RNA Interference of 1-Aminocyclopropane-1-carboxylic Acid Oxidase (ACO1 and ACO2) Genes Expression Prolongs the Shelf Life of Eksotika (Carica papaya L.) Papaya Fruit
Abstract
:1. Introduction
2. Results and Discussion
2.1. Development of RNAi Constructs Using Gateway Technology
Construct | Total Number of Callus Transformed | Number of Putative Transgenic Lines Obtained | PCR Positive for nptII | PCR Positive for gusA and PDK Intron | PCR Positive for Gene of Interest | Number of Regenerated Putative Transgenic Plants |
---|---|---|---|---|---|---|
pRNAiACO1 | 5,000 | 80 | 68 | 68 | 68 | 68 |
pRNAiACO2 | 5,000 | 30 | 26 | 26 | 26 | 26 |
pRNAiCACO | 5,000 | 66 | 54 | 54 | 54 | 54 |
Total | 15,000 | 1.17% (of total calli transformed) | 0.99% (of total calli transformed) | 0.99% (of total calli transformed) | 0.99% (of total calli transformed) | 100% (of total positive putative transgenic lines obtained) |
2.2. Agrobacterium Transformation and PCR Analysis
2.3. Gene Expression Analysis
2.4. Field Evaluation and Fruit Analysis
3. Experimental Section
3.1. Development of RNA Interference (RNAi) Constructs
Primer | Orientation | Sequence (5'-3') | Length (bp) | Amplicon size (bp) |
---|---|---|---|---|
pRNAiACO1 | Sense | cttctttctacaaccccagc | 20 | 350 |
Antisense | gacaccgttttcccacact | 19 | ||
pRNAiACO2 | Sense | tctactgtaactcctggtgc | 20 | 317 |
Antisense | caccaaaggccactagacag | 20 | ||
pRNAiCACO | Sense | atgaaggagtttgcagtggg | 20 | 341 |
Antisense | ccgttagtaatcagctcaag | 20 |
3.2. Papaya Transformation and Regeneration
3.3. Analysis of RNAi Transgenic Plants
Name | Sequence (5'-3') | Length (bp) | Amplicon Size (bp) |
---|---|---|---|
nptIIF | ccttatccgcaacttctttacc | 22 | 610 |
nptIIR | caccatgatattcggcaagcag | 22 | |
gusAF | catggtacgtcctgtagaaacc | 22 | 1711 |
gusAR | gaagatccctttcttgttaccg | 22 | |
PDK IntronF | ttcccaactgtaatcaatcc | 20 | 622 |
PDK IntronR | tgacaagtgatgtgtaagac | 20 | |
pRNAiACO1F | cttctttctacaaccccagc | 20 | 350 |
pRNAiACO1R | gacaccgttttcccacact | 19 | |
pRNAiACO2F | tctactgtaactcctggtgc | 20 | 317 |
pRNAiACO2R | caccaaaggccactagacag | 20 | |
pRNAiCACOF | atgaaggagtttgcagtggg | 20 | 341 |
pRNAiCACOR | ccgttagtaatcagctcaag | 20 |
3.4. Determination of the Effect of Dexamethasone on RNAi Transgenic Papaya
3.5. Field Evaluation and Fruit Analysis
4. Conclusions
Acknowledgments
Author Contributions
Conflicts of Interest
References and Notes
- Abeles, F.B.; Morgan, P.W.; Saltveit, M.E., Jr. Ethylene in Plant Biology, 2nd ed.; Academic Press: San Diego, CA, USA, 1992. [Google Scholar]
- Andersen, S.U.; Cvitanich, C.; Hougaard, B.K.; Roussis, A.; Gronlund, M.; Jensen, D.B.; Frokjaer, L.A.; Jensen, E.O. The glucocorticoid-inducible GVG system causes severe growth defects in both root and shoot of the model legume Lotus japonicus. Mol. Plant Microbe Interact. 2003, 16, 1069–1076. [Google Scholar] [CrossRef]
- Barton, G.M.; Medzhitov, R. Retroviral delivery of small interfering RNA into primary cells. Proc. Natl. Acad. Sci. USA 2002, 99, 14943–14948. [Google Scholar] [CrossRef]
- Brian, M. K.; Mark, G.T.; Harry, J.K. Fruit-specific suppression of the ethylene receptor LeETR4 results in early-ripening tomato fruit. Plant Biotech. J. 2008, 6, 295–300. [Google Scholar] [CrossRef]
- Chan, Y.K. Backcross method in improvement of papaya (Carica papaya L.). Malays. Appl. Biol. 1987, 16, 95–100. [Google Scholar]
- Christina, R.; Martin, M.H.; Wenli, Z.; Dirk, M.N.; Anja, E. RNAi suppressor P19 can be broadly exploited for enhanced adenovirus replication and microRNA knockdown experiments. Sci. Rep. 2013, 3. [Google Scholar] [CrossRef]
- Craft, J.; Samalova, M.; Baroux, C.; Townley, H.; Martinez, A.; Jepson, I.; Tsiantis, M.; Moore, I. New pOp/LhG4 vectors for stringent glucocorticoid-dependent transgene expression in Arabidopsis. Plant J. 2005, 41, 899–918. [Google Scholar] [CrossRef]
- Day, C.D.; Lee, E.; Kobayashi, J.; Holappa, L.D.; Albert, H.; Ow, D.W. Transgene integration into the same chromosome location can produce alleles that express at a predictable level, or alleles that are differentially silenced. Genes Dev. 2000, 14, 2869–2880. [Google Scholar]
- De Fossard, R.; Myint, A.; Lee, E.A. Broad spectrum tissue culture experiment with tobacco (Nicotiana tabacum L.) pith tissue callus. Plant Physiol. 1974, 31, 125–130. [Google Scholar] [CrossRef]
- Elio, G.W.M.; Schijlen, C.H.; Ric, D.V.; Stefan, M.; Harry, H.; Jonker, F.M.; Rosin, J.W.; Molthoff, Y.M.; Tikunov, G.C.; Angenent, A.J.; et al. RNA interference silencing of chalcone synthase, the first step in the flavonoid biosynthesis pathway, leads to parthenocarpic tomato fruits. Plant Physiol. 2007, 144, 1520–1530. [Google Scholar] [CrossRef]
- Kooter, J.M.; Matzke, M.A.; Meyer, P. Listening to the silent genes: Transgene silencing, gene regulation and pathogen control. Trends Plant Sci. 1999, 4, 340–347. [Google Scholar] [CrossRef]
- Kuderova, A.; Urbankova, I.; Valkova, M.; Malbeck, J.; Brzobohaty, B.; Nemethova, D.; Hejatko, J. Effects of conditional IPT-dependent cytokinin overproduction on root architecture of Arabidopsis seedlings. Plant Cell Phys. 2008, 49, 570–582. [Google Scholar] [CrossRef]
- Li, J.; Jiang, D.; Zhou, H.; Li, F.; Yang, J. Expression of RNA-interference/antisense transgenes by the cognate promoters of target genes is a better gene-silencing strategy to study gene functions in rice. PLoS One 2011, 6, e17444. [Google Scholar]
- Marketa, S.; Bretislav, B.; Ian, M. pOp/lhGR: A stringently regulated and highly responsive dexamethasone-inducible gene expression system for tobacco. Plant J. 2005, 41, 919–935. [Google Scholar] [CrossRef]
- Matzke, A.J.; Matzke, M.A. Position effects and epigenetic silencing of plant transgenes. Curr. Opin. Plant Biol. 1998, 1, 142–148. [Google Scholar] [CrossRef]
- Mazumder, B.; Seshadri, V.; Fox, P.L. Translational control by the 3′-UTR: The ends specify the means. Trends Biochem. Sci. 2003, 28, 91–98. [Google Scholar] [CrossRef]
- Mohamad Salleh, P.; Pauziah, M.; Ahmad Tarmizi, S.; Zaipun, M.Z. Quality of papaya in modified atmosphere packages under simulated storage condition for export by sea. J. Trop. Agric. Food Sci. 2007, 35, 71–77. [Google Scholar]
- Miki, D.; Itoh, R.; Shimamoto, K. RNA silencing of single and multiple members in a gene family of rice. Plant Physiol. 2005, 138, 1903–1913. [Google Scholar] [CrossRef]
- Murashige, T.; Skoog, F. A revised medium for rapid growth and bioassay with tobacco tissue culture. Plant Physiol. 1962, 15, 473–497. [Google Scholar] [CrossRef]
- Napoli, C.; Lemieux, C.; Jorgensen, R. Introduction of chimeric chalcone synthase gene into petunia results in reversible co-suppression of homologous genes in trans. Plant Cell 1990, 2, 279–289. [Google Scholar] [CrossRef]
- Ouwerker, P.B.F.; de Kam, R.J.; Hodge, J.H.C.; Meijer, A.H. Glucocorticoid-inducible gene expression in rice. Planta 2001, 213, 370–378. [Google Scholar] [CrossRef]
- Rothermel, A.; Volpert, K.; Burghardt, M.; Lantzsch, C.; Robitzki, A.A.; Layer, P.G. Knockdown of GFR_4 expression by RNA interference affects the development of retinal cell types in three-dimensional histiotypic retinal spheres. Invest. Ophthalmol. Vis. Sci. 2006, 47, 2716–2725. [Google Scholar] [CrossRef]
- Sew, Y.S.; Lam, P.F.; Abu Bakar, U.K. Nucleotide sequence of a cDNA (CP-ACO2EI) encoding ACC oxidase from ripe Eksotika-1 papaya fruit. EMBL 2004. Accession number AJS51239.
- Sew, Y.S.; Lam, P.F.; Abu Bakar, U.K. lsolation and Cloning of l-Aminocyclopropane-l- Carboxylate Oxidases From Carica papaya var. Eksotika I and Eksotika ll. Acta Hortic. 2007, 740, 153–162. [Google Scholar]
- Vilasini, P.; Latipah, Z.; Salasiah, A. Induction of somatic embryogenesis and plant regeneration from immature embryos of Eksotika papaya (Carica papaya L.). J. Trop. Agric. Food Sci. 2000, 28, 121–126. [Google Scholar]
- Wang, D.; Kennedy, S.; Conte, D., Jr.; Kim, J.K.; Gabel, H.W.; Kamath, R.S.; Mello, C.C.; Ruvkun, G. Somatic misexpression of germ line P granules and enhanced RNA interference in retinoblastoma pathway mutants. Nature 2005, 436, 593–597. [Google Scholar] [CrossRef]
- Yang, S.F.; Hoffman, N.E. Ethylene biosynthesis and its regulation in higher plants. Ann. Rev. Plant Physiol. 1984, 35, 155–189. [Google Scholar] [CrossRef]
- Zhai, Z.Y.; Thanwalee, S.N.; Olena, K.V. Establishing RNA interference as a reverse-genetic approach for gene functional analysis in protoplasts. Plant Physiolol. 2009, 149, 642–652. [Google Scholar]
- Sample Availability: Not available.
© 2014 by the authors. licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution license ( http://creativecommons.org/licenses/by/3.0/).
Share and Cite
Sekeli, R.; Abdullah, J.O.; Namasivayam, P.; Muda, P.; Bakar, U.K.A.; Yeong, W.C.; Pillai, V. RNA Interference of 1-Aminocyclopropane-1-carboxylic Acid Oxidase (ACO1 and ACO2) Genes Expression Prolongs the Shelf Life of Eksotika (Carica papaya L.) Papaya Fruit. Molecules 2014, 19, 8350-8362. https://doi.org/10.3390/molecules19068350
Sekeli R, Abdullah JO, Namasivayam P, Muda P, Bakar UKA, Yeong WC, Pillai V. RNA Interference of 1-Aminocyclopropane-1-carboxylic Acid Oxidase (ACO1 and ACO2) Genes Expression Prolongs the Shelf Life of Eksotika (Carica papaya L.) Papaya Fruit. Molecules. 2014; 19(6):8350-8362. https://doi.org/10.3390/molecules19068350
Chicago/Turabian StyleSekeli, Rogayah, Janna Ong Abdullah, Parameswari Namasivayam, Pauziah Muda, Umi Kalsom Abu Bakar, Wee Chien Yeong, and Vilasini Pillai. 2014. "RNA Interference of 1-Aminocyclopropane-1-carboxylic Acid Oxidase (ACO1 and ACO2) Genes Expression Prolongs the Shelf Life of Eksotika (Carica papaya L.) Papaya Fruit" Molecules 19, no. 6: 8350-8362. https://doi.org/10.3390/molecules19068350
APA StyleSekeli, R., Abdullah, J. O., Namasivayam, P., Muda, P., Bakar, U. K. A., Yeong, W. C., & Pillai, V. (2014). RNA Interference of 1-Aminocyclopropane-1-carboxylic Acid Oxidase (ACO1 and ACO2) Genes Expression Prolongs the Shelf Life of Eksotika (Carica papaya L.) Papaya Fruit. Molecules, 19(6), 8350-8362. https://doi.org/10.3390/molecules19068350