Selection and Characterization of DNA Aptamers for Egg White Lysozyme
Abstract
:1. Introduction
2. Results and Discussion
2.1. Selection of aptamers
2.2. Evaluation of the aptamer binding affinity
2.3. Evaluation of binding specificity
3. Experimental
3.1. Reagents
3.2. Capillary electrophoresis operational parameters
3.3. Aptamer selection protocol
3.4. PCR and dsDNA separation
3.5. Cloning and sequencing
3.6. Binding affinity
3.6.1. Affinity capillary electrophoresis
3.6.2. Fluorescence anisotropy
3.6.3. Surface plasmon resonance
4. Conclusions
Acknowledgments
References
- Proctor, V.A.; Cunningham, F.E. The chemistry of lysozyme and its use as a food preservative and a pharmaceutical. Crit. Rev. Food Sci. Nutr. 1988, 26, 359–395. [Google Scholar] [CrossRef] [PubMed]
- Wasserfall, F.; Teuber, M. Action of egg-white lysozyme on Clostridium tyrobutyricum. Appl. Environ. Microbiol. 1979, 38, 197–199. [Google Scholar] [PubMed]
- Masschalck, B.; Michiels, C.W. Antimicrobial properties of lysozyme in relation to foodborne vegetative bacteria. Crit. Rev. Microbiol. 2003, 29, 191–214. [Google Scholar] [CrossRef] [PubMed]
- Weber, P.; Kratzin, H.; Brockow, K.; Ring, J.; Steinhart, H.; Paschke, A. Lysozyme in wine: A risk evaluation for consumers allergic to hen's egg. Mol. Nutr. Food Res. 2009, 53, 1469–1477. [Google Scholar] [CrossRef] [PubMed]
- Gerbaux, V.; Villa, A.; Monamy, C.; Bertrand, A. Use of lysozyme to inhibit malolactic fermentation and to stabilize wine after malolactic fermentation. Am. J. Enol. Vitic. 1997, 48, 49–54. [Google Scholar]
- Akashi, A.; Oono, A. Preservative effect of egg-white lysozyme to nonpackaged kamaboko. J. Agric. Chem. Soc. Jpn. 1972, 46, 177–183. [Google Scholar]
- Chander, R.; Lewis, N.F. Effect of lysozyme and sodium EDTA on shrimp microflora. Eur. J. Appl. Microbiol. Biotechnol. 1980, 10, 253–258. [Google Scholar] [CrossRef]
- Samuelson, K.J.; Rupnow, J.H.; Froning, G.W. The effect of lysozyme and ethylenediaminetetraacetic acid on Salmonella on broiler Parts. Poult. Sci. 1985, 64, 1488–1490. [Google Scholar] [CrossRef] [PubMed]
- Anet, J.; Back, J.F.; Baker, R.S.; Barnett, D.; Burley, R.W.; Howden, M.E.H. Allergens in the white and yolk of hens egg - a study of IgE binding by egg proteins. Int. Arch. Allergy Appl. Immunol. 1985, 77, 364–371. [Google Scholar] [CrossRef] [PubMed]
- Perez-Calderon, R.; Gonzalo-Garijo, M.A.; Lamilla-Yerga, A.; Mangas-Santos, R.; Moreno-Gaston, I. Recurrent angioedema due to lysozyme allergy. J. Invest. Allergol. Clin. Immunol. 2007, 17, 264–266. [Google Scholar]
- Yman, I.M. Detection of inadequate labeling and contamination as causes of allergic reactions to food. Acta Aliment. 2004, 33, 347–357. [Google Scholar] [CrossRef]
- Fremont, S.; Kanny, G.; Nicolas, J.P.; MoneretVautrin, D.A. Prevalence of lysozyme sensitization in an egg-allergic population. Allergy 1997, 52, 224–228. [Google Scholar] [CrossRef] [PubMed]
- Tombelli, S.; Minunni, A.; Mascini, A. Analytical applications of aptamers. Biosens. Bioelectron. 2005, 20, 2424–2434. [Google Scholar] [CrossRef] [PubMed]
- Bock, L.C.; Griffin, L.C.; Latham, J.A.; Vermaas, E.H.; Toole, J.J. Selection of single-stranded-DNA molecules that bind and inhibit human thrombin. Nature 1992, 355, 564–566. [Google Scholar] [CrossRef] [PubMed]
- Wen, J.D.; Gray, C.W.; Gray, D.M. SELEX selection of high-affinity oligonucleotides for bacteriophage Ff gene 5 protein. Biochemistry 2001, 40, 9300–9310. [Google Scholar] [CrossRef] [PubMed]
- Nonaka, Y.; Sode, K.; Ikebukuro, K. Screening and improvement of an anti-VEGF DNA aptamer. Molecules 2010, 15, 215–225. [Google Scholar] [CrossRef] [PubMed]
- Mendonsa, S.D.; Bowser, M.T. In vitro selection of aptamers with affinity for neuropeptide Y using capillary electrophoresis. J. Am. Chem. Soc. 2005, 127, 9382–9383. [Google Scholar] [CrossRef] [PubMed]
- Geiger, A.; Burgstaller, P.; vonderEltz, H.; Roeder, A.; Famulok, M. RNA aptamers that bind L-arginine with sub-micromolar dissociation constants and high enantioselectivity. Nucleic Acids Res. 1996, 24, 1029–1036. [Google Scholar] [CrossRef] [PubMed]
- Ellington, A.D.; Szostak, J.W. Selection Invitro of single-stranded-DNA molecules that fold into specific ligand-binding structures. Nature 1992, 355, 850–852. [Google Scholar] [CrossRef] [PubMed]
- Osborne, S.E.; Ellington, A.D. Nucleic acid selection and the challenge of combinatorial chemistry. Chem. Rev. 1997, 97, 349–370. [Google Scholar] [CrossRef] [PubMed]
- Stoltenburg, R.; Reinemann, C.; Strehlitz, B. SELEX-A (r)evolutionary method to generate high-affinity nucleic acid ligands. Biomol. Eng. 2007, 24, 381–403. [Google Scholar] [CrossRef] [PubMed]
- Pan, W.H.; Clawson, G.A. The shorter the better: reducing fixed primer regions of oligonucleotide libraries for aptamer selection. Molecules 2009, 14, 1353–1369. [Google Scholar] [CrossRef] [PubMed]
- Cox, J.C.; Ellington, A.D. Automated selection of anti-protein aptamers. Bioorg. Med. Chem. 2001, 9, 2525–2531. [Google Scholar] [CrossRef]
- Kirby, R.; Cho, E.J.; Gehrke, B.; Bayer, T.; Park, Y.S.; Neikirk, D.P.; McDevitt, J.T.; Ellington, A.D. Anal. Chem. 2004, 76, 4066–4075.
- Kawde, A.N.; Rodriguez, M.C.; Lee, T.M.H.; Wang, J. Label-free bioelectronic detection of aptamer-protein interactions. Electrochem. Commun. 2005, 7, 537–5340. [Google Scholar] [CrossRef]
- Rodriguez, M.C.; Kawde, A.N.; Wang, J. Aptamer biosensor for label-free impedance spectroscopy detection of proteins based on recognition-induced switching of the surface charge. Chem. Commun. 2005, 4267–4269. [Google Scholar] [CrossRef] [PubMed]
- Cheng, A.K.H.; Ge, B.; Yu, H.Z. Aptamer-based biosensors for label-free voltammetric detection of lysozyme. Anal. Chem. 2007, 79, 5158–5164. [Google Scholar] [CrossRef] [PubMed]
- Huang, H.P.; Jie, G.F.; Cui, R.J.; Zhu, J.J. DNA aptamer-based detection of lysozyme by an electrochemiluminescence assay coupled to quantum dots. Electrochem. Commun. 2009, 11, 816–818. [Google Scholar] [CrossRef]
- Rodriguez, M.C.; Rivas, G.A. Label-free electrochemical aptasensor for the detection of lysozyme. Talanta 2009, 78, 212–216. [Google Scholar] [CrossRef] [PubMed]
- Peng, Y.G.; Zhang, D.D.; Li, Y.; Qi, H.L.; Gao, Q.; Zhang, C.X. Label-free and sensitive faradic impedance aptasensor for the determination of lysozyme based on target-induced aptamer displacement. Biosens. Bioelectron. 2009, 25, 94–99. [Google Scholar] [CrossRef] [PubMed]
- Mendonsa, S.D.; Bowser, M.T. In vitro evolution of functional DNA using capillary electrophoresis. J. Am. Chem. Soc. 2004, 126, 20–21. [Google Scholar] [CrossRef] [PubMed]
- Luzi, E.; Minunni, M.; Tombelli, S.; Mascini, M. New trends in affinity sensing: aptamers for ligand binding. Trac-Trends Anal. Chem. 2003, 22, 810–818. [Google Scholar] [CrossRef]
- Law, M.J.; Linde, M.E.; Chambers, E.J.; Oubridge, C.; Katsamba, P.S.; Nilsson, L.; Haworth, I.S.; Laird-Offringa, I.A. The role of positively charged amino acids and electrostatic interactions in the complex of U1A protein and U1 hairpin II RNA. Nucleic Acids Res. 2006, 34, 275–285. [Google Scholar] [CrossRef] [PubMed]
- Ebbehoj, K.; Dahl, A.M.; Frokiaer, H.; Norgaard, A.; Poulsen, L.K.; Barkholt, V. Purification of Egg-White Allergens. Allergy 1995, 50, 133–141. [Google Scholar] [CrossRef] [PubMed]
- Mendonsa, S.D.; Bowser, M.T. In vitro selection of high-affinity DNA ligands for human IgE using capillary electrophoresis. Anal. Chem. 2004, 76, 5387–5392. [Google Scholar] [CrossRef] [PubMed]
- Zuker, M. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 2003, 31, 3406–3415. [Google Scholar] [CrossRef] [PubMed]
- Tetin, S.Y.; Hazlett, T.L. Optical spectroscopy in studies of antibody-hapten interactions. Methods 2000, 20, 341–361. [Google Scholar] [CrossRef] [PubMed]
- Katilius, E.; Flores, C.; Woodbury, N.W. Exploring the sequence space of a DNA aptamer using microarrays. Nucleic Acids Res. 2007, 35, 7626–7635. [Google Scholar] [CrossRef] [PubMed]
Sample Availability: Samples of the compounds are available from authors. |
Clone ID | Sequence of random region (5’ to 3’) |
---|---|
Apta1 | GCAGCTAAGCAGGCGGCTCACAAAACCATTCGCATGCGGC |
Apta2 | GCGTGGGCAGCTAGCACCGATGGTTCTATCGTGGGCTCCG |
Apta3 | GCGGGTCGGTTGCTCGCTTCGCCCGATCGGTCTAAGGGTG |
Apta4 | GCGCAAGGTCATCGCATCGCGTCGGAATGGGCTACAGGTG |
Apta8 | GCACCTTGATGACATGATAGTCGTTGTGTATGCAGTTGGC |
© 2010 by the authors; licensee Molecular Diversity Preservation International, Basel, Switzerland. This article is an open-access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/).
Share and Cite
Tran, D.T.; Janssen, K.P.F.; Pollet, J.; Lammertyn, E.; Anné, J.; Van Schepdael, A.; Lammertyn, J. Selection and Characterization of DNA Aptamers for Egg White Lysozyme. Molecules 2010, 15, 1127-1140. https://doi.org/10.3390/molecules15031127
Tran DT, Janssen KPF, Pollet J, Lammertyn E, Anné J, Van Schepdael A, Lammertyn J. Selection and Characterization of DNA Aptamers for Egg White Lysozyme. Molecules. 2010; 15(3):1127-1140. https://doi.org/10.3390/molecules15031127
Chicago/Turabian StyleTran, Dinh T., Kris P. F. Janssen, Jeroen Pollet, Elke Lammertyn, Jozef Anné, Ann Van Schepdael, and Jeroen Lammertyn. 2010. "Selection and Characterization of DNA Aptamers for Egg White Lysozyme" Molecules 15, no. 3: 1127-1140. https://doi.org/10.3390/molecules15031127
APA StyleTran, D. T., Janssen, K. P. F., Pollet, J., Lammertyn, E., Anné, J., Van Schepdael, A., & Lammertyn, J. (2010). Selection and Characterization of DNA Aptamers for Egg White Lysozyme. Molecules, 15(3), 1127-1140. https://doi.org/10.3390/molecules15031127