Next Article in Journal
Production of Nanoemulsions from Palm-Based Tocotrienol Rich Fraction by Microfluidization
Previous Article in Journal
Synthesis, Density Functional Theory (DFT), Urease Inhibition and Antimicrobial Activities of 5-Aryl Thiophenes Bearing Sulphonylacetamide Moieties
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Molecules
Volume 20
Issue 11
10.3390/molecules201119669
molecules-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Development and Characterization of Polymorphic Microsatellite Markers for Sedum sarmentosum (Crassulaceae) and Their Cross-Species Transferability

by
Jing Xu
*,
Fu-Yuan Hou
,
Ding-Rong Wan
,
Sha Wang
,
Dong-Mei Xu
and
Guang-Zhong Yang
College of Pharmacy, South Central University for Nationalities, 708 Minyuan Road, Wuhan 430074, China
*
Author to whom correspondence should be addressed.
Molecules 2015, 20(11), 19929-19935; https://doi.org/10.3390/molecules201119669
Submission received: 17 August 2015 / Revised: 8 October 2015 / Accepted: 10 October 2015 / Published: 5 November 2015
(This article belongs to the Section Molecular Diversity)
Versions Notes

Abstract

:
Sedum sarmentosum is an important Chinese medicinal herb that exhibits anti-inflammatory, anti-angiogenic and anti-nociceptive properties. However, little is known about its genetic background. The first set of 14 microsatellite markers were isolated and characterized for S. sarmentosum using an SSR-enriched library. Fourteen polymorphic microsatellite markers were acquired with satisfactory amplifications and a polymorphic pattern in 48 S. sarmentosum individuals. The number of alleles ranged from 3 to 15. The observed and expected heterozygosities varied from 0.0833 to 0.8750 and 0.2168 to 0.9063, respectively. Two loci showed significant departure from the Hardy-Weinberg equilibrium. Cross-species amplification was carried out in other Sedum species. High rates of cross-species amplification were observed. The transferability value ranged from 85.7% in S. lineare to 64.3% in S. ellacombianum. These markers will be valuable for studying the genetic variation, population structure and germplasm characterization of S. sarmentosum and related Sedum species.

1. Introduction

The Sedum L. genus in the Crassulaceae family consists of 470 species that are distributed in the Northern Hemisphere, Africa and Latin America of Southern Hemisphere [1]. Sedum L. species are widely used in folk medicine, especially Sedum sarmentosum, which has been frequently used for the treatment of chronic hepatitis in China [2,3]. Furthermore, S. sarmentosum exhibits anti-angiogenic, anti-cancer, anti-viral and anti-nociceptive properties [4] and is attracting increasing interest from domestic and foreign pharmaceutical companies. The high demand of S. sarmentosum for medicinal uses has led to overexploitation of the wild populations, driving them close to local extinction in the wild [5]. Furthermore, the species of S. sarmentosum are difficult to identify because of the large variety and close resemblance in closely related genera. For example, it is usually morphologically confused with S. lineare [6]. Plants of the Sedum L. genus usually differ in components and activities, and therefore classification and identification of the medicinal plant species is critical to ensure quality and therapeutic efficacy. Accurate evaluation of its genetic diversity is necessary for the conservation and molecular identification of this species.
Earlier morphological and chemical composition studies have been performed for identification and classification of Sedum genus [7,8]. Allozyme markers have been used to assess the genetic relationship of two Sedum species [9]. However, little is known regarding the diversity and genetic structure of the Sedum genus. DNA markers, such as random amplified polymorphic DNA, have been established to study the genetic relationship of six Sedum species. However, the RAPD marker had limited ability to provide stable genetic relationship [10]. More reliable molecular markers are needed to enhance genetic analyses of Sedum species.
Microsatellite or simple sequence repeat (SSR) markers are considered to be effective in accessing genetic diversity and structure of plant population due to their abundance, high level of polymorphism, co-dominance, bi-parentally inheritance, and reproducibility of the results [11,12]. However, microsatellite markers have not been isolated from any Sedum species. In the absence of sequenced genomes, microsatellite-enrichment of genomic libraries has been shown to be effective at developing molecular markers for genetic studies [13,14]. In this study, the first set of genomic polymorphic microsatellite markers of S. sarmentosum have been developed using a microsatellite-enriched library and tested for transferability across five other Sedum species. The polymorphic microsatellite markers might have important implications for the identification, genetic diversity and population genetic structure of Sedum genus.

2. Results and Discussion

From the 198 colonies screened for inserts, 82 positive colonies were randomly chosen and 68 colonies were successfully sequenced, 7 colonies were duplicates. Fifty-three microsatellite motifs were discovered in 61 singleton sequences. The enrichment efficiency of microsatellites (86.9%) was higher than for Rubus coreanus at 84.5% [15], groundnut at 68% [16], and Japanese apricot at 57.0% [17]. Most of the microsatellite motifs (45, 84.9%) were dinucleotides repeats, followed by trinucleotides repeats (5, 9.4%) and repeat motifs that were tetranucleotide or greater (3, 5.7%). Among the dinucleotides repeats, the GT/TG/AC/CA motifs showed the most frequency (37, 82.2%).
38 fragments containing microsatellite motifs that showed flanking regions were used to design primers (partial results are shown in Table 1) and tested for consistency of amplification and polymorphism with 48 S. sarmentosum. After preliminary screening, 14 polymorphic microsatellite loci yielded satisfactory amplifications with a polymorphic pattern. The number of polymorphic microsatellite loci observed with respect to amplified loci in S. sarmentosum (36.8%) is higher than that obtained by enriched libraries constructed from other medicinal herb, such as the Dendrobium huoshanense (30.6%) [18], Rhodiola (25.8%) [19], and Bletilla striata (13.2%) [20]. Several factors may account for these isolation efficiency differences, including microsatellite frequency within the genome of the studied species, structure of the microsatellites and their flanking regions [21,22,23].
The genetic diversity parameters of the 14 polymorphic microsatellite loci were calculated for S. sarmentosum and summarized in Table 2. The number of alleles per locus ranged from three for locus Ssa10 to 15 for locus Ssa17 with an average of 6.9 alleles/locus. The observed heterozygosity (HO) ranged from 0.0833 to 0.8750 and the expected heterozygosity (HE) varied from 0.2168 to 0.9063. After sequential Bonferroni correction, two of the loci (Ssa10 and Ssa 60) showed significant departure from Hardy-Weinberg equilibrium (HWE), because of an excess of homozygotes. Null alleles, inbreeding, Wahlund effect, and small population size might lead to the excess of homozygotes [24,25]. The presence of null alleles at the microsatellite loci will be detected by software (e.g., MICRO-CHECKER [26]) and the effects of sample and habitat size will be determined in the future population genetic studies of S. sarmentosum. Among the 14 microsatellite loci, no significant linkage disequilibrium was identified between loci.
Table
Table 1. Characteristics of 14 polymorphic microsatellite markers isolated from S. sarmentosum.
Table 1. Characteristics of 14 polymorphic microsatellite markers isolated from S. sarmentosum.
LocusRepeat MotifPrimer Sequence (5′-3′)Ta (°C)Size (bp)GenBank Accession No.
Ssa 47(GT)5F: GGAGAAGAGAGAAGAGAGGATG55109KP742353
R: CACCGTCAAGTAATTCAGTATAAAT
Ssa 30(GT)7F: TGGGTGGATTATTGATGAGG55112KP742354
R: GCTTCCTACTCAATGCAAAACC
Ssa 92(TG)11F: TGGAGTGAGTTTTAGGTTTT5170KP742355
R: CACTGGAAGTGGTACGATAC
Ssa 46(TG)10F: AGTGAGTTTTAGGTTTTTGTGT5159KP742356
R: AAGTGGTACGATACTATTCGC
Ssa 64(TG)11F: AATGGAGTGAGTTTTAGGT5170KP742357
R: CTGGAAGTGGTACGATAC
Ssa 17(CA)7F: TCAGGCTCCATAGTAACCC57173KP742358
R: AAGTCGTGTCAGGAAGGC
Ssa 66B(CA)11F: CTGGAAGTGGTACGATAC5567KP742359
R: GGAGTGAGTTTTAGGTTTT
Ssa 56(CA)12F: TATTTCGATACTTCAATCACAC51105KP742360
R: TGTTTATTATTGACATTGAATTG
Ssa 32(CA)10F: GGAAGGAGGTTTGGTAGAT51118KP742361
R: TCATCCTGTGACCCCTGT
Ssa 10(CA)7–(CA)13F: ACTGGAAGTGGTACGATACTATT52223KP742362
R: GAAATGTGTACTTACCTTATCCA
Ssa 66A(GT)7F: GGTTGCATTGCATAGCC52234KP742363
R: AGAATCTTCTCTCCAGAGTCA
Ssa 83(GT)8F: AGGAAGGCGAATGAGTGT55153KP742364
R: AAGAAGGTGAAATGTATAGCA
Ssa 60(TGTTGTG)6F: GCTTCTTGCTGAAAGTGACA55243KP742366
R: ACGACAGGTTTCCCGACT
Ssa 90(TG)5F: AACAACAGGTTATACCACTTCG54128KP742365
R: CCACACAAACACACGCAC
Annealing temperature (Ta).
Table
Table 2. Genetic diversity of microsatellite marker for S. sarmentosum and S. lineare.
Table 2. Genetic diversity of microsatellite marker for S. sarmentosum and S. lineare.
LocusSedum sarmentosum (n = 48)Sedum lineare (n = 12)
AHOHEPHWEAHOHEPHWE
Ssa 4760.58920.58330.6073–
Ssa 3050.45830.50520.06121
Ssa 9280.64580.65160.873440.20330.29640.0312
Ssa 4660.58330.60380.98241
Ssa 64 70.64710.58820.666750.450.50180.3506
Ssa 17150.87500.90110.182370.50.60120.2021
Ssa 66B50.45120.39580.461260.45830.58210.0000
Ssa 56100.83330.90630.067260.41670.56230.0313
Ssa 3240.41670.49200.73431
Ssa 1030.08330.21680.00001
Ssa 66A80.58330.63280.1273–
Ssa 8370.54170.60270.42631
Ssa 6040.25000.43280.00031
Ssa 9090.70330.71080.623030.33330.33670.0421
Number of alleles (A), observed heterozygosity (HO), expected heterozygosity (HE), and the test for deviation from Hardy-Weinberg Equilibrium (PHWE). Values in bold represent significant deviation from Hardy-Weinberg equilibrium.
Cross-species amplification tests were performed in the S. lineare, which is morphologically close to S. sarmentosum. Twelve of the 14 microsatellite markers were amplified successfully and only six showed polymorphism in 12 S. lineare individuals (Table 2), which may result from the small size of the populations. The number of alleles per locus ranged from 3 to 7, the HO ranged from 0.2033 to 0.5000 and HE varied from 0.2964 to 0.6012 (Table 2). Among the six polymorphic microsatellite loci, only one locus (Ssa 66B) deviated significantly from HWE. This result showed that the microsatellite primers could be used in S. lineare and selective use of the primers could effectively discriminate S. sarmentosum from S. lineare.
We also applied the 14 microsatellite markers to test their transferability to other four Sedum species (S. emarginatum, S. bulbiferum, S. aizoo and S. ellacombianum, Supplementary Table). The tested SSR primer pairs displayed a high amplification frequency across the species. A total of eight (57.1%) markers successfully amplified in all the four other Sedum species. The transferability value was highest in S. emarginatum (78.6%), followed by S. bulbiferum (71.4%) and S. aizoo (71.4%) (Table 3). S. ellacombianum showed the lowest transferability, only 64.3%. Wu et al. used PAPD to study the genetic relationship of six Sedum species. The phylogenetic analysis revealed that S. sarmentosum and S. lineare had the nearest the distance and grouped in one clade, while S. ellacombianum was in another clade [10]. The transferability of the SSR markers obtained by enriched libraries was a little lower than that by sequencing, which was expected due to the conservative nature of transcribed regions [27,28,29].
Table
Table 3. Transferability of 14 microsatellite markers for the Sedum genus.
Table 3. Transferability of 14 microsatellite markers for the Sedum genus.
Sedum Species
S. sarmentosumS. lineareS. emarginatumS. bulbiferumS. aizooS. ellacombianum
(n = 12)(n = 12)(n = 3)(n = 3)(n = 3)(n = 3)
Transferability (%)10085.778.671.471.464.3

3. Experimental Section

3.1. Plant Materials and Genomic DNA Extraction

Forty-eight individuals of S. sarmentosum were collected from a single population located in Hongshan District, Wuhan, China (30°29′22′′N, 114°23′15′′E). Leaves were randomly sampled and immediately put into the plastic sealed bags with silica gel for fast drying and then stored at room temperature until use. Genomic DNA was extracted from silica-gel-dried leaves using a 2% CTAB protocol with minor modification [30]. The DNA concentration was determined using an ultraviolet-visible spectrophotometer (ND-1000; NanoDrop, Wilmington, DE, USA). The final concentration of each DNA sample was adjusted to 20 ng/µL in TE buffer and kept at −30 °C until use.

3.2. Construction of an SSR-Enriched Library and Primer Design

DNA was digested using the restriction enzyme MseI (Promega, Madison, WI, USA) and the digested DNA was ligated to a double-strand linker by T4 DNA ligase (TaKaRa, Dalian, China). Then linker-ligated DNA was amplified by 17 cycles of pre-hybridization polymerase chain reaction (PCR) using one strand of the linker as primer. The enriched DNA fragments were denatured and hybridized to biotinylated probes (AC)15 followed by incubation with Streptavidin MagneSphere Paramagnetic Particles (Promega, Madison, WI, USA). The captured DNA fragments were used as templates for 33 cycles of PCR amplification using an adaptor as primers. Following amplification, DNA fragments were size-selected (200 to 1000 bp) and purified on agarose gels. The fragments were ligated to pMD18-T vectors and transformed into Escherichia coli DH5a competent cells to construct an enriched microsatellite library. Recombinant colonies, identified as white colonies on an LB plate containing ampicillin were screened for inserts using M13 primers and we randomly chose 82 positive colonies to sequence. Tandem Repeats Finder [31] was used to identify the SSR motif and Primer Premier 5.0 software [32] was used to design primers flanking the tandem repeat region in the sequence.

3.3. Amplification of SSR, Polymorphism Detection and Data Analysis

The M13-tailed primer method, in which the M13 sequence is attached to the 5′-end of the forward primer, was used to determine the sizes of the amplified products [33]. Microsatellite amplification conditions consisted of 20 µL PCR reaction volumes, which containing 50 ng of genomic DNA, 0.2 mM of each dNTP, 1X Taq polymerase buffer (containing 1.5 mM MgCl2), 2 pmol of M13-tailed-forward primer, 4 pmol of the fluorescently labeled M13 universal primer (5′-TGT AAA ACG GCC AGT-3′), 6 pmol of a normal reverse primer, and 1 U of DNA Polymerase (Takara, Dalian, China). The temperature profile was as follows: 5 min initial denaturation at 95 °C, followed by 34 cycles of denaturation at 94 °C for 30 s, annealing at 51–57 °C for 30 s, extension at 72 °C for 1 min and the final extension step of 7 min at 72 °C. The PCR products were electrophoresed on an ABI 3730 genetic analyzer and allele sizes were determined using GeneMapper v4.0 software (Applied Biosystems). The number of alleles per locus (A) and observed (HO) and expected (HE) levels of heterozygosity were calculated using the Arlequin program Version 3.5 [34]. Hardy-Weinberg Equilibrium (HWE) and linkage disequilibrium (LD) was tested using the GENEPOP program Version 4.0 [35].

3.4. Detection of the Transferability of SSR Primers and Date Analysis

Cross-species amplification tests were performed in randomly selected S. lineare (n = 12), S. emarginatum (n = 3), S. bulbiferum (n = 3), S. aizoo (n = 3), and S. ellacombianum (n = 3). The PCR conditions of each loci and the calculation of the genetic diversity parameters were the same as described earlier.

4. Conclusions

This is the first set of microsatellite markers developed for S. sarmentosum, an important Chinese medicinal herb. A total of 14 polymorphic SSR markers were ultimately screened and proved in S. sarmentosum. The SSR primer pairs displayed a high amplification frequency across Sedum species. These markers will be valuable for studying the genetic variation, population structure and germplasm characterization of S. sarmentosum and related Sedum species and aid in the development of conservation practices for S. sarmentosum.

Supplementary Materials

Supplementary materials can be accessed at: https://www.mdpi.com/1420-3049/20/11/19669/s1.

Acknowledgments

The study was supported by the National Natural Science Foundation of China (Grant: 31302172), Universities of Hubei Province Outstanding Youth Scientific Innovation Team Plan (Grant: T201220), and Hubei Engineering Technology Center of National Medicine Modernization (Grant: 2015ZY004).

Author Contributions

Jing Xu, Ding-Rong Wan and Guang-Zhong Yang conceived and designed the experiments; Fu-Yuan Hou, Sha Wang and Dong-Mei Xu performed the experiments; Guang-Zhong Yang analyzed the data; Jing Xu wrote the manuscript. All authors read and approved the manuscript.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Wang, D.R. A Survey of “Chuipencao” and the other ethnomedicines from the same genus (Sedum L.). Lishizhen Med. Mat. Med. Res. 2007, 18, 1853–1855. [Google Scholar]
  2. Wu, X.N. Update therapy of chronic hepatitis B in China: Recent progress. China Natl. J. New Gas. 1996, 2, 65–68. [Google Scholar]
  3. Kang, T.H.; Pae, H.O.; Yoo, J.C.; Kim, N.Y.; Kim, Y.C.; Ko, G.I.; Chung, H.T. Antiproliferative effects of alkaloids from Sedum sarmentosum on murine and human hepatoma cell lines. J. Ethnopharmacol. 2000, 70, 177–182. [Google Scholar] [CrossRef]
  4. Jung, H.J.; Kang, H.J.; Song, Y.S.; Park, E.H.; Kim, Y.M.; Lim, C.J. Anti-inflammatory, anti-angiogenic and anti-nociceptive activities of Sedum sarmentosum extract. J. Ethnopharmacol. 2008, 116, 138–143. [Google Scholar] [CrossRef] [PubMed]
  5. Liu, M.Z.; Luo, K.; Yao, H.; Liu, P. Authentication of sedum sarmentosum and its adulterants by application of ITS2 sequences. Mod. Chin. Med. 2011, 13, 29–31. [Google Scholar]
  6. Xie, D.M.; Huang, L.Q.; Qin, M.J.; Wang, D.Q.; Jiang, C.; Yuan, Y. AS-PCR amplification in identification of Sedum sarmentosum with its relative species. J. Chin. Med. Mat. 2014, 37, 1768–1772. [Google Scholar]
  7. Wu, F.X. Authentication of Sedum sarmentosum and its adulterants. Yunnan J. Tradit. Chin. Med. Mater. Med. 2008, 29. [Google Scholar] [CrossRef]
  8. Lu, L.Q.; Mei, Q.; Wan, D.R.; Yang, X.Z.; Qiao, S.; Zhao, Y.D. HPLC characteristic fingerprints of sedi linearis herba and sedi herba. J. Chin. Med. Mat. 2014, 37, 583–587. [Google Scholar]
  9. Chung, M.Y.; López-Pujol, J.; Chung, M.G. Comparative genetic structure between Sedum ussuriense and Sedum kamtschaticum (Crassulaceae), two stonecrops co-occurring on rocky cliffs. Am. J. Bot. 2014, 101, 946–956. [Google Scholar] [CrossRef] [PubMed]
  10. Wu, H.J.; Xu, R.; Wan, D.R.; Chen, Y. Genetic diversity analysis on the medicinal plants of Sedum L. by RAPD. J. Huazhong Agric. Univ. 2008, 27, 782–786. [Google Scholar]
  11. Varshney, R.K.; Graner, A.; Sorrells, M.E. Genic microsatellite markers: Features and applications. Trends Biotechnol. 2005, 23, 48–55. [Google Scholar] [CrossRef] [PubMed]
  12. Sharma, P.C.; Grover, A.; Kahl, G. Mining microsatellites in eukaryotic genomes. Trends Biotechnol. 2007, 25, 490–498. [Google Scholar] [CrossRef] [PubMed]
  13. Glenn, T.C.; Schable, N.A. Isolating microsatellite DNA loci. Method Enzymol. 2005, 395, 202–222. [Google Scholar]
  14. Techen, N.; Arias, R.S.; Pan, Z.; Khan, I.A.; Scheffler, B.E. Optimized construction of microsatellite-enriched libraries. Mol. Ecol. Res. 2010, 10, 508–515. [Google Scholar] [CrossRef] [PubMed]
  15. Lee, G.A.; Song, J.Y.; Choi, H.R.; Chung, J.W.; Jeon, Y.A.; Lee, J.R.; Ma, K.H.; Lee, M.C. Novel microsatellite markers acquired from Rubus coreanus Miq. and cross-amplification in other Rubus species. Molecules 2015, 20, 6432–6442. [Google Scholar] [CrossRef] [PubMed]
  16. Cuc, L.M.; Mace, E.S.; Crouch, J.H.; Quang, V.D.; Long, T.D.; Varshney, R.K. Isolation and characterization of novel microsatellite markers and their application for diversity assessment in cultivated groundnut (Arachis hypogaea). BMC Plant Biol. 2008, 8. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  17. Kwon, S.W.; Chung, J.W.; Park, J.W.; Lee, G.A.; Ma, K.H.; Lee, M.C.; Park, Y.J. Microsatellite variations and population structure in an on-farm collection of Japanese apricot (Prunus mume Sieb. et Zucc.). Biochem. Syst. Ecol. 2012, 42, 99–112. [Google Scholar] [CrossRef]
  18. Wang, H.; Chen, N.F.; Zheng, J.Y.; Wang, W.C.; Pei, Y.Y.; Zhu, G.P. Isolation and characterization of eleven polymorphic microsatellite loci for the valuable medicinal plant Dendrobium huoshanense and cross-species amplification. Int. J. Mol. Sci. 2012, 13, 16779–16784. [Google Scholar] [CrossRef] [PubMed]
  19. You, J.L.; Liu, W.S.; Zhao, Y.; Zhu, Y.Q.; Zhang, W.J.; Wang, Y.G.; Lu, F.; Song, Z.P. Microsatellite markers in Rhodiola (Crassulaceae), a medicinal herb genus widely used in traditional Chinese medicine. Appl. Plant Sci. 2013, 1. [Google Scholar] [CrossRef]
  20. Zhang, Y.S.; Hou, B.W.; Zhang, W.M.; Ding, X.Y. Isolation and characterization of novel microsatellite markers for Bletilla striata and inter-specific amplification in 2 congeneric species. Conserv. Genet. Resour. 2015, 7, 483–485. [Google Scholar] [CrossRef]
  21. Nève, G.; Meglécz, E. Microsatellite frequencies in different taxa. Trends Ecol. Evol. 2000, 15, 376–377. [Google Scholar] [CrossRef]
  22. Meglécz, E.; Petenian, F.; Danchin, E.; Coeur d’Acier, A.; Rasplus, J.Y.; Faure, E. High similarity between flanking regions of different microsatellites detected within each of two species of Lepidoptera: Parnassius apollo and Euphydryas aurinia. Mol. Ecol. 2004, 13, 1693–1700. [Google Scholar] [CrossRef] [PubMed]
  23. Nantón, A.; Arias-Pérez, A.; Méndez, J.; Freire, R. Characterization of nineteen microsatellite markers and development of multiplex PCRs for the wedge clam Donax trunculus (Mollusca: Bivalvia). Mol. Biol. Rep. 2014, 41, 5351–5357. [Google Scholar] [CrossRef] [PubMed]
  24. Geng, Q.F.; Liu, J.; Sun, L.; Liu, H.; Ou-Yang, Y.; Cai, Y.; Tang, X.S.; Zhang, H.W.; Wang, Z.S.; An, S.Q. Development and characterization of polymorphic microsatellite markers (SSRs) for an endemic plant, Pseudolarix amabilis (Nelson) Rehd. (Pinaceae). Molecules 2015, 20, 2685–2692. [Google Scholar] [CrossRef] [PubMed]
  25. Zouros, E.; Foltz, D.W. Possible explanations of heterozygote deficiency in Bivalve mollusks. Malacologia 1984, 25, 583–591. [Google Scholar]
  26. Chapuis, M.P.; Estoup, A. Microsatellite null alleles and estimation of population differentiation. Mol. Biol. Evol. 2007, 24, 621–631. [Google Scholar] [CrossRef] [PubMed]
  27. Chen, X.B.; Xie, Y.H.; Sun, X.M. Development and characterization of polymorphic Genic-SSR markers in Larix kaempferi. Molecules 2015, 20, 6060–6067. [Google Scholar] [CrossRef] [PubMed]
  28. Wu, J.; Cai, C.F.; Cheng, F.Y.; Cui, H.L.; Zhou, H. Characterisations and development of EST-SSR markers in tree peony using transcriptome sequences. Mol. Breed. 2014, 34, 1853–1866. [Google Scholar] [CrossRef]
  29. Wang, H.X.; Walla, J.A.; Zhong, S.B.; Huang, D.Q.; Dai, W.H. Development and cross-species/genera transferability of microsatellite markers discovered using 454 genome sequencing in chokecherry (Prunus virginiana L.). Plant Cell Rep. 2012, 31, 2047–2055. [Google Scholar] [CrossRef] [PubMed]
  30. Lian, C.L.; Hogetsu, T.; Matsushita, N.; Guerin-Laguette, A.; Suzuki, K.; Yamada, A. Development of microsatellite markers from an ectomycorrhizal fungus, Tricholoma matsutake, by an ISSR-suppression-PCR method. Mycorrhiza 2003, 13, 27–31. [Google Scholar] [CrossRef] [PubMed]
  31. Benson, G. Tandem repeats finder: A program to analyze DNA sequences. Nucleic Acids Res. 1999, 27, 573–580. [Google Scholar] [CrossRef] [PubMed]
  32. Abd-Elsalam, K.A. Bioinformatic tools and guideline for PCR primer design. Afr. J. Biotechnol. 2003, 2, 91–95. [Google Scholar] [CrossRef]
  33. Schuelke, M. An economic method for the fluorescent labeling of PCR fragments. Nat. Biotechnol. 2000, 18, 233–234. [Google Scholar] [CrossRef] [PubMed]
  34. Excoffier, L.; Lischer, H.E.L. Arlequin suite ver 3.5: A new series of programs to perform population genetics analyses under Linux and Windows. Mol. Ecol. Resour. 2010, 10, 564–567. [Google Scholar] [CrossRef] [PubMed]
  35. Raymond, M.; Rousset, F. GENEPOP (version 1.2): Population genetics software for exact tests and ecumenicism. J. Hered. 1995, 86, 248–249. [Google Scholar]
  • Sample Availability: Samples are available from the authors.

Share and Cite

MDPI and ACS Style

Xu, J.; Hou, F.-Y.; Wan, D.-R.; Wang, S.; Xu, D.-M.; Yang, G.-Z. Development and Characterization of Polymorphic Microsatellite Markers for Sedum sarmentosum (Crassulaceae) and Their Cross-Species Transferability. Molecules 2015, 20, 19929-19935. https://doi.org/10.3390/molecules201119669

AMA Style

Xu J, Hou F-Y, Wan D-R, Wang S, Xu D-M, Yang G-Z. Development and Characterization of Polymorphic Microsatellite Markers for Sedum sarmentosum (Crassulaceae) and Their Cross-Species Transferability. Molecules. 2015; 20(11):19929-19935. https://doi.org/10.3390/molecules201119669

Chicago/Turabian Style

Xu, Jing, Fu-Yuan Hou, Ding-Rong Wan, Sha Wang, Dong-Mei Xu, and Guang-Zhong Yang. 2015. "Development and Characterization of Polymorphic Microsatellite Markers for Sedum sarmentosum (Crassulaceae) and Their Cross-Species Transferability" Molecules 20, no. 11: 19929-19935. https://doi.org/10.3390/molecules201119669

Article Metrics

Back to TopTop