The Inhibitory Effects of Cyclodepsipeptides from the Entomopathogenic Fungus Beauveria bassiana on Myofibroblast Differentiation in A549 Alveolar Epithelial Cells
Abstract
:1. Introduction
2. Results and Discussions
2.1. The Inhibitory Effects of MeOH Extract of B. bassiana on Myofibroblast Differentiation
2.2. LC/MS-Based Isolation and Identification of Compounds 1–4
2.3. The Inhibitory Effects of Cyclodepsipeptides 1–4 on Myofibroblast Differentiation
2.4. The Inhibitory Effects of Compound 2 on Myofibroblast Differentiation
3. Materials and Methods
3.1. General Experimental Procedures
3.2. Fermentation Procedures
3.3. Extraction Procedures from Liquid Cultures
3.4. Isolation of Compounds
3.5. Cell Lines
3.6. Cell Viability
3.7. Comparative Quantitative Real-Time PCR (qPCR)
3.8. Western Blot Analysis
3.9. Statistical Analysis
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Todd, N.W.; Luzina, I.G.; Atamas, S.P. Molecular and cellular mechanisms of pulmonary fibrosis. Fibrogenesis Tissue Repair 2012, 5, 11. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Willis, B.C.; Dubois, R.M.; Borok, Z. Epithelial origin of myofibroblasts during fibrosis in the lung. Proc. Am. Thorac. Soc. 2006, 3, 377–382. [Google Scholar] [CrossRef] [PubMed]
- Hinz, B.; Phan, S.H.; Thannickal, V.J.; Galli, A.; Bochaton-Piallat, M.L.; Gabbiani, G. The myofibroblast: One function, multiple origins. Am. J. Pathol. 2007, 170, 1807–1816. [Google Scholar] [CrossRef] [PubMed]
- Hinz, B.; Phan, S.H.; Thannickal, V.J.; Prunotto, M.; Desmouliere, A.; Varga, J.; De Wever, O.; Mareel, M.; Gabbiani, G. Recent developments in myofibroblast biology: Paradigms for connective tissue remodeling. Am. J. Pathol. 2012, 180, 1340–1355. [Google Scholar] [CrossRef] [PubMed]
- Cox, T.R.; Erler, J.T. Remodeling and homeostasis of the extracellular matrix: Implications for fibrotic diseases and cancer. Dis. Model. Mech. 2011, 4, 165–178. [Google Scholar] [CrossRef] [PubMed]
- Bonnans, C.; Chou, J.; Werb, Z. Remodelling the extracellular matrix in development and disease. Nat. Rev. Mol. Cell. Biol. 2014, 15, 786–801. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Qin, X.; Evans, J.D.; Aronstein, K.A.; Murray, K.D.; Weinstock, G.M. Genome sequences of the honey bee pathogens Paenibacillus larvae and Ascosphaera apis. Insect Mol. Biol. 2006, 15, 715–718. [Google Scholar] [CrossRef] [PubMed]
- Gibson, D.M.; Donzelli, B.G.G.; Krasnoff, S.B.; Keyhani, N.O. Discovering the secondary metabolite potential encoded within entomopathogenic fungi. Nat. Prod. Rep. 2014, 31, 1287–1305. [Google Scholar] [CrossRef] [PubMed]
- Pedras, M.S.C.; Zaharia, L.I.; Ward, D.E. The destruxins: Synthesis, biosynthesis, biotransformation, and biological activity. Phytochemistry 2002, 59, 579–596. [Google Scholar] [CrossRef]
- Feng, P.; Shang, Y.; Cen, K.; Wang, C. Fungal biosynthesis of the bibenzoquinone oosporein to evade insect immunity. Proc. Natl. Acad. Sci. USA 2015, 112, 11365–11370. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wyche, T.P.; Ruzzini, A.C.; Beemelmanns, C.; Kim, K.H.; Klassen, J.L.; Cao, S.; Poulsen, M.; Bugni, T.S.; Currie, C.R.; Clardy, J. Linear peptides are the major products of a biosynthetic pathway that encodes for cyclic depsipeptides. Org. Lett. 2017, 19, 1772–1775. [Google Scholar] [CrossRef] [PubMed]
- Beemelmanns, C.; Ramadhar, T.R.; Kim, K.H.; Klassen, J.L.; Cao, S.; Wyche, T.P.; Hou, Y.; Poulsen, M.; Bugni, T.S.; Currie, C.R.; et al. Macrotermycins A–D, glycosylated macrolactams from a termite-associated Amycolatopsis sp. M39. Org. Lett. 2017, 19, 1000–1003. [Google Scholar] [CrossRef] [PubMed]
- Kang, H.R.; Lee, D.; Benndorf, R.; Jung, W.H.; Beemelmanns, C.; Kang, K.S.; Kim, K.H. Termisoflavones A–C, isoflavonoid glycosides from termite-associated Streptomyces sp. RB1. J. Nat. Prod. 2016, 79, 3072–3078. [Google Scholar] [CrossRef] [PubMed]
- Kim, K.H.; Ramadhar, T.R.; Beemelmanns, C.; Cao, S.; Poulsen, M.; Currie, C.R.; Clardy, J. Natalamycin A, an ansamycin from a termite-associated Streptomyces sp. Chem. Sci. 2014, 5, 4333–4338. [Google Scholar] [CrossRef] [PubMed]
- Xu, J.; Lamouille, S.; Derynck, R. TGF-beta-induced epithelial to mesenchymal transition. Cell Res. 2009, 19, 156–172. [Google Scholar] [CrossRef] [PubMed]
- Jegorov, A.; Sedmera, P.; Matha, V.; Simek, P.; Zhradnickova, H.; Landa, Z.; Eyal, J. Beauverolides L and La from Beauveria tenella and Paecilomyces fumosoroseus. Phytochemistry 1994, 37, 1301–1303. [Google Scholar] [CrossRef]
- Matsuda, D.; Namatame, I.; Tomoda, H.; Kobayashi, S.; Zocher, R.; Kleinkauf, H.; Omura, S. New beauveriolides produced by amino acid-supplemented fermentation of Beauveria sp. FO-6979. J. Antibiot. 2004, 57, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Chung, Y.M.; El-Shazly, M.; Chuang, D.W.; Hwang, T.L.; Asai, T.; Oshima, Y.; Ashour, M.L.; Wu, Y.C.; Chang, F.R. Suberoylanilide hydroxamic acid, a histone deacetylase inhibitor, induces the production of anti-inflammatory cyclodepsipeptides from Beauveria feline. J. Nat. Prod. 2013, 76, 1260–1266. [Google Scholar] [CrossRef] [PubMed]
- Wu, H.M.; Lin, L.P.; Xu, Q.L.; Han, W.B.; Zhang, S.; Liu, Z.W.; Mei, Y.N.; Yao, Z.J.; Tan, R.X. Nodupetide, a potent insecticide and antimicrobial from Nodulisporium sp. associated with Riptortus pedestris. Tetrahedron Lett. 2017, 58, 663–665. [Google Scholar] [CrossRef]
- Ye, X.; Anjum, K.; Song, T.; Wang, W.; Liang, Y.; Chen, M.; Huang, H.; Lian, X.Y.; Zhang, Z. Antiproliferative cyclodepsipeptides from the marine actinomycete Streptomyces sp. P11-23B downregulating the tumor metabolic enzymes of glycolysis, glutaminolysis, and lipogenesis. Phytochemistry 2017, 135, 151–159. [Google Scholar] [CrossRef] [PubMed]
- Kuranaga, T.; Enomoto, A.; Tan, H.; Fujita, K.; Wakimoto, T. Total synthesis of Theonellapeptolide Id. Org. Lett. 2017, 19, 1366–1369. [Google Scholar] [CrossRef] [PubMed]
- Kendall, R.T.; Feghali-Bostwick, C.A. Fibroblasts in fibrosis: Novel roles and mediators. Front. Pharmacol. 2014, 5, 123. [Google Scholar] [CrossRef] [PubMed]
- Baum, J.; Duffy, H.S. Fibroblasts and myofibroblasts: What are we talking about? J. Cardiovasc. Pharmacol. 2011, 57, 376–379. [Google Scholar] [CrossRef] [PubMed]
- Park, J.; Schwarzbauer, J.E. Mammary epithelial cell interactions with fibronectin stimulate epithelial-mesenchymal transition. Oncogene 2014, 33, 1649–1657. [Google Scholar] [CrossRef] [PubMed]
- Wendt, M.K.; Allington, T.M.; Schiemann, W.P. Mechanisms of the epithelial-mesenchymal transition by TGF-beta. Future Oncol. 2009, 5, 1145–1168. [Google Scholar] [CrossRef] [PubMed]
- Deshmane, S.L.; Kremlev, S.; Amini, S.; Sawaya, B.E. Monocyte chemoattractant protein-1 (MCP-1): An overview. J. Interferon Cytokine Res. 2009, 29, 313–326. [Google Scholar] [CrossRef] [PubMed]
- Lee, C.C.; Ho, H.C.; Su, Y.C.; Lee, M.S.; Hung, S.K.; Lin, C.H. MCP1-induced epithelial-mesenchymal transition in head and neck cancer by AKT activation. Anticancer Res. 2015, 35, 3299–3306. [Google Scholar] [PubMed]
- Li, S.; Lu, J.; Chen, Y.; Xiong, N.; Li, L.; Zhang, J.; Yang, H.; Wu, C.; Zeng, H.; Liu, Y. MCP-1-induced ERK/GSK-3beta/Snail signaling facilitates the epithelial-mesenchymal transition and promotes the migration of MCF-7 human breast carcinoma cells. Cell. Mol. Immunol. 2017, 14, 621–630. [Google Scholar] [CrossRef] [PubMed]
- Sakai, N.; Nakamura, M.; Lipson, K.E.; Miyake, T.; Kamikawa, Y.; Sagara, A.; Shinozaki, Y.; Kitajima, S.; Toyama, T.; Hara, A.; et al. Inhibition of CTGF ameliorates peritoneal fibrosis through suppression of fibroblast and myofibroblast accumulation and angiogenesis. Sci. Rep. 2017, 7, 5392. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sonnylal, S.; Xu, S.; Jones, H.; Tam, A.; Sreeram, V.R.; Ponticos, M.; Norman, J.; Agrawal, P.; Abraham, D.; de Crombrugghe, B. Connective tissue growth factor causes EMT-like cell fate changes in vivo and in vitro. J. Cell Sci. 2013, 126, 2164–2175. [Google Scholar] [CrossRef] [PubMed]
- Pardo, A.; Cabrera, S.; Maldonado, M.; Selman, M. Role of matrix metalloproteinases in the pathogenesis of idiopathic pulmonary fibrosis. Respir. Res. 2016, 17, 23. [Google Scholar] [CrossRef] [PubMed]
Sample Availability: Samples of the compounds are not available from the authors. |
Gene | Forward | Reverse | Size (bp) |
---|---|---|---|
CoL1A1 | GGCAACAGCCGCTTCACCTAC | GCGGGAGGACTTGGTGGTTTT | 105 |
E-cadherin | TGCCCAGAAAATGAAAAAGG | GTGTATGTGGCAATGCGTTC | 200 |
Fibronectin | CAGTGGGAGACCTCGAGAAG | TCCCTCGGAACATCAGAAAC | 168 |
MCP-1 | GTCACCTGCTGTTATAACTTC | TGCTGCTGGTGATTCTTCTA | 79 |
MMP2 | GGAAAGCCAGGATCCATTTT | ATGCCGCCTTTAACTGGAG | 103 |
CTGF | CAAGGGCCTCTTCTGTGACT | ACGTGCACTGGTACTTGCAG | 146 |
GAPDH | AATCCCATCACCATCTTCCA | TGGACTCCACGACGTACTCA | 82 |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Park, Y.J.; Lee, S.R.; Kim, D.M.; Yu, J.S.; Beemelmanns, C.; Chung, K.H.; Kim, K.H. The Inhibitory Effects of Cyclodepsipeptides from the Entomopathogenic Fungus Beauveria bassiana on Myofibroblast Differentiation in A549 Alveolar Epithelial Cells. Molecules 2018, 23, 2568. https://doi.org/10.3390/molecules23102568
Park YJ, Lee SR, Kim DM, Yu JS, Beemelmanns C, Chung KH, Kim KH. The Inhibitory Effects of Cyclodepsipeptides from the Entomopathogenic Fungus Beauveria bassiana on Myofibroblast Differentiation in A549 Alveolar Epithelial Cells. Molecules. 2018; 23(10):2568. https://doi.org/10.3390/molecules23102568
Chicago/Turabian StylePark, Yong Joo, Seoung Rak Lee, Dong Min Kim, Jae Sik Yu, Christine Beemelmanns, Kyu Hyuck Chung, and Ki Hyun Kim. 2018. "The Inhibitory Effects of Cyclodepsipeptides from the Entomopathogenic Fungus Beauveria bassiana on Myofibroblast Differentiation in A549 Alveolar Epithelial Cells" Molecules 23, no. 10: 2568. https://doi.org/10.3390/molecules23102568