Isolation and Characterization of Microsatellite Markers for Cotinus coggygria Scop. (Anacardiaceae) by 454 Pyrosequencing
Abstract
:1. Introduction
2. Results and Discussion
3. Experimental Section
3.1. Isolation of Microsatellite Markers
3.2. PCR Amplification and Genotyping
| Primer | Primer sequence (5’-3’) | Repeat motif | Ta (°C ) | Allele Size (bp) | A | HE | HO | FIS | GenBank Accession No. |
|---|---|---|---|---|---|---|---|---|---|
| Cc004 | F:CCCCATTAGCTCACTCTCCAR:CGTTCCTATGGGTTCCTCAA | (CTC)7 | 52 | 350–381 | 3 | 0.301 | 0.333 | −0.114 | KJ398949 |
| Cc012 | F:AGCAGTGAAGAGCCAACTCCR:AGCTTGCAAAGAATGGGGTA | (TA)7 | 56 | 347–363 | 3 | 0.420 | 0.500 | −0.200 | KJ398957 |
| Cc024 | F:GCCCCACCAAGCAATAAAATR:TTCATGGCTCCTCCTTCTTC | (AT)6 | 56 | 399–409 | 4 | 0.685 | 0.667 | 0.028 | KJ398969 |
| Cc025 | F:CCAAACACCTTTGGGTCTGTR:GGGGAAATGAAACAAGGGTT | (TCT)6 | 54 | 123–147 | 5 | 0.651 | 0.667 | −0.026 | KJ398970 |
| Cc026 | F:TGCGCAAACTAATCCAAACAR:TTTCCGCAATAACACACCAA | (ATTT)5 | 52 | 246–266 | 2 | 0.290 | 0.333 | −0.158 | KJ398971 |
| Cc032 | F:GGATCAATTTGACCATCATATTCCR:CGGGATTGAGATTGGATTGT | (AT)6 | 50 | 333–353 | 3 | 0.518 | 0.750 | −0.478 | KJ398977 |
| Cc040 | F:ACCCTAACCCAAACCCAAACR:ATCGGAAACAACCTCCCTTT | (GAG)6 | 58 | 210–216 | 3 | 0.163 | 0.167 | −0.023 | KJ398985 |
| Cc047 | F:AATATCATCCTCCAGCGACGR:TGTTCAGATTCACGGCTGAG | (TTC)9 | 52 | 224–242 | 5 | 0.743 | 0.583 | 0.222 | KJ398992 |
| Primer | Wuzhi Mountain ( N = 6) | Tianlong Mountain ( N = 6) | ||||||
|---|---|---|---|---|---|---|---|---|
| A | HE | HO | FIS | A | HE | HO | FIS | |
| Cc004 | 2 | 0.303 | 0.333 | −0.111 | 3 | 0.318 | 0.333 | −0.053 |
| Cc012 | 3 | 0.439 | 0.500 | −0.154 | 3 | 0.439 | 0.500 | −0.154 |
| Cc024 | 4 | 0.803 | 0.500 | 0.400 | 2 | 0.530 | 0.833 | −0.667 |
| Cc025 | 3 | 0.537 | 0.333 | 0.407 | 5 | 0.788 | 1.000 | −0.304 |
| Cc026 | 2 | 0.409 | 0.500 | −0.250 | 2 | 0.167 | 0.167 | _ |
| Cc032 | 2 | 0.530 | 0.833 | −0.667 | 3 | 0.530 | 0.667 | −0.290 |
| Cc040 | 3 | 0.318 | 0.333 | −0.053 | 1 | 0 | 0 | _ |
| Cc047 | 2 | 0.409 | 0.500 | −0.250 | 4 | 0.742 | 0.667 | 0.111 |
3.3. Data Analysis
4. Conclusions
Acknowledgments
Author Contributions
Conflictts of Interest
References
- Wang, W.; Tian, C.Y.; Li, Y.H.; Li, Y. Molecular data and ecological niche modeling reveal phylogeographical pattern of Cotinus coggygria (Anacardiaceae) in China’s warm-temperate zone. Plant Biol. 2014, in press. [Google Scholar]
- Zhao, F.Y. Plants for Soil and Water Conservation; China Forestry Press: Beijing, China, 2005. [Google Scholar]
- Mao, Y.M.; Li, L.G. Landscapingtreasures-Cotinus coggygria Scop. Spec. Econ. Anim. Plant 2004, 6, 35–36. [Google Scholar]
- Marèetiæ, M.; Božiæ, D.; Milenkoviæ, M.; Maleševiæ, N.; Raduloviæ, S.; Kovaèeviæ, N. Antimicrobial, antioxidant and anti-inflammatory activity of young shoots of the smoke tree, Cotinus coggygria Scop. Phytother. Res. 2013, 27, 1658–1663. [Google Scholar] [CrossRef]
- Matiæ, S.; Staniæ, S.; Bogojeviæ, D.; Vidakoviæ, M.; Grdoviæ, N.; Diniæ, S.; Solujiæ, S.; Mladenoviæ, M.; Stankoviæ, N.; Mihailoviæ, M. Methanol extract from the stem of Cotinus coggygria Scop., and its major bioactive phytochemical constituent myricetin modulate pyrogallol-induced DNA damage and liver injury. Mutat. Res. 2013, 755, 81–89. [Google Scholar] [CrossRef]
- Li, Y.; Zhao, H.X.; Duan, B.L.; Korpelainen, H.; Li, C.Y. Effect of drought and ABA on growth, photosynthesis and antioxidant system of Cotinus coggygria seedlings under two different light conditions. Environ. Exp. Bot. 2011, 71, 107–113. [Google Scholar] [CrossRef]
- Olmez, Z.; Gokturk, A.; Karasah, B.; Yilmaz, H. Effects of cold stratification and sulphuric acid pretreatments on germination of three provenances of smoke-tree (Cotinus coggygria Scop.) seeds in greenhouse and laboratory conditions. Afr. J. Biotechnol. 2009, 8, 4964–4968. [Google Scholar]
- Jarne, P.; Lagoda, P.J.L. Microsatellites, from molecules to populations and back. Tree 1996, 11, 424–429. [Google Scholar]
- Li, Y.C.; Korol, A.B.; Fahima, T.; Beiles, A.; Nevo, E. Microsatellites: Genomic distribution, putative functions and mutational mechanisms: A review. Mol. Ecol. 2002, 11, 2453–2465. [Google Scholar] [CrossRef]
- Selkoe, K.A.; Toonen, R.J. Microsatellites for ecologists: A practicalguide to using and evaluating microsatellite markers. Ecol. Lett. 2006, 9, 615–629. [Google Scholar] [CrossRef]
- Oliveira, E.J.; Pádua, J.G.; Zucchi, M.I.; Vencovsky, R.; Vieira, M.L.C. Origin, evolution and genome distribution of microsatellites. Genet. Mol. Biol. 2006, 29, 294–307. [Google Scholar] [CrossRef]
- Li, Y.; Li, L.F.; Chen, G.Q.; Ge, X.J. Development of ten microsatellite loci for Gentiana crassicaulis (Gentianaceae). Conserv. Genet. 2007, 8, 1499–1501. [Google Scholar] [CrossRef]
- Kalia, R.K.; Rai, M.K.; Kalia, S.; Singh, R.; Dhawan, A.K. Microsatellite markers: An overview of the recent progress in plants. Euphytica 2011, 177, 309–334. [Google Scholar] [CrossRef]
- Mardis, E.R. Next-generation DNA sequencing methods. Annu. Rev. Genomics Hum. Genet. 2008, 9, 387–402. [Google Scholar] [CrossRef]
- Mardis, E.R. The impact of next-generation sequencing technology ongenetics. Trends Genet. 2008, 24, 133–141. [Google Scholar] [CrossRef]
- Imelfort, M.; Duran, C.; Batley, J.; Edwards, D. Discovering geneticpolymorphisms in next-generation sequencing data. Plant Biotechnol. J. 2009, 7, 312–317. [Google Scholar] [CrossRef]
- Yamamoto, S.; Kurokawa, T.; Sekino, M.; Yasuike, M.; Saitoh, K. Tetra-repeat microsatellite markers for the masu salmon (Oncorhynchus masou masou) and its application in cross-subspecies amplification. Int. J. Mol. Sci. 2013, 14, 23153–23159. [Google Scholar]
- Suresh, S.; Park, J.H.; Cho, G.T.; Lee, H.S.; Baek, H.J.; Lee, S.Y.; Chung, J.W. Development and molecular characterization of 55 novel polymorphic cDNA-SSR markers in faba bean (Vicia faba L.) using 454 pyrosequencing. Molecules 2013, 18, 1844–1856. [Google Scholar] [CrossRef]
- Stoeckel, S.; Grange, J.; Fernandez-Manjarres, J.F.; Bilger, I.; Frascaria-Lacoste, N.; Mariette, S. Heterozygote excess in a self-incompatible and partially clonal forest tree species - Prunus avium L. Mol. Ecol. 2006, 15, 2109–2118. [Google Scholar] [CrossRef]
- Nakamura, Y.; Shigenobu, Y.; Sugaya, T.; Kurokawa, T.; Saitoh, K. Automated screening andprimer design of fish microsatellite DNA loci on pyrosequencing data. Ichthyol. Res. 2013, 60, 184–187. [Google Scholar] [CrossRef]
- Raymond, M.; Rousset, F. GENEPOP (version 1.2): Population genetics software for exact tests and ecumenicism. J. Hered. 1995, 86, 248–249. [Google Scholar]
- Rousset, F. Genepop'007: A complete reimplementation of the Genepop software for Windows and Linux. Mol. Ecol. Resour. 2008, 8, 103–106. [Google Scholar] [CrossRef]
- Goudet, J. FSTAT (version 1.2): A computer program to calculate F-statistics. J. Hered. 1995, 86, 485–486. [Google Scholar]
- Excoffier, L.; Lischer, H.E.L. Arlequin suite ver 3.5: A new series of programs to perform population genetics analyses under Linux and Windows. Mol. Ecol. Resour. 2010, 10, 564–567. [Google Scholar] [CrossRef]
- Sample Availability: Samples of the eight primer pairs are available from the authors.
© 2014 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution license ( http://creativecommons.org/licenses/by/3.0/).
Share and Cite
Wang, W.; Li, Z.; Li, Y. Isolation and Characterization of Microsatellite Markers for Cotinus coggygria Scop. (Anacardiaceae) by 454 Pyrosequencing. Molecules 2014, 19, 3813-3819. https://doi.org/10.3390/molecules19033813
Wang W, Li Z, Li Y. Isolation and Characterization of Microsatellite Markers for Cotinus coggygria Scop. (Anacardiaceae) by 454 Pyrosequencing. Molecules. 2014; 19(3):3813-3819. https://doi.org/10.3390/molecules19033813
Chicago/Turabian StyleWang, Wei, Zhuo Li, and Yong Li. 2014. "Isolation and Characterization of Microsatellite Markers for Cotinus coggygria Scop. (Anacardiaceae) by 454 Pyrosequencing" Molecules 19, no. 3: 3813-3819. https://doi.org/10.3390/molecules19033813
APA StyleWang, W., Li, Z., & Li, Y. (2014). Isolation and Characterization of Microsatellite Markers for Cotinus coggygria Scop. (Anacardiaceae) by 454 Pyrosequencing. Molecules, 19(3), 3813-3819. https://doi.org/10.3390/molecules19033813
