res. 2005, 33, 2901–2907. [Google Scholar] [CrossRef] [PubMed]
- Huppert, J.L.; Balasubramanian, S. G-quadruplexes in promoters throughout the human genome. Nucl. Acids Res. 2007, 35, 406–413. [Google Scholar] [CrossRef] [PubMed]
- Iida, K.; Nakamura, T.; Yoshida, W.; Tera, M.; Nakabayashi, K.; Hata, K.; Ikebukuro, K.; Nagasawa, K. Fluorescent-ligand-mediated screening of G-quadruplex structures using a DNA microarray. Angew. Chem. 2013, 52, 12052–12055. [Google Scholar] [CrossRef] [PubMed]
- Lam, E.Y.; Beraldi, D.; Tannahill, D.; Balasubramanian, S. G-quadruplex structures are stable and detectable in human genomic DNA. Nat. Commun. 2013, 4, 1796. [Google Scholar] [CrossRef] [PubMed]
- Chambers, V.S.; Marsico, G.; Boutell, J.M.; Di Antonio, M.; Smith, G.P.; Balasubramanian, S. High-throughput sequencing of DNA G-quadruplex structures in the human genome. Nat. Biotechnol. 2015, 33, 877–881. [Google Scholar] [CrossRef] [PubMed]
- Rigo, R.; Palumbo, M.; Sissi, C. G-quadruplexes in human promoters: A challenge for therapeutic applications. Biochim. Biophys. Acta 2017, 1861, 1399–1413. [Google Scholar] [CrossRef] [PubMed]
- Yoshida, W.; Saikyo, H.; Nakabayashi, K.; Yoshioka, H.; Bay, D.H.; Iida, K.; Kawai, T.; Hata, K.; Ikebukuro, K.; Nagasawa, K.; et al. Identification of G-quadruplex clusters by high-throughput sequencing of whole-genome amplified products with a G-quadruplex ligand. Sci. Rep. 2018, 8, 3116. [Google Scholar] [CrossRef] [PubMed]
- Brazda, V.; Haronikova, L.; Liao, J.C.; Fojta, M. DNA and RNA quadruplex-binding proteins. Int. J. Mol. Sci. 2014, 15, 17493–17517. [Google Scholar] [CrossRef] [PubMed]
- Yoshida, W.; Saito, T.; Yokoyama, T.; Ferri, S.; Ikebukuro, K. Aptamer selection based on G4-forming promoter region. PLoS ONE 2013, 8, e65497. [Google Scholar] [CrossRef] [PubMed]
- Saito, T.; Yoshida, W.; Yokoyama, T.; Abe, K.; Ikebukuro, K. Identification of RNA Oligonucleotides Binding to Several Proteins from Potential G-Quadruplex Forming Regions in Transcribed Pre-mRNA. Molecules 2015, 20, 20832–20840. [Google Scholar] [CrossRef] [PubMed]
- Raiber, E.A.; Kranaster, R.; Lam, E.; Nikan, M.; Balasubramanian, S. A non-canonical DNA structure is a binding motif for the transcription factor SP1 in vitro. Nucl. Acids Res. 2012, 40, 1499–1508. [Google Scholar] [CrossRef] [PubMed]
- Beishline, K.; Azizkhan-Clifford, J. Sp1 and the ‘hallmarks of cancer’. FEBS J. 2015, 282, 224–258. [Google Scholar] [CrossRef] [PubMed]
- Wierstra, I. Sp1: Emerging roles—Beyond constitutive activation of TATA-less housekeeping genes. Biochem. Biophys. Res. Commun. 2008, 372, 1–13. [Google Scholar] [CrossRef] [PubMed]
- Vizcaino, C.; Mansilla, S.; Portugal, J. Sp1 transcription factor: A long-standing target in cancer chemotherapy. Pharmacol. Ther. 2015, 152, 111–124. [Google Scholar] [CrossRef] [PubMed]
- Gilmour, J.; Assi, S.A.; Jaegle, U.; Kulu, D.; van de Werken, H.; Clarke, D.; Westhead, D.R.; Philipsen, S.; Bonifer, C. A crucial role for the ubiquitously expressed transcription factor Sp1 at early stages of hematopoietic specification. Development 2014, 141, 2391–2401. [Google Scholar] [CrossRef] [PubMed]
- Todd, A.K.; Neidle, S. The relationship of potential G-quadruplex sequences in cis-upstream regions of the human genome to SP1-binding elements. Nucleic Acids Res. 2008, 36, 2700–2704. [Google Scholar] [CrossRef] [PubMed]
- Kumar, P.; Yadav, V.K.; Baral, A.; Kumar, P.; Saha, D.; Chowdhury, S. Zinc-finger transcription factors are associated with guanine quadruplex motifs in human, chimpanzee, mouse and rat promoters genome-wide. Nucl. Acids Res. 2011, 39, 8005–8016. [Google Scholar] [CrossRef] [PubMed]
- Li, E.; Bestor, T.H.; Jaenisch, R. Targeted mutation of the DNA methyltransferase gene results in embryonic lethality. Cell 1992, 69, 915–926. [Google Scholar] [CrossRef]
- Chen, R.Z.; Pettersson, U.; Beard, C.; Jackson-Grusby, L.; Jaenisch, R. DNA hypomethylation leads to elevated mutation rates. Nature 1998, 395, 89–93. [Google Scholar] [CrossRef] [PubMed]
- Bogdanovic, O.; Veenstra, G.J. DNA methylation and methyl-CpG binding proteins: Developmental requirements and function. Chromosoma 2009, 118, 549–565. [Google Scholar] [CrossRef] [PubMed]
- Sowers, L.C.; Shaw, B.R.; Sedwick, W.D. Base stacking and molecular polarizability: Effect of a methyl group in the 5-position of pyrimidines. Biochem. Biophys. Res. Commun. 1987, 148, 790–794. [Google Scholar] [CrossRef]
- Perez, A.; Castellazzi, C.L.; Battistini, F.; Collinet, K.; Flores, O.; Deniz, O.; Ruiz, M.L.; Torrents, D.; Eritja, R.; Soler-Lopez, M.; et al. Impact of methylation on the physical properties of DNA. Biophys. J. 2012, 102, 2140–2148. [Google Scholar] [CrossRef] [PubMed]
- Hardin, C.C.; Corregan, M.; Brown, B.A., 2nd; Frederick, L.N. Cytosine-cytosine+ base pairing stabilizes DNA quadruplexes and cytosine methylation greatly enhances the effect. Biochemistry 1993, 32, 5870–5880. [Google Scholar] [CrossRef] [PubMed]
- Fry, M.; Loeb, L.A. The fragile X syndrome d(CGG)n nucleotide repeats form a stable tetrahelical structure. Proc. Natl. Acad. Sci. USA 1994, 91, 4950–4954. [Google Scholar] [CrossRef] [PubMed]
- Zamiri, B.; Mirceta, M.; Bomsztyk, K.; Macgregor, R.B., Jr.; Pearson, C.E. Quadruplex formation by both G-rich and C-rich DNA strands of the C9orf72 (GGGGCC)8*(GGCCCC)8 repeat: Effect of CpG methylation. Nucl. Acids Res. 2015, 43, 10055–10064. [Google Scholar] [PubMed]
- Lin, J.; Hou, J.Q.; Xiang, H.D.; Yan, Y.Y.; Gu, Y.C.; Tan, J.H.; Li, D.; Gu, L.Q.; Ou, T.M.; Huang, Z.S. Stabilization of G-quadruplex DNA by C-5-methyl-cytosine in bcl-2 promoter: Implications for epigenetic regulation. Biochem. Biophys. Res. Commun. 2013, 433, 368–373. [Google Scholar] [CrossRef] [PubMed]
- Stevens, A.J.; Stuffrein-Roberts, S.; Cree, S.L.; Gibb, A.; Miller, A.L.; Doudney, K.; Aitchison, A.; Eccles, M.R.; Joyce, P.R.; Filichev, V.V.; et al. G-quadruplex structures and CpG methylation cause drop-out of the maternal allele in polymerase chain reaction amplification of the imprinted MEST gene promoter. PLoS ONE 2014, 9, e113955. [Google Scholar] [CrossRef] [PubMed]
- Yoshida, W.; Yoshioka, H.; Bay, D.H.; Iida, K.; Ikebukuro, K.; Nagasawa, K.; Karube, I. Detection of DNA Methylation of G-Quadruplex and i-Motif-Forming Sequences by Measuring the Initial Elongation Efficiency of Polymerase Chain Reaction. Anal. Chem. 2016, 88, 7101–7107. [Google Scholar] [CrossRef] [PubMed]
- Sun, D.; Guo, K.; Rusche, J.J.; Hurley, L.H. Facilitation of a structural transition in the polypurine/polypyrimidine tract within the proximal promoter region of the human VEGF gene by the presence of potassium and G-quadruplex-interactive agents. Nucl. Acids Res. 2005, 33, 6070–6080. [Google Scholar] [CrossRef] [PubMed]
- Guo, K.; Gokhale, V.; Hurley, L.H.; Sun, D. Intramolecularly folded G-quadruplex and i-motif structures in the proximal promoter of the vascular endothelial growth factor gene. Nucl. Acids Res. 2008, 36, 4598–4608. [Google Scholar] [CrossRef] [PubMed]
- Membrino, A.; Cogoi, S.; Pedersen, E.B.; Xodo, L.E. G4-DNA formation in the HRAS promoter and rational design of decoy oligonucleotides for cancer therapy. PLoS ONE 2011, 6, e24421. [Google Scholar] [CrossRef] [PubMed]
- Cogoi, S.; Shchekotikhin, A.E.; Xodo, L.E. HRAS is silenced by two neighboring G-quadruplexes and activated by MAZ, a zinc-finger transcription factor with DNA unfolding property. Nucleic Acids Res. 2014, 42, 8379–8388. [Google Scholar] [CrossRef] [PubMed]
- Platella, C.; Riccardi, C.; Montesarchio, D.; Roviello, G.N.; Musumeci, D. G-quadruplex-based aptamers against protein targets in therapy and diagnostics. Biochim. Biophys. Acta 2017, 1861, 1429–1447. [Google Scholar] [CrossRef] [PubMed]
- Gatto, B.; Palumbo, M.; Sissi, C. Nucleic acid aptamers based on the G-quadruplex structure: Therapeutic and diagnostic potential. Curr. Med. Chem. 2009, 16, 1248–1265. [Google Scholar] [CrossRef] [PubMed]
- Osawa, Y.; Ikebukuro, K.; Motoki, H.; Matsuo, T.; Horiuchi, M.; Sode, K. The simple and rapid detection of specific PCR products from bacterial genomes using Zn finger proteins. Nucl. Acids Res. 2008, 36, e68. [Google Scholar] [CrossRef] [PubMed]
- Tsukakoshi, K.; Ikuta, Y.; Abe, K.; Yoshida, W.; Iida, K.; Ma, Y.; Nagasawa, K.; Sode, K.; Ikebukuro, K. Structural regulation by a G-quadruplex ligand increases binding abilities of G-quadruplex-forming aptamers. Chem. Commun. 2016, 52, 12646–12649. [Google Scholar] [CrossRef] [PubMed]
- Dantas Machado, A.C.; Zhou, T.; Rao, S.; Goel, P.; Rastogi, C.; Lazarovici, A.; Bussemaker, H.J.; Rohs, R. Evolving insights on how cytosine methylation affects protein-DNA binding. Brief. Funct. Genom. 2015, 14, 61–73. [Google Scholar] [CrossRef] [PubMed]
- Tateishi-Karimata, H.; Ohyama, T.; Muraoka, T.; Podbevsek, P.; Wawro, A.M.; Tanaka, S.; Nakano, S.I.; Kinbara, K.; Plavec, J.; Sugimoto, N. Newly characterized interaction stabilizes DNA structure: Oligoethylene glycols stabilize G-quadruplexes CH-pi interactions. Nucl. Acids Res. 2017, 45, 7021–7030. [Google Scholar] [CrossRef] [PubMed]
- Harrington, M.A.; Jones, P.A.; Imagawa, M.; Karin, M. Cytosine methylation does not affect binding of transcription factor Sp1. Proc. Natl. Acad. Sci. USA 1988, 85, 2066–2070. [Google Scholar] [CrossRef] [PubMed]
- Holler, M.; Westin, G.; Jiricny, J.; Schaffner, W. Sp1 transcription factor binds DNA and activates transcription even when the binding site is CpG methylated. Genes Dev. 1988, 2, 1127–1135. [Google Scholar] [CrossRef] [PubMed]
- Eckhardt, F.; Lewin, J.; Cortese, R.; Rakyan, V.K.; Attwood, J.; Burger, M.; Burton, J.; Cox, T.V.; Davies, R.; Down, T.A.; et al. DNA methylation profiling of human chromosomes 6, 20 and 22. Nat. Genet. 2006, 38, 1378–1385. [Google Scholar] [CrossRef] [PubMed]
- Weber, M.; Hellmann, I.; Stadler, M.B.; Ramos, L.; Paabo, S.; Rebhan, M.; Schubeler, D. Distribution, silencing potential and evolutionary impact of promoter DNA methylation in the human genome. Nat. Genet. 2007, 39, 457–466. [Google Scholar] [CrossRef] [PubMed]
Sample Availability: Samples of the compounds (pGEX2T-SP1) are available from the authors. |






| Name | Sequence (5′–3′) |
|---|---|
| VEGF G4 | GGGGCGGGCCGGGGGCGGGG |
| c-KIT G4 | GGCGAGGAGGGGCGTGGCCGGC |
| BCL-2 G4 | CGGGCGCGGGAGGAAGGGGGCGGGAGC |
| HRAS1 G4 | TCGGGTTGCGGGCGCAGGGCACGGGCG |
| HRAS2 G4 | CGGGGCGGGGCGGGGGCGGGGGCG |
| KD (nM) | |||||
|---|---|---|---|---|---|
| VEGF G4 | c-KIT G4 | BCL-2 G4 | HRAS1 G4 | HRAS2 G4 | |
| Unmethylated | 14 | 16 | 12 | 10 | 10 |
| Methylated | 11 | 11 | 28 | 36 | 27 |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tsukakoshi, K.; Saito, S.; Yoshida, W.; Goto, S.; Ikebukuro, K. CpG Methylation Changes G-Quadruplex Structures Derived from Gene Promoters and Interaction with VEGF and SP1. Molecules 2018, 23, 944. https://doi.org/10.3390/molecules23040944
Tsukakoshi K, Saito S, Yoshida W, Goto S, Ikebukuro K. CpG Methylation Changes G-Quadruplex Structures Derived from Gene Promoters and Interaction with VEGF and SP1. Molecules. 2018; 23(4):944. https://doi.org/10.3390/molecules23040944
Chicago/Turabian StyleTsukakoshi, Kaori, Shiori Saito, Wataru Yoshida, Shinichi Goto, and Kazunori Ikebukuro. 2018. "CpG Methylation Changes G-Quadruplex Structures Derived from Gene Promoters and Interaction with VEGF and SP1" Molecules 23, no. 4: 944. https://doi.org/10.3390/molecules23040944
APA StyleTsukakoshi, K., Saito, S., Yoshida, W., Goto, S., & Ikebukuro, K. (2018). CpG Methylation Changes G-Quadruplex Structures Derived from Gene Promoters and Interaction with VEGF and SP1. Molecules, 23(4), 944. https://doi.org/10.3390/molecules23040944
