Next Article in Journal
Buffalo Yogurt Fortified with Eucalyptus (Eucalyptus camaldulensis) and Myrrh (Commiphora Myrrha) Essential Oils: New Insights into the Functional Properties and Extended Shelf Life
Previous Article in Journal
Anion Transport Using Core Functionalized Hyperbranched Polymers and Evidence of a Dense Packed Limit Based on Molecular Weight
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Molecules
Volume 26
Issue 22
10.3390/molecules26226851
molecules-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Anthracene and Pyrene Biodegradation Performance of Marine Sponge Symbiont Bacteria Consortium

by
Ismail Marzuki
1,*,
Ruzkiah Asaf
2,
Mudian Paena
2,
Admi Athirah
2,
Khairun Nisaa
3,
Rasheed Ahmad
4 and
Mudyawati Kamaruddin
5
1
Department of Chemical Engineering, Fajar University, Makassar 90231, Indonesia
2
Research Center for Brackish Aquaculture Fisheries and Extension Fisheries, Maros 90512, Indonesia
3
Fishery Faculty, Cokroaminoto University of Makassar, Makassar 90245, Indonesia
4
Departement of Chemistry, Airlangga University, Surabaya 60115, Indonesia
5
Postgraduate Program, Department of Medical Laboratory Science, Muhammadiyah Semarang University, Semarang 50273, Indonesia
*
Author to whom correspondence should be addressed.
Molecules 2021, 26(22), 6851; https://doi.org/10.3390/molecules26226851
Submission received: 6 October 2021 / Revised: 8 November 2021 / Accepted: 10 November 2021 / Published: 13 November 2021
(This article belongs to the Section Medicinal Chemistry)
Browse Figures
Review Reports Versions Notes

Abstract

:
Every petroleum-processing plant produces sewage sludge containing several types of polycyclic aromatic hydrocarbons (PAHs). The degradation of PAHs via physical, biological, and chemical methods is not yet efficient. Among biological methods, the use of marine sponge symbiont bacteria is considered an alternative and promising approach in the degradation of and reduction in PAHs. This study aimed to explore the potential performance of a consortium of sponge symbiont bacteria in degrading anthracene and pyrene. Three bacterial species (Bacillus pumilus strain GLB197, Pseudomonas stutzeri strain SLG510A3-8, and Acinetobacter calcoaceticus strain SLCDA 976) were mixed to form the consortium. The interaction between the bacterial consortium suspension and PAH components was measured at 5 day intervals for 25 days. The biodegradation performance of bacteria on PAH samples was determined on the basis of five biodegradation parameters. The analysis results showed a decrease in the concentration of anthracene (21.89%) and pyrene (7.71%), equivalent to a ratio of 3:1, followed by a decrease in the abundance of anthracene (60.30%) and pyrene (27.52%), equivalent to a ratio of 2:1. The level of pyrene degradation was lower than that of the anthracene due to fact that pyrene is more toxic and has a more stable molecular structure, which hinders its metabolism by bacterial cells. The products from the biodegradation of the two PAHs are alcohols, aldehydes, carboxylic acids, and a small proportion of aromatic hydrocarbon components.

1. Introduction

Anthracene and pyrene are polycyclic aromatic hydrocarbons (PAHs). Their molecular structure is stable due to the ring’s resonance ability of pi (π) bonds. These two types of PAHs were first isolated from coal tar and as volatile compounds formed from the incomplete combustion of organic compounds in protein-rich foods [1]. The primary sources of anthracene and pyrene are coal tar, natural gases, and petroleum. These PAHs are also present in plants (e.g., tobacco tar) and animals (e.g., deer and termites) [2]. Anthracene is moderately toxic and carcinogenic, whereas pyrene is highly toxic, carcinogenic, and genotoxic or mutagenic [3,4,5]. Anthracene is widely used as an antiseptic and insecticide, whereas pyrene is used for increasing the octane number of fossil fuels [6,7]. The current use of anthracene and pyrene is quite extensive; hence, there is a risk of them being pollutants in the air, soil, and water [8,9]. As one of the characteristics of PAHs, anthracene and pyrene are difficult to decompose. They accumulate in the environment, including in living organisms. Supposedly, these PAHs have been released in the environment for a long time, which, in combination with the effects of climate factors such as precipitation and temperature, can disrupt the ecological balance [10]. Additionally, these two PAHs can be dissolved in water bodies, eventually ending up in the sea [11].
The sea is a giant container that can accommodate a variety of materials. There is a wide range of biota interacting in the sea, including the reversible relationship between all abiotic components and biotic components, i.e., those already available in the sea and new materials that enter the marine environment [12,13]. This condition results in new adaptations in the sea, resulting in changes in the life patterns of marine ecosystems [14,15]. If the discharge of PAHs into the sea is not properly controlled, fish and other biota will accumulate these carcinogenic components [16,17]. These fish are then caught by fishermen and eventually consumed by humans [18]. This process eventually forms a cycle, and the flow of the food chain, in the long run, decreases both environmental quality and human health [19].
The formation of interactive patterns in the sea between abiotic and biotic components as the result of adaptation to the above conditions causes many organisms to experience pressure, thereby regulating their lifecycle. However, some organisms thrive due to these new patterns [20,21]. One example is the sea sponge because it has a strong ability to adapt to changes in habitat [22]. There are four forms of adaptation by marine sponges. First, sponges have the ability to form a mutual symbiosis with bacteria such that they can survive in habitats contaminated with waste such as PAHs and heavy metals [23]. Second, the nutritional pattern of sponges is a filter feeder with a body structure that has oscula, enabling it to obtain and absorb food that is needed, whereas food that is not needed is disposed of by spraying it out [24]. Third, sponges can produce mucus substances that act as enzymes, which can be spread on the surface of their bodies to camouflage them against predatory threats [25,26]. Several earlier investigations discovered that any bacteria with the potential to biodegrade PAHs were isolated from sponges having mucus on their body surface. This mucus is thought to be utilized by sponges to defend themselves against predators in their environments, including the presence of poisonous PAHs and heavy metals [11,26]. Fourth, sponges are able to absorb carbon components and convert them into energy for activities, including being able to absorb heavy metals [27,28,29,30]. Some scientific data have suggested this adaptability of sponges to be due to their old civilization. The DNA structure of sponges responds easily to habitat changes [31].
In addition to having the ability to degrade carbon components, especially PAHs, sponges also have bioindicator and biomonitoring functions, as well as the ability to bio-adsorb heavy metals. This is due to their ability to produce enzymes (metabolic components) that can absorb and neutralize the toxic nature of the waste [32,33,34]. Sponges are also able biodegrade aliphatic and aromatic hydrocarbon components, presumably because of the role of symbiotic bacteria or because of the metabolic components produced [35,36]. The biodegradation of PAHs and bio-adsorption of heavy metals have led to the marine sponge being identified with significant benefits in reducing pollutants and maintaining the quality of the marine environment [37,38].
The facts mentioned above prompted us to carry out a series of studies to explore and map the abilities of sponges and their symbiont bacteria to reduce PAHs and heavy-metal pollutants in the marine environment. Thus, data on the collection and even formulation of marine sponge symbiont bacteria can be compiled with their biodegradation and bio-adsorption abilities to form a crystalline bacterial consortium that can be quickly mobilized to the polluted sites [1,11,39]. Characterization of sponges and symbiotic bacteria, including an analysis of the biodegradation potential of PAHs, is essential [40]. The application and increase in the biodegradation rate of symbiont bacteria toward hydrocarbon pollutants, especially PAHs, is seen as a necessity [41,42].
Several species of sponge symbiont bacteria can also carry out the bio-adsorption of several types of heavy metals, namely, mercury (Hg), chromium (Cr), arsenic (As), lead (Pb), cadmium (Cd), copper (Cu), nickel (Ni), zinc (Zn), and cobalt (Co) [43,44,45,46]. The development of the function and performance in the biodegradation of PAHs and bio-adsorption of heavy metals by sponge symbiont bacteria, in the form of a consortium of potential bacteria, can be used to effectively manage polluted environments [47]. A previous study also looked at several types of sponge symbiotic bacteria with the capacity to biodegrade PAH components and bio-adsorb heavy metals [24]. Following a series of effective studies, future environmental management operations to remove PAHs and heavy metals can be carried out using bacteria that have been shown to breakdown PAH pollutants and absorb heavy metals. The maritime environment is severely polluted with both sorts of pollutants (PAHs and heavy metals); therefore, materials that can address this are required [48]. The role of sponge symbiotic biomass and bacteria in improving the quality of the marine environment is of great interest. The biodegradation performance of PAHs can be improved by utilizing a bacterial consortium. Possible practical applications allow preserving the environment while maintaining the growth and development of the marine sponge population. The cultivation of marine sponges can be achieved using the transplantation method [49,50,51].
The major goal of this study was to evaluate a consortium of bacteria for its biodegradation of anthracene and pyrene by examining the level of biodegradation products, in addition to biodegradation metrics such as turbidity, gas generation, changes in pH, and fermentation odor.

2. Results

This study attempted to observe the ability of a consortium formulated from marine sponge symbiont bacteria to decompose anthracene and pyrene. This included the preparation of the marine sponge symbiont bacteria consortium through a characterization of the sampling point, morphology analysis, bacterial isolation from marine sponges, phenotypic and genotypic analyses of the isolated bacterial, and selection of potential PHAs for biodegradation, followed by an evaluation of the biodegradation processes of the bacterial consortium as a function of various parameters including the reduction in abundance and concentration of the PHAs, and a measurement of the biodegradation products or functional groups.

2.1. Characteristics of Seawater at Sampling Location

The seawater at the point of sponge sample acquisition was characterized to establish any potential correlation between the habitat of the sponge (e.g., the presence of hazardous contaminants and potential symbiotic bacteria for their biodegradation). The sampling points were the waters around Kodingareng Keke Island, in the administrative area of Makassar Metro City, South Sulawesi. The island is one of the Maritime Tourism Areas developed by the Makassar City government and is included in the Spermonde Archipelago Cluster [11]. Table 1 shows the characteristics of the sampling locations. The data obtained in the table shows the general condition of coastal waters.

2.2. Marine Sponge Morphology

The morphology of marine sponges, as the source of bacterial isolates for the biodegradation of PAHs, was evaluated in terms of the sponge body and cell structure. The bacterial symbiotic model exhibited potential for biodegradation of PAHs. Sponges are marine organisms with many functions, but they are vulnerable to threats resulting from predators or fishing activity disturbances due to the slow growth rate and development of sponges. It is necessary to understand whether there is a relationship between the body structure of marine sponges and their associated bacteria, as well as between their habitats and the presence of slimy body surfaces with the ability to decompose PAH-type hydrocarbon components using the symbiotic bacteria isolated from the sponges. Marine sponge samples coded Sp1, Sp2, and Sp3, according to the results of morphological analysis, were Niphates sp. (Figure 1), Hyrtios erectus (Figure 2), and Clathria (Thalysias) reinwardtii (Figure 3), respectively. Interestingly, all three marine sponges presented a slimy surface [11,39].
In general, the features of these three species of sponges were similar, while their body surfaces were covered with mucus and supplied various types of bacteria. Other studies conducted using bacteria obtained from marine sponges whose bodies are not coated with mucus substances in their natural habitat resulted in these bacteria being unable to breakdown PAHs. This validates the idea that bacteria isolated from marine sponges with mucus-covered body surfaces can be employed for the biodegradation of PAHs.

2.3. Isolation and Phenotypic Characteristics of Marine Sponge Symbiont Bacteria

Potential bacteria for the biodegradation of PAHs can be isolated from marine sponges. A phenotypic citrate test was preliminarily performed to confirm whether the chosen bacteria had the potential to biodegrade PAHs. A positive indicates that the bacteria can likely convert carbon as an energy source and are, thus, potentially able to biodegrade PAHs.
Phenotypic characterization of three bacterial isolates showed that the bacteria formed spores, were Gram-positive, and generally reacted positively to seven types of biochemical reagents These characteristics were considered to meet the primary requirements to carry out the biodegradation process of PAH components [9,31]. Several conditions are needed so that bacteria can carry out the biodegradation of hydrocarbon components, e.g., having enzymes capable of hydrolyzing amino acids as indicated by the indole test, ability to carry out the fermentation reaction as shown by the TSIA test, ability to reduce nitrate to nitrile as shown by the nitrate test, and ability to break bonds as shown by the urease test. The urease test indicated the presence of carbon, while the positive citrate test indicated that bacteria can convert citrate to pyruvate, which enters the organism’s metabolic cycle to produce energy. On the basis of these results, we can predict that these bacteria can also biodegrade PAHs. Although not all bacteria examined exhibited positive results for all tests, other criteria suggested the potential utilization of these bacteria in the biodegradation of PAH components. However, no particular phenotypic feature showing that sponge symbiotic bacteria may breakdown PAHs was identified. Selected bacteria exhibited more than two phenotypic characteristics for the biodegradation of PAHs from seven phenotypic tests (Table 2). The phenotypic analysis also revealed that the bacterial isolate coded Sp1, isolated from the sponge Niphates sp., belongs to the Bacillus group, Sp2, isolated from the sponge Hyrtios erectus, belongs to the Pseudomonas group, and Sp3, isolated from the sponge Clathria (Thalysias) reinwardtii, belongs to the Acinetobacter group [22,24,29].

2.4. Genotypic Analysis of Marine Sponge Symbiont Bacteria

It is necessary to know the bacterial genotype of marine sponge symbionts to ascertain the types and strains of bacteria used to degrade PAH components. According to the data on the grouping of marine sponge symbiont bacteria (Table 2), the three isolates were assigned a new code as a function of the suspected bacterial class, i.e., Sp1-Bc, Sp2-Ps, and Sp3-Ac. The results of genotypic characterization using the 16S rRNA gene sequence indicated that bacterial isolate Sp1-Bc had a 96% similarity level with Bacillus pumilus strain GLB197, the Sp2-Ps isolate had a 91% similarity level with Pseudomonas stutzeri strain SLG510A3-8, and the Sp3-Ac isolate had a 99% similarity level with Acinetobacter calcoaceticus strain SLCDA976 (Table 3).

2.5. Biodegradation of PAH Components

2.5.1. Evaluating PAH Biodegradation Performance of the Marine Sponge Symbiont Bacterial Consortium

The physical interaction of the bacterial consortium suspension with the PAHs changed during the biodegradation process. Several general parameters can be observed as indicators of the ongoing biodegradation process, including turbidity, fermentation odor, pH changes, and the formation of gas bubbles (Table 4). These parameters are characteristic of fermentation by bacteria or the actions of enzymes on a substrate containing protein or glucose, including materials containing hydrocarbon components. Biodegradation follows the pattern of enzymatic reactions. The enzymatic components are thought to be produced by bacteria in response to their habitat conditions contaminated with hydrocarbon components. Mucus with enzyme characteristics is produced for bacteria to survive in PAH-contaminated media. Therefore, physical changes in the interaction media denote the performance of enzymatic reactions via the appearance of fermentation odor and the abundance of gas bubbles [29,30,31].
The relative turbidity of the media increased with increasing interaction time, indicating that there was an increase in the size and number of bacterial cells. The increase in temperature, the relative increase in acidity of the interactive media, the emergence of gas bubbles, and the smell of fermentation are strong indications of a biodegradation process occurring in the media. These parameters are characteristic of the fermentation process of enzymes produced by marine sponge symbiont bacteria in response to media contaminated with anthracene and pyrene components. These results indicate that the consortium of marine sponge symbiont bacteria can degrade anthracene and pyrene components [37,42].

2.5.2. Analysis of the Biodegradation Performance of Anthracene and Pyrene PAHs by Marine Sponge Symbiont Consortium

Anthracene and pyrene act as substrates degraded by the bacterial consortium. In theory, the number of peaks detected by GC–MS should only be two, corresponding to the presence of anthracene and pyrene in the mixture. However, this was not the case, as more peaks were recorded. A longer interaction period led to more new peaks appearing, indicating that those new peaks are products resulting from the biodegradation of PAHs [11,42,52]. The new peaks were attributed to alcohols, aldehydes, carboxylic acids, some ketones, and aliphatic hydrocarbon compounds. However, this cannot be estimated with absolute certainty because the quality of some GC–MS components was below 90% (Table 5).
The peaks of anthracene and pyrene decreased with the increase in interaction time. This result indicates that the medium’s abundance of anthracene and pyrene components was reduced due to degradation. Under the same conditions, the number of new components tended to increase, and the total concentration of biodegradation products also increased.
The abundance of anthracene and pyrene components seemed to decrease with increasing interaction time. The decrease in abundance of the component correlated with the decrease in component peak. Subsequently, new peaks appeared, indicating new products of the biodegraded compound. The number of new peaks formed tended to increase with interaction time. These new peaks had different retention times and peak heights, indicating different types and abundances [1,4,53]. Each new component had different characteristics, i.e., functional groups, but they were all organic compounds. Anthracene and pyrene components are shown in red in Figure 4A–E, while degradation products components are shown in green. Analysis of the degraded components on the spectra (Figure 4A–E) showed differences in the number and type of component. Accordingly, it can be stated that (1) the number of components resulting from biodegradation tended to increase with increasing interaction time, (2) the types of biodegradation products were different, and (3) all biodegradation products were organic compounds with dominant characteristics in the form of hydroxyl and carbonyl functional groups.
The maximum biodegradation process was characterized by a decrease in peak height or a decrease in the abundance of PAHs that occurred following a contact time of 15–20 days (Figure 4C,D), after which the biodegradation process was relatively stagnant (Figure 4E).

2.5.3. Functional Groups of Biodegradation Products

The FTIR spectrum (Figure 5) presents the components of biodegradation products in the form of organic compounds. Each compound is characterized by functional groups identified according to the range of wavenumbers. Overall, it can be stated that a longer interaction time led to an increase in the number of components and the types of components (Figure 5A–E), dominated by alcohols, aldehydes, ketones, carboxylic acids, and some aromatic components [5,8,11]

2.6. Comparison of the Biodegradation of Anthracene and Pyrene by the Marine Sponge Symbiont Consortium Bacteria

The performance and level of biodegradation of anthracene by the marine sponge symbiotic bacterial consortium were different from those of pyrene. With an interaction time of 25 days (Figure 6A), the decrease in the abundance of anthracene reached 4.132 × 106 units, equal to 60.30%, while that of pyrene reached 7.902 × 106 units, equal to 27.52%, i.e., a ratio of 1:2. The decrease in concentrations of anthracene and pyrene (Figure 6B) exhibited a ratio of 1:3, i.e., the percentage decrease in the concentration of anthracene was 21.89%, while that of pyrene was only 7.71%. The total concentration of PAHs (Ant. + Pyr.) degraded by the bacterial consortium was 17.23% (Figure 6C), while the total concentration of biodegradation products formed was 17.67%. These results indicate that the consortium of marine sponge symbiotic bacteria more easily degraded anthracene than pyrene [2,11,54].

3. Discussion

The seawater conditions at the sponge sampling point were of good quality (Table 1) according to salinity, pH, electrical conductivity, and total dissolved solids (TDS). However, this does not suggest that the seawater is free from hydrocarbon contamination. The results of the morphological analysis showed that all three types of marine sponges as sources of bacterial isolates had a slimy body surface (Figure 1, Figure 2 and Figure 3). The mucus on the surface of the sponge body is anticipated to be a substance produced by symbiotic bacteria for self-protection and adaptation to the dynamics in the sponge’s growth habitat [5,15,55]. The three types of consortium bacteria (Table 2) reacted positively with several phenotypic test reagents, indicating their specific ability to biodegrade PAHs, such as pyrene and anthracene. The phenotypic information was supplemented by genotypic analysis in the form of strains and bacterial species. As a result, the features of the bacterial consortia involved in the biodegradation of anthracene and pyrene components were more evident. Genotypic analysis was carried out to ascertain the characteristics of the three types of isolates used for the biodegradation of PAHs (Table 3).
One of the novelties of this research is that it provides an understanding of potential bacteria from marine sponges that can biodegrade hydrocarbon components, especially PAHs. It can be used as guideline for compiling data on bacteria that biodegrade PAHs [11,37,39].
The observations of turbidity, temperature, pH, gas bubbles, and the fermentation smell suggested that the consortium of marine sponge symbiont bacteria was able to degrade PAH components (anthracene and pyrene) (Table 4) [56]. Further evidence of the degradation of anthracene and pyrene by the consortium of sponge symbiont bacteria was the decrease in their abundance after an interaction lasting several days (Table 5), as a function of the peak height (Figure 4A–E), changes in the percentage of degraded components (Table 5), formation of new peaks corresponding to biodegradation products (Figure 4), and percentage of biodegradation products (Table 5). The new peaks formed were attributed to simple organic compounds in the form of alcohols, aldehydes, ketones, carboxylic acids, and aromatic components (Table 4; Figure 5) [2,40,57].
Anthracene was more easily degraded by the consortium of marine sponge bacterial symbionts than pyrene (Figure 6). Theoretically, this can be explained as follows: (1) the toxicity level of pyrene is higher than anthracene; thus, bacterial cells do not survive as long during the biodegradation of pyrene compared with anthracene; (2) the structure of the pyrene molecule is more stable than that of anthracene, thereby hindering its metabolism by bacteria; (3) pyrene has more aromatic rings and forms a compact structure, thus necessitating a longer time for degradation; (4) acidic compounds are formed as degradation products, thereby limiting the biodegradation process. In these conditions, bacterial cells can experience sudden mass death or struggle to further replicate [7,16,37,58].
The combination of all analytical parameters revealed a drop in anthracene concentration of 21.89%, while the decrease in pyrene concentration was 7.71%, i.e., an equivalent ratio of 3:1. These findings were supplemented by a reduction in the abundance of anthracene (which fell to 60.30%) and pyrene (which fell to 27.52%). All biodegradation products (alcohols, aldehydes, carboxylic acids, ketones, and a small number of aromatic components) were formed at a rate of 17.67%. Because the consortium bacteria’s level of biodegradation of anthracene was higher than that of pyrene, it was hypothesized that anthracene is less toxic than pyrene. Furthermore, pyrene’s molecular structure is more stable than anthracene’s, limiting its metabolism by bacterial cells. The application of a bacterial consortium was not successful in raising the degree of PAH biodegradation, likely owing to competition between bacterial cells of various species, such that the capacity of PAHs to adapt to their hazardous environment was not observed.

4. Materials and Methods

4.1. Materials

The materials used were three types of marine sponges coded Sp1 (Niphates sp.), Sp2 (Hyrtios erectus), and Sp3 (Clathria (Thalysias) reinwardtii) (Figure 1, Figure 2 and Figure 3), which were collected by the researchers [11,29,42]. Three different bacterial stocks were utilized, and their genotypes were determined using the PCR technique. Total DNA from sponge symbionts was extracted and amplified using a universal primer of the 16S rRNA gene with the forward sequence 5′–CCAGCAGCCGCGGTAATACG–3′ attached to nucleotide bases 518–537 and the reverse sequence 5′–ATCGG(C/T)TACCTTGTTACGACTTC–3′ attached to nucleotide bases 1513–1491 [11,28]. Marine sponge symbiont bacteria Sp1-Bc, Sp2-Ps, and Sp3-Ac (Table 3), methanol pa, n-hexane for GC, anthracene CAS number 000120-12-7 and pyrene CAS number 000129-00-0 (Supelco, Bellefonte, PA, USA), Na2SO4 pa, aquabides, physiological 0.9% NaCl (commercially obtained, Supelco), materials for sponge morphology analysis, materials for standard biochemical tests following the guidelines in [59], and materials for genotypic analysis of bacterial isolates were also obtained. Bacterial isolates of marine sponge symbionts were sourced from [11,29,32,37].

4.2. Sampling Point Characterization

Parameters observed and measured for the seawater conditions at the sponge sampling point included coordinates, salinity, pH, TDS, EC, distance from the sampling point to the nearest shoreline, and sampling depth from sea level (Table 1). All data displayed were not previously published. The determination of sampling points and sampling techniques were guided by fishery and marine experts belonging to nongovernmental organizations concerned with marine life.

4.3. Marine Sponge Morphology

Morphology, cell structure, and types of sea sponge samples in the study were analyzed at the Microbiology Laboratory of Sebelas Maret University, Surakarta, Central Java. Sponge types and morphological data were sourced from [11,29,32,37,42].

4.4. Isolation and Phenotypic Analysis of Marine Sponge Symbiont Bacteria

Isolation of bacteria was done using the swab method. Purification was done using the direct plating method. Morphological analysis was done by direct observation. Gram staining, biochemical analysis, and identification of the isolates of marine sponge symbiont bacteria followed [59]. The data contained in Table 2, refer to previous research [29,32,37].

4.5. Genotypic Analysis of the Bacterial Isolate

Characteristics of marine sponge symbiont bacteria were determined through genotypic analysis using the PCR method (Table 3). The data displayed were sourced from [11,29,32,37,42].

4.6. Biodegradation Interactions and Evaluation of the Processes

4.6.1. Interaction of Biodegradation Components

Selected bacterial isolates (Sp1-Bc, Sp2-Ps, and Sp3-Ac) from [11,29,37] were cultured. A volume of 10 mL of each bacterial suspension was put in an Erlenmeyer flask, diluted to 100 mL, homogenized, and adapted for 1 × 24 h in an incubator. To mix the bacterial suspension (consortium), 5 mL was serially pipetted in a row of 15 test tubes, before incubating for 1 × 2 h in an incubator. A total of 2 mL of mixed PAHs (Ant + Pyr) were put in each test tube previously been filled with bacterial suspension. Bacterial suspensions and PAHs were allowed to interact on a shaker incubator at 200 rpm. The interaction time was 25 days, with observations and biodegradation parameters recorded every 5 days [4,11,58].

4.6.2. Parameters of Biodegradation of PAHs by Bacteria

Measurement of biodegradation parameters for the bacterial suspensions interacting with PAHs was carried out every 5 days using appropriate instruments, in addition to direct observations of the abundance of gas bubbles formed and the odor of fermentation (Table 4) [11,12].

4.6.3. Biodegradation Performance of PAHs by the Bacterial Consortium

Measurement of the abundance and components of biodegradation products was carried out every 5 days by extracting components of anthracene and pyrene that were not degraded, as well as components of biodegradation products, using n-hexane. The n-hexane extract was dehydrated using Na2SO4 for GC–MS (Table 5, Figure 4A–E) [1,37].

4.6.4. Detection of Functional Groups for Identification of Biodegradation Products of PAHs by Bacteria Consortium

An aqueous-free n-hexane extract was partially used for the determination of functional groups of each biodegradation product using an FTIR instrument (Figure 5A–E). The FTIR (Fourier-transform infrared) spectra revealed the presence of organic components, such as alcohols, aldehydes, and carboxylic acids.

4.7. Comparison of Biodegradation Rates of Anthracene and Pyrene

The biodegradation level of anthracene and pyrene by the bacterial consortium was determined through an analysis of the decrease in peak height of the degraded components as a function of the interaction time.
A b u n d .   o f   d e g r .   c o m p .   ( % ) = ( p e a k   h e i g h t ) n o − ( p e a k   h e i g h t ) n t ( p e a k   h e i g h t ) n o × 100   %
where no and nt represent the initial and final peak heights of the biodegradation process [7,14], respectively. The decrease in the concentration of the substrate component (anthracene or pyrene) that underwent biodegradation was determined as follows:
C o n c . o f   d e g r .   c o m p . X   ( % ) =   ( i n i t i a l   c o n c .   o f   c o m p .   X ) − ( f i n a l   c o n c .   o f   c o m p .   X ) ( T o t a l   c o n c .   o f   c o m p . ) × 100   %
where X is the component of anthracene or pyrene PAHs that underwent degradation following an interaction time of 25 days [31]. The concentrations of biodegradation products were determined as follows:
B i o d e g .   p r o d u c t   c o m p a r i s o n   ( % ) = T o t a l   c o m p .   o f   b i o d e g r .   p r o d u c t s T o t a l   c o n c .   o f   c o m p . × 100   %
Equation (1) was used to calculate the degradation rate of anthracene and pyrene by a consortium of bacteria as a function of the recorded peak height data. The data was presented in Figure 4A–E and Figure 6A and Table 5. Equation (2) was used to determine the concentration of the degraded anthracene and pyrene components. The data was presented in Figure 6B. Equation (3) was used to determine the total concentration of biodegradation products. The data was presented in Figure 6C. Each result was compared to obtain the biodegradation ratio.

5. Conclusions

According to the results and their analysis, several conclusions can be drawn. The bacterial consortium succeeded in degrading 21.89% of anthracene and 7.71% of pyrene. The total concentration of PAHs reached 17.67%. Several types of biodegradation products were found in this study, including alcohols, aldehydes, carboxylic acids, ketones, and a small number of aromatic components. The use of a bacterial consortium was less effective in increasing the level of biodegradation of the tested PAHs, compared with the use of a single bacterium. This was presumably due to competition between bacterial cells in the media. Acidic biodegradation products limited the ability of bacterial cells to continue the biodegradation process. The research indicates that sponge symbiont bacteria whose body surface is covered with mucus have the potential to biodegrade PAHs.

6. Patents

There are three patents described in this manuscript in the public testing process stage, as recorded by the Ministry of Law and Human Rights of the Republic of Indonesia: (1) performance of microsymbionts from marine sponge culture as a biodegradator of polycyclic aromatic hydrocarbons (PAH), code registration: P15202008653; (2) tracing method for bacterial isolates isolated from marine sponges as biodegradator material for polycyclic aromatic hydrocarbons (PAH), registration code: S15201907661; (3) new metal-lo-clastic bacterial species cultured from marine sponges as biomaterials for adsorption of several kinds of heavy metals, registration code: P15202008653.

Author Contributions

Conceptualization, I.M., K.N. and M.K.; methodology; I.M., R.A. and K.N.; validation, R.A. (Rasheed Ahmad), R.A. (Ruzkiah Asaf) and M.P.; formal analysis, I.M. and A.A.; investigation, I.M. and M.P.; resources, I.M. and M.K.; data curation, K.N.; writing—original draft preparation, I.M.; writing—review and editing, K.N. and R.A. (Rasheed Ahmad); visualization, I.M.; supervision, R.A. (Ruzkiah Asaf); project administration, M.P. and A.A. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by the DRPM of the Ministry of Research, Technology, and Higher Education of the Republic of Indonesia, under contract number B/87/E3/RA.00/2020, dated 28 January 2020, and Fajar University, under Work Implementation Order number 25/AI/LPPM-UNIFA/IV/2020, dated 21 April 2020.

Institutional Review Board Statement

Research did not involve animals or humans as test material.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Acknowledgments

We acknowledge the support of Hasanuddin Biochemistry Laboratory, Department of Chemistry, for use of its facilities. The Makassar Plantation Product Industry Center (BBIHP) was a partner of this research.

Conflicts of Interest

The authors declare no conflict of interest.

Sample Availability

Samples of the compounds are available from the authors.

References

  1. Bendouz, M.; Dionne, D.; Tran, L.H.; Coudert, L.; Mercier, G.; Blais, J.F. Polycyclic Aromatic Hydrocarbon Oxidation from Concentrates Issued from an Attrition Process of Polluted Soil Using the Fenton Reagent and Permanganate. Water Air Soil Pollut. 2017, 228, 115. [Google Scholar] [CrossRef]
  2. Bezza, F.A.; Chirwa, E.M.N. Biosurfactant-enhanced bioremediation of aged polycyclic aromatic hydrocarbons (PAHs) in creosote contaminated soil Fisseha. Chemosphere 2016, 144, 635–644. [Google Scholar] [CrossRef]
  3. Dadrasnia, A.; Usman, M.M.; Lim, K.T.; Farahiyah, F.H.; Rodzhan, N.S.M.; Karim, S.H.A.; Ismail, S. Bio-Enhancement of Petroleum Hydrocarbon Polluted Soil Using Newly Isolated Bacteria. Polycycl. Aromat. Compd. 2020, 40, 484–493. [Google Scholar] [CrossRef]
  4. Fang, H.; Shi, Y.; Zhou, M.; Niu, Q. Influence of n-Hexadecane and Naphthalene on Anaerobic Digestion: Kinetic Simulation, DOM Variation and Microbial Community Assessment. IOP Conf. Ser. Earth Environ. Sci. 2020, 555, 012038. [Google Scholar] [CrossRef]
  5. Ja’nczuk, B.; Szymczyk, K.; Zdziennicka, A. Adsorption Properties of Hydrocarbon and Fluorocarbon Surfactants Ternary Mixture at the Water-Air Interface. Molecules 2021, 26, 4313. [Google Scholar] [CrossRef] [PubMed]
  6. Khabouchi, I.; Khadhar, S.; Chaouachi, D.; Chekirbene, A.; Doumenq, P. Study of organic pollution in superficial sediments of Meliane river catchment area: Aliphatic and polycyclic aro-matic hydrocarbons Study of organic pollution in superficial sediments of Meliane river catchment area: Aliphatic and polycyclic aromatic hydrocarbons. Enviroment Monit. Assess. 2020, 192, 282–290. [Google Scholar] [CrossRef]
  7. Lu, C.; Hong, Y.; Liu, J.; Gao, Y.; Ma, Z.; Yang, B.; Ling, W.; Waigi, M.G. A PAH-degrading bacterial community enriched with contaminated agricultural soil and its utility for microbial bioremediation. Environ. Pollut. 2019, 251, 773–782. [Google Scholar] [CrossRef]
  8. Medić, A.; Lješević, M.; Inui, H.; Beškoski, V.; Kojić, I.; Stojanović, K.; Karadžić, I. Efficient biodegradation of petroleum: N -alkanes and polycyclic aromatic hydrocarbons by polyextremophilic Pseudomonas aeruginosa san ai with multidegradative capacity. RSC Adv. 2020, 10, 14060–14070. [Google Scholar] [CrossRef] [Green Version]
  9. Parhamfar, M.; Abtahia, H.; Godinib, K.; Saeedi, R.; Sartaje, M.; Villaseñorf, J.; Coulong, F.; Kumarg, V.; Soltanighiash, T.; Radi, E.G.; et al. Biodegradation of heavy oily sludge by a two-step inoculation composting process using synergistic effect of indigenous isolated bacteria. Process Biochem. 2020, 91, 223–230. [Google Scholar] [CrossRef]
  10. Laothamteep, N.; Kawano, H.; Vejarano, F.; Minakuchi, C.S.; Shintani, M.; Nojiri, H.; Pinyakong, O. Effects of environmental factors and coexisting substrates on PAH degradation and transcriptomic responses of the defined bacterial consortium OPK. Environ. Pollut. 2021, 277, 116769. [Google Scholar] [CrossRef] [PubMed]
  11. Marzuki, I.; Kamaruddin, M.; Ahmad, R. Identification of marine sponges-symbiotic bacteria and their application in degrading polycyclic aromatic hydrocarbons. Bioivers. J. Biol. Divers. 2021, 22, 1481–1488. [Google Scholar] [CrossRef]
  12. Abass, O.K.; Zhuo, M.; Zhang, K. Concomitant degradation of complex organics and metals recovery from fracking wastewater: Roles of nano zerovalent iron initiated oxidation and adsorption. Chem. Eng. J. 2017, 328, 159–171. [Google Scholar] [CrossRef]
  13. Nursid, M.; Marraskuranto, E.; Atmojo, K.B.; Hartono, T.M.P.; Meinita, M.D.N. Investigation on antioxidant compounds from Marine Algae Extracts collected from Binuangeun Coast, Banten, Indonesia. Squalen Bull. Mar. Fish. Postharvest Biotechnol. 2016, 11, 59–67. [Google Scholar] [CrossRef] [Green Version]
  14. Onwosia, C.O.; Odibob, F.-J.K.; Enebechia, C.K.; Nwankwegub, A.S.; Ikeleb, A.I.; Okehc, O.C. Soil and Sediment Contamination: An International Bioremediation of Diesel-contaminated Soil by Composting with Locally Generated Bulking Agents Bioremediation of Diesel-contaminated. Soil Sediment. Contam. 2017, 26, 438–456. [Google Scholar] [CrossRef]
  15. Košnář, Z.; Částková, T.; Wiesnerová, L.; Praus, L.; Jablonský, I.; Koudela, M.; Tlustoš, P. Comparing the removal of polycyclic aromatic hydrocarbons in soil after different bioremediation approaches in relation to the extracellular enzyme activities. J. Environ. Sci. 2019, 76, 249–258. [Google Scholar] [CrossRef]
  16. Yetti, E.; Thontowi, A.; Yopi, Y.; Lisdiyanti, P. Screening of Marine bacteria capable of degrading various polyaromatic hydrocarbons. Squalen Bull. Mar. Fish. Postharvest Biotechnol. 2015, 10, 121–127. [Google Scholar] [CrossRef] [Green Version]
  17. Obire, O.; Aleruchi, O.; Wemedo, S. Fungi in Biodegradation of Polycyclic Aromatic Hydrocarbons in Oilfield Wastewater. Acta Sci. Microbiol. 2020, 3, 220–224. [Google Scholar] [CrossRef]
  18. Sinsona, M.-J.; Juinio, M.M.A. Effects of sediment enrichment with macroalgae, Sargassum spp., on the behavior, growth, and survival of juvenile sandfish, Holothuria scabra. Aquac. Rep. 2018, 12, 56–63. [Google Scholar] [CrossRef]
  19. Araújo, S.C.D.S.; Silva-Portela, R.C.B.; De Lima, D.C.; Da Fonsêca, M.M.B.; Araújo, W.J.; Da Silva, U.B.; Napp, A.; Pereira, E.; Vainstein, M.H.; Agnez-Lima, L.F. MBSP1: A biosurfactant protein derived from a metagenomic library with activity in oil degradation. Sci. Rep. 2020, 10, 1340–1352. [Google Scholar] [CrossRef] [Green Version]
  20. Campana, S.; Hudspith, M.; Lankes, D.; de Kluijver, A.; Demey, C.; Schoorl, J.; Absalahh, S.; der Meer, M.T.J.; Mueller, B.; de Goeij, J.-M. Processing of Naturally Sourced Macroalgal- and Coral-Dissolved Organic Matter (DOM) by High and Low Microbial Abundance Encrusting Sponges. Front. Mar. Sci. 2021, 8, 640583. [Google Scholar] [CrossRef]
  21. Gu, B.; Li, F.; Liu, Y.; Mao, L.; Tao, H. Effect of Vegetable Growth on Content and Composition of Antibiotics in Litopenaeus vannamei Pond Sediments in Crop/Aquacultural Rotation Process. Sustainability 2021, 13, 8400. [Google Scholar] [CrossRef]
  22. Maldonado, M.; López-Acosta, M.; Busch, K.; Slaby, B.M.; Bayer, K.; Beazley, L.; Hentschel, U.; Kenchington, E.; Rapp, H.T. A Microbial Nitrogen Engine Modulated by Bacteriosyncytia in Hexactinellid Sponges: Ecological Implications for Deep-Sea Communities. Front. Mar. Sci. 2021, 8, 638505. [Google Scholar] [CrossRef]
  23. Morganti, T.M.; Ribes, M.; Yahel, G.; Coma, R. Size Is the Major Determinant of Pumping Rates in Marine Sponges. Front. Physiol. 2019, 10, 1474. [Google Scholar] [CrossRef] [Green Version]
  24. Orani, A.M.; Barats, A.; Vassileva, E.; Thomas, O.P. Marine sponges as a powerful tool for trace elements biomonitoring studies in coastal environment. Mar. Pollut. Bull. 2018, 131, 633–645. [Google Scholar] [CrossRef] [Green Version]
  25. Page, H.N.; Hewett, C.; Tompkins, H.; Hall, E.R. Ocean acidification and direct interactions affect coral, macroalga, and sponge growth in the florida keys. J. Mar. Sci. Eng. 2021, 9, 739. [Google Scholar] [CrossRef]
  26. Pita, L.; Rix, L.; Slaby, B.M.; Franke, A.; Hentschel, U. The sponge holobiont in a changing ocean: From microbes to ecosystems. Microbiome 2018, 6, 46. [Google Scholar] [CrossRef] [PubMed]
  27. Turon, M.; Cáliz, J.; Garate, L.; Casamayor, E.O.; Uriz, M.J. Showcasing the role of seawater in bacteria recruitment and microbiome stability in sponges. Sci. Rep. 2018, 8, 15201. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  28. Campana, S.; Busch, K.; Hentschel, U.; Muyzer, G.; de Goeij, J.M. DNA-stable isotope probing (DNA-SIP) identifies marine sponge-associated bacteria actively utilizing dissolved organic matter (DOM). Environ. Microbiol. 2021, 23, 4489–4504. [Google Scholar] [CrossRef]
  29. Marzuki, I.; Sinardi, S.; Pratama, I.; Chaerul, M.; Paserangi, I.; Kamaruddin, M.; Asaf, R. Performance of sea sponges micro symbionts as a biomaterial in biodegradation naphthalene waste of modified. In Proceedings of the 5th International Seminar on Sustainable Urban Development, Jakarta, Indonesia, 5 August 2020; Volume 737, p. 012016. [Google Scholar] [CrossRef]
  30. Costa, G.; Violi, B.; Bavestrello, G.; Pansini, M.; Bertolino, M. Aplysina aerophoba (Nardo, 1833) (Porifera, Demospongiae): An unexpected miniaturised growth form the tidal zone of Mediterranean caves: Morphology and DNA barcoding. Eur. Zool. J. 2020, 87, 73–81. [Google Scholar] [CrossRef] [Green Version]
  31. Baquiran, J.I.P.; Nada, M.A.L.; Posadas, N.; Manogan, D.P.; Cabaitan, P.C.; Conaco, C. Population structure and microbial community diversity of two common tetillid sponges in a tropical reef lagoon. PeerJ 2020, 8, e9017. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  32. Marzuki, I.; Daris, L.; Nisaa, K.; Emelda, A. The power of biodegradation and bio-adsorption of bacteria symbiont sponges sea on waste contaminated of polycyclic aromatic hydrocarbons and heavy metals. In Proceedings of the International Conference on Fisheries and Marine, Ternate, Maluku, Indonesia, 13 July 2020; Volume 584, p. 012013. [Google Scholar] [CrossRef]
  33. Yang, Q.; Franco, C.M.M.; Lin, H.W.; Zhang, W. Untapped sponge microbiomes: Structure specificity at host order and family levels. FEMS Microbiol. Ecol. 2019, 95, fiz136. [Google Scholar] [CrossRef] [PubMed]
  34. Lavy, A.; Keren, R.; Haber, M.; Schwartz, I.; Ilan, M. Implementing sponge physiological and genomic information to enhance the diversity of its culturable associated bacteria. FEMS Microbiol. Ecol. 2014, 87, 486–502. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  35. Fu, X.; Wang, H.; Bai, Y.; Xue, J.; Gao, Y.; Hu, S.; Wu, T.; Sum, J. Systematic degradation mechanism and pathways analysis of the immobilized bacteria: Permeability and biodegradation, kinetic and molecular simulation. Environ. Sci. Ecotechnol. 2020, 2, 100028. [Google Scholar] [CrossRef]
  36. Su, X.M.; Bamba, A.M.; Zhang, S.; Zhang, Y.G.; Hashmi, M.Z.; Lin, H.J.; Ding, L.X. Revealing potential functions of VBNC bacteria in polycyclic aromatic hydrocarbons biodegradation. Lett. Appl. Microbiol. 2018, 66, 277–283. [Google Scholar] [CrossRef] [Green Version]
  37. Marzuki, I.; Daris, L.; Yunus, S.; Riana, A.D. Selection and characterization of potential bacteria for polycyclic aromatic biodegradation of hydrocarbons in sea sponges from Spermonde Islands, Indonesia. Aquac. Aquar. Conserv. Legis. 2020, 13, 3493–3506. [Google Scholar]
  38. Rua, C.P.J.; de Oliveira, L.S.; Froes, A.; Tschoeke, D.A.; Soares, A.C.; Leomil, L.; Gregoracci, G.B.; Coutinho, R.; Hajdu, E.; Thompson, C.C.; et al. Microbial and Functional Biodiversity Patterns in Sponges that Accumulate Bromopyrrole Alkaloids Suggest Horizontal Gene Transfer of Halogenase Genes. Microb. Ecol. 2018, 76, 825–838. [Google Scholar] [CrossRef]
  39. Al-Dhabaan, F.A. Morphological, biochemical and molecular identification of petroleum hydrocarbons biodegradation bacteria isolated from oil polluted soil in Dhahran, Saud Arabia. Saudi J. Biol. Sci. 2019, 26, 1247–1252. [Google Scholar] [CrossRef]
  40. Miao, L.L.; Qu, J.; Liu, Z.P. Hydroxylation at Multiple Positions Initiated the Biodegradation of Indeno[1,2,3-cd]Pyrene in Rhodococcus aetherivorans IcdP1. Front. Microbiol. 2020, 11, 568381. [Google Scholar] [CrossRef] [PubMed]
  41. Cui, X.; Tian, J.; Yu, Y.; Chand, A.; Zhang, S.; Meng, Q.; Li, X.; Wang, S. Multifunctional graphene-based composite sponge. Sensors 2020, 20, 329. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  42. Marzuki, I.; Ali, M.Y.; Syarif, H.U.; Gusty, S.; Ritnawati, R.; Daris, L.; Nisaa, K. Investigation of Biodegradable Bacteria as Bio indicators of the Presence of PAHs Contaminants in Marine Waters in the Marine Tourism Area of Makassar City. In Proceedings of 6th International Conference on Tropical Coastal Region Eco-Development, Semarang, Indonesia. IOP Conf. Ser. Earth Environ. Sci. 2020, 750, 012006. [Google Scholar] [CrossRef]
  43. Khan, M.N.; Ullah, H.; Naeem, S.; Uddin, J.; Hamid, Y.; Ahmad, W.; Ding, J. Remediation of Emerging Heavy Metals from Water Using Natural Adsorbent: Adsorption Performance and Mechanistic Insights. Sustainability 2021, 13, 8817. [Google Scholar] [CrossRef]
  44. Siahaya, N.; Noor, A.; Sukamto, N.; de Voogd, N. A preliminary effort to assign sponge (Callispongia sp.) as trace metal biomonitor for Pb, Cd, Zn, and Cr, an environmental perspective in Hative gulf waters Ambon. Adv. Biol. Chem. 2013, 3, 549–552. [Google Scholar] [CrossRef] [Green Version]
  45. Melawaty, L.; Noor, A.; Harlim, T.; de Voogd, N. Essential metal Zn in sponge Callyspongia aerizusa from Spermonde Archipelago. Adv. Biol. Chem. 2014, 4, 86–90. [Google Scholar] [CrossRef] [Green Version]
  46. Karimpour, M.; Ashrafi, S.D.; Taghavi, K.; Mojtahedi, A.; Roohbakhsh, E.; Naghipur, D. Adsorption of cadmium and lead onto live and dead cell mass of Pseudomonas aeruginosa: A dataset. Data Brief 2018, 18, 1185–1192. [Google Scholar] [CrossRef] [PubMed]
  47. Schmittmann, L.; Jahn, M.T.; Pita, L.; Hentschel, U. Decoding cellular dialogues between sponges, bacteria, and phages. In Cellular Dialogues in the Holobiont, 1st ed.; CRC Press: Boca Raton, FL, USA, 2020; pp. 49–63. [Google Scholar] [CrossRef]
  48. Bart, M.C.; Hudspith, M.; Rapp, H.T.; Verdonschot, P.F.M.; de Goeij, J.M. A Deep-Sea Sponge Loop? Sponges Transfer Dissolved and Particulate Organic Carbon and Nitrogen to Associated Fauna. Front. Mar. Sci. 2021, 8, 604879. [Google Scholar] [CrossRef]
  49. Arjuna, A.; Olson, M.T.; Tokman, S.; Walia, R.; Mohanakumar, T.; Hashimi, A. Samad.; Smith, M.A.; Bremner, R.M.; Omar, A.; Norton, N. Antibody-Mediated Rejection and Sponge Effect in a Redo Lung Transplant Recipient. Case Rep. Transplant. 2021, 2021, ID6637154. [Google Scholar] [CrossRef]
  50. Weigel, B.L.; Erwin, P.M. Effects of reciprocal transplantation on the microbiome and putative nitrogen cycling functions of the intertidal sponge, Hymeniacidon heliophila. Sci. Rep. 2017, 7, 43247. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  51. Xu, X.; Hu, J.; Lu, H. Histological observation of a gelatin sponge transplant loaded with bone marrow-derived mesenchymal stem cells combined with platelet-rich plasma in repairing an annulus defect. PLoS ONE 2017, 12, e0171500. [Google Scholar] [CrossRef] [Green Version]
  52. Guo, J.; Wen, X. Performance and kinetics of benzo(a)pyrene biodegradation in contaminated water and soil and improvement of soil properties by biosurfactant amendment. Ecotoxicol. Environ. Saf. 2021, 207, 111292. [Google Scholar] [CrossRef]
  53. Ray, M.; Kumar, V.; Banerjee, C.; Gupta, P.; Singh, S.; Singh, A. Investigation of biosurfactants produced by three indigenous bacterial strains, their growth kinetics and their anthracene and fluorene tolerance. Ecotoxicol. Environ. Saf. 2021, 208, 111621. [Google Scholar] [CrossRef]
  54. Smułek, W.; Sydow, M.; Matejuk, Z.J.; Kaczorek, E. Bacteria involved in biodegradation of creosote PAH—A case study of long-term contaminated industrial area. Ecotoxicol. Environ. Saf. 2020, 187, 109843. [Google Scholar] [CrossRef] [PubMed]
  55. Tziveleka, L.-A.; Ioannou, E.; Tsiourvas, D.; Berillis, P.; Foufa, E.; Roussis, V. Collagen from the marine sponges Axinella cannabina and Suberites carnosus: Isolation and morphological, biochemical, and biophysical characterization. Mar. Drugs 2017, 15, 152. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  56. Arroyo, A.; Provoste, F.; Rodríguez, M.; Prieto, A.L. A mechanistic model to assess the fate of naphthalene and benzo(A)pyrene in a chilean wwtp. Processes 2021, 9, 1313. [Google Scholar] [CrossRef]
  57. Scheuch, G.A.; Zuñiga, J.R.; Fuentes, E.; Bravo, D.; Donoso, J.M.P. Effect of co-contamination by PAHs and heavy metals on bacterial communities of diesel contaminated soils of south shetland islands, antarctica. Microorganisms 2020, 8, 1749. [Google Scholar] [CrossRef] [PubMed]
  58. Marzuki, I.; Pratama, I.; Ismail, H.E.; Paserangi, I.; Kamaruddin, M.; Chaerul, M.; Ahmad, R. The Identification and Distribution Components of Polycyclic Aromatic Hydrocarbon Contaminants at the Port of Paotere, Makassar, South Sulawesi. In Proceedings of the the 1st International Conference on Biotechnology and Food Sciences, Surabaya, Indonesia, 11 September 2021; Volume 679, p. 012017. [Google Scholar] [CrossRef]
  59. Cappuccino, J.G.; Sherman, N. Microbiology: A Laboratory Manual, 10th ed.; Rockland Community College, Inc., Publishing as Benjamin Cummings: San Fransisco, CA, USA, 2014; pp. 110–168. [Google Scholar]
Molecules 26 06851 g001 550
Figure 1. The morphology of marine sponge Niphates sp. (Sp1): (A) consistency; (B) surface; (C) skeleton; (D) skeletal tract; (E) spicules (40×).
Figure 1. The morphology of marine sponge Niphates sp. (Sp1): (A) consistency; (B) surface; (C) skeleton; (D) skeletal tract; (E) spicules (40×).
Molecules 26 06851 g001
Molecules 26 06851 g002 550
Figure 2. The morphology of marine sponge Hyrtios erectus (Sp2): (A) consistency; (B) surface; (C) choanosomes; (D) skeleton; (E) spicules (10×).
Figure 2. The morphology of marine sponge Hyrtios erectus (Sp2): (A) consistency; (B) surface; (C) choanosomes; (D) skeleton; (E) spicules (10×).
Molecules 26 06851 g002
Molecules 26 06851 g003 550
Figure 3. Morphology of the marine sponge Clathria (Thalysias) reinwardtii (Sp3): (A) consistency; (B) projection; (C) choanosome; (D) megasclere; (E) microsclera in the form of chelae (40×).
Figure 3. Morphology of the marine sponge Clathria (Thalysias) reinwardtii (Sp3): (A) consistency; (B) projection; (C) choanosome; (D) megasclere; (E) microsclera in the form of chelae (40×).
Molecules 26 06851 g003
Molecules 26 06851 g004 550
Figure 4. GC–MS spectrum showing the biodegradation performance of the marine sponge consortium bacterial suspension in terms of the abundance of anthracene and pyrene components and new peaks related to biodegradation products as a function of interaction time: peak abundance after (A) 5 days of interaction, (B) 10 days of interaction, (C) 15 days of interaction, (D) 20 days of interaction, and (E) 25 days of interaction.
Figure 4. GC–MS spectrum showing the biodegradation performance of the marine sponge consortium bacterial suspension in terms of the abundance of anthracene and pyrene components and new peaks related to biodegradation products as a function of interaction time: peak abundance after (A) 5 days of interaction, (B) 10 days of interaction, (C) 15 days of interaction, (D) 20 days of interaction, and (E) 25 days of interaction.
Molecules 26 06851 g004
Molecules 26 06851 g005 550
Figure 5. FTIR spectra displaying the functional groups of biodegradation products as a function of the interaction time: (A) 5 days of interaction, (B) 10 days of interaction, (C) 15 days of interaction, (D) 20 days of interaction, and (E) 25 days of interaction.
Figure 5. FTIR spectra displaying the functional groups of biodegradation products as a function of the interaction time: (A) 5 days of interaction, (B) 10 days of interaction, (C) 15 days of interaction, (D) 20 days of interaction, and (E) 25 days of interaction.
Molecules 26 06851 g005
Molecules 26 06851 g006 550
Figure 6. Biodegradation performance of anthracene and pyrene by consortium of marine sponge symbiotic bacteria as a function of contact time. (A) Abundance of anthracene and pyrene corresponding to the peak height obtained in the GC–MS analysis; (B) reduction in anthracene and pyrene components; (C) percentage abundance of anthracene and pyrene.
Figure 6. Biodegradation performance of anthracene and pyrene by consortium of marine sponge symbiotic bacteria as a function of contact time. (A) Abundance of anthracene and pyrene corresponding to the peak height obtained in the GC–MS analysis; (B) reduction in anthracene and pyrene components; (C) percentage abundance of anthracene and pyrene.
Molecules 26 06851 g006
Table
Table 1. Characteristics of seawater at sampling points for sponges around Kodingareng Keke Island.
Table 1. Characteristics of seawater at sampling points for sponges around Kodingareng Keke Island.
Sample CodeCoordinateSalinity (‰)Temperature
((°C)		pHTDS
(mg/L)		EC
(ds/m)		Depth MSL (m)Distance from the Beach (m)
Sp15°6′ 38, 12376″ S28.329.47.477.4114.463.20200
119° 17′70, 76544″ E
Sp25°6′ 11, 62476″ S28.130.97.697.2114.203.74250
119° 17′60, 06228″ E
Sp35°6′ 23, 55372″ S27.330.37.707.5012.874.25370
190° 20′27, 62376″ E
TDS: total dissolved solid, EC: electrical conductivity, MSL: mean sea level.
Table
Table 2. Phenotypic characteristics of marine sponge symbiont bacterial isolates.
Table 2. Phenotypic characteristics of marine sponge symbiont bacterial isolates.
ParametersMarine Sponge Symbiont Bacteria Isolate
Sp1 (Niphates sp.)Sp2 (Hyrtios erectus)Sp3 (Clathria (Thalysias) reinwardtii)
Morphologyjagged stem shape, cream color, clustered distribution, endospore is less clearjagged stem shape, brown color, separate distribution with endosporesround shape, bluish-cream color, clustered distribution, endospores are less clear
Gram stainingreaction (−) with safranin reagent and (−) with 1% KOH alkaline solvent, Gram (+)fixed color with safranin reagent and (−) with 1% KOH alkaline solvent, Gram (+)reaction (−) with safranin and (−) with 1% KOH alkaline solvent, Gram (+)
Indole test−−+
Triple sugar iron agar (TSIA)++−
Nitrate test++−
Simmons citrate test−++
Methyl red (Mr) test−++
Voges–Proskauer (VP) test+−+
Urease test+++
Provisional guessBacillus groupPseudomonas groupAcinetobacter group
Note: − negative reaction; + positive reaction.
Table
Table 3. Genotypic characteristics of marine sponge symbiont isolates by 16S rRNA gene sequence.
Table 3. Genotypic characteristics of marine sponge symbiont isolates by 16S rRNA gene sequence.
Bacterial IsolateSequence SamplesRange Sequence
Gen-Bank		Identities Quality (%)Gaps
(%)		Species Type
Sp1-Bc15–967
(952)		710,748–711,700
(952)		922/956
(96.44)		6/956
(0.63)		Bacillus pumilus strain GLB197
Sp2-Ps14–975
(961)		3,666,632–3,667,587 (955)890/974
(91.14)		30/974
(3.08)		Pseudomonas stutzeri strain SLG510A3-8
Sp3-Ac9–961
(952)		12–964
(952)		951/954
(99.69)		2/954
(0.21)		Acinetobacter calcoaceticus strain SLCDA976
Table
Table 4. Biodegradation parameters of bacterial consortium suspension toward the PAH contaminants.
Table 4. Biodegradation parameters of bacterial consortium suspension toward the PAH contaminants.
Biodegradation ParametersInteraction Period (Days)
0510152025
Turbidity of interaction media (NTU)1.016.5612.8217.6224.8326.43
Temperature (°C)292930303029
pH6.676.686.136.106.066.43
Abundance of gas bubblesntnt++++++
Fermentation smellntnt√√√√√√√
nt: not detected; + gas bubbles appear less abundant; ++ abundance of gas bubbles; √ weak fermentation smell; √√ strong fermentation smell.
Table
Table 5. GC–MS data on biodegradation of PAHs by a consortium of marine sponge bacterial symbionts.
Table 5. GC–MS data on biodegradation of PAHs by a consortium of marine sponge bacterial symbionts.
Peak NumberRetention TimeComp. Peak Height (106)Quality
(%)		Total Conc.
(%)		Group of Comp.Approximate Comp. on the Library/ ID
Interaction time 5 days
110.2870.182951.057AromaticNaphthalene
217.4680.120470.424Aldehyde---
318.56610.4079545.693Aromatic **Anthracene
421.81910.9029651.914Aromatic **Pyrene
524.9470.223900.912AlcoholPhenol
Interaction time 10 days
16.0830.132910.959MethylCyclotetrasiloxane
217.4710.794533.752Aldehyde---
318.5598.5689540.589Aromatic **Anthracene
421.3090.239781.401Aldehyde---
521.8099.1139650.686Aromatic **Pyrene
624.9440.185901.070AlcoholPhenol
726.8240.240621.543Carboxylic acid---
Interaction time 15 days
16.0880.109910.558OrganosiliconCyclotetrasiloxane
217.4710.471531.663Carboxylate---
318.5647.2339638.311Aromatic **Anthracene
421.3110.139720.561Indole, aldehyde---
521.8188.9209649.619Aromatic **Pyrene
622.0850.080930.384AmideHexadecanamide
723.6370.187910.760Amide9-octadecetamide
823.6850.123931.084Amide9-octadecenamide
924.9440.506931.824Alcohol aromaticPhenol
1026.8230,700813.236Carboxylate---
Interaction time 20 days
116.7280.131981.858AlcoholBenzenemethanol
217.4670.139530.982Carboxylate---
318.5534.8449536.105Aromatic **Anthracene
420.3290.141460.946Aliphatic---
520.7760.199431.323Aliphatic---
621.8037.9809648.603Aromatic **Pyrene
724.9440.163931.168Alcohol aromaticPhenol
826.8230.219492.016CarboxylateTetraphtelic acid
Interaction time 25 days
117.4700.242641.112Methylene---
218.5604.1329535.297Aromatic **Anthracene
320.3320.148470.697Sulfurous acid---
420.7780.332471.508Aliphatic---
521.1400.178471.253Alcohol aromatic---
621.8117.9029647.959Aromatic **Pyrene
724.9440.126780.681Alcohol aromatic---
826.8230.234911.504CarboxylateTetraphtelic acid
--- The compound cannot be determined with certainty because the quality was below 90%; ** components of PAHs (anthracene and pyrene) that were degraded.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Marzuki, I.; Asaf, R.; Paena, M.; Athirah, A.; Nisaa, K.; Ahmad, R.; Kamaruddin, M. Anthracene and Pyrene Biodegradation Performance of Marine Sponge Symbiont Bacteria Consortium. Molecules 2021, 26, 6851. https://doi.org/10.3390/molecules26226851

AMA Style

Marzuki I, Asaf R, Paena M, Athirah A, Nisaa K, Ahmad R, Kamaruddin M. Anthracene and Pyrene Biodegradation Performance of Marine Sponge Symbiont Bacteria Consortium. Molecules. 2021; 26(22):6851. https://doi.org/10.3390/molecules26226851

Chicago/Turabian Style

Marzuki, Ismail, Ruzkiah Asaf, Mudian Paena, Admi Athirah, Khairun Nisaa, Rasheed Ahmad, and Mudyawati Kamaruddin. 2021. "Anthracene and Pyrene Biodegradation Performance of Marine Sponge Symbiont Bacteria Consortium" Molecules 26, no. 22: 6851. https://doi.org/10.3390/molecules26226851

Article Metrics

Back to TopTop