Search Results (9)

Valorization of agri-food residues has garnered significant interest for obtaining value-added compounds such as enzymes or bioactive molecules. Rice milling by-products, such as rice bran, have limited commercial value and may pose environmental challenges. Filamentous fungi are recognized for their ability to grow on residues and for their capacity to produce large amounts of metabolites and enzymes of industrial interest. Here, we used filamentous fungi to produce enzyme cocktails from rice bran, which, due to its polysaccharide composition, serves as an ideal substrate for the growth of fungi producing cellulases and xylanases. To this end, sixteen fungal strains were isolated from rice bran and identified at the species level. The species belonged to the genera Aspergillus, Penicillium, and Mucor. The Aspergillus species displayed the highest efficiency in cellulase and xylanase activities, especially A. niger var. phoenicis and A. amstelodami. A. terreus, A. tritici, and A. montevidensis stood out as xylanolytic isolates, while P. parvofructum exhibited good cellulase activity. A. niger var. phoenicis followed by A. terreus showed the highest specific enzymatic activities of α- and β-D-galactosidase, α-L-arabinofuranosidase, α- and β-D-glucosidase, and β-D-xylosidase. Additionally, proteomic analysis of A. terreus, A. niger var. phoenicis, and P. parvofructum exoproteomes revealed differences in enzyme production for rice bran degradation. A. niger var. phoenicis had the highest levels of xylanases and cellulases, while P. parvofructum excelled in proteases, starch-degrading enzymes, and antifungal proteins. Finally, two Penicillium isolates were notable as producers of up to three different antifungal proteins. Our results demonstrate that filamentous fungi can effectively valorize rice bran by producing enzyme cocktails of industrial interest, along with bioactive peptides, in a cost-efficient manner, aligning with the circular bio-economy framework. Full article

Recently, in several locations in the province of Trapani (Sicily, Italy), olive growers have reported cases of decaying olive trees of cv. ‘Nocellara del Belice’, showing symptoms of defoliation, branch drying, xylem browning, and reduced production. Internal symptoms include white and brown wood rot, starting from the base of the trunk. These alterations have been observed in trees irrigated using a pipe system at the trunk with spray sprinklers. To identify the causal agents of decay, some trees were eradicated and dissected, and woody samples were processed to isolate and identify the associated fungal micro-organisms. The most common colonies were identified using morphological (macro- and microscopical observation) and molecular (PCR amplification of the rDNA-ITS region) analyses. Nine fungal taxa were identified, of which four were associated with this decay syndrome (Coriolopsis gallica, Fomitiporia mediterranea, Kirschsteiniothelia sp., and Pleurostoma richardsiae), three were considered ubiquitous and opportunistic fungi (Alternaria spp., Aspergillus amstelodami, and Trichoderma sp.), and the other two were mycelia sterilia. Artificial inoculation satisfied Koch’s postulates, confirming the pathogenicity of the aforementioned fungi, even though the infections in the fields seem to be related to the irrigation system. This hypothesis would seem to be confirmed by the progression of decay over time in the trees subjected to the irrigation system described but not reported in olive groves differently managed. It is therefore considered appropriate to conduct further and more in-depth investigations aimed at studying the correlation between the irrigation system, presence of fungal agents, and manifestation of the syndrome. A further ongoing investigation is aimed at the use of biostimulants (Agrusaver, Savory Sun, VA LLC) on symptomatic trees, with the aim of both improving the vegetative performance of the host and limiting the symptoms detected in the field. Full article

This study aimed to investigate the alkaloid secondary metabolites of Aspergillus amstelodami BSX001, a fungus isolated from Anhua dark tea, and to improve the extraction yield of the active ingredients by optimizing the extraction process. The structural characterization of the compounds was investigated using mass spectrometry (MS) and nuclear magnetic resonance (NMR) spectroscopy. The antioxidant activity of echinulin-related alkaloids was evaluated by determining the total reducing power and DPPH radical scavenging capacity. The extraction process of the compound with optimum activity was optimized by a single-factor test and response surface methodology (RSM) combined with Box–Behnken design (BBD). The optimized result was validated. Finally, a new alkaloid 8-hydroxyechinulin (1), and four known alkaloids, variecolorin G (2), echinulin (3), neoechinulin A (4), and eurocristatine (5), were isolated. Echinulin-related compounds 1, 3, and 4 possessed certain antioxidant activities, with IC₅₀ values of 0.587 mg/mL, 1.628 mg/mL, and 0.219 mg/mL, respectively, against DPPH radicals. Their total reducing power at a concentration of 0.5 mg/mL was 0.29 mmol/L, 0.17 mmol/L, and 4.25 mmol/L. The extraction process of neoechinulin A was optimized with the optimum extraction parameters of 72.76% methanol volume fraction, 25 mL/g solid–liquid ratio, and 50.8 °C soaking temperature. Under these conditions, the extraction yield of neoechinulin A was up to 1.500 mg/g. Full article

The study explored the potential protective impact of the probiotic fungus Eurotium amstelodami in Fuzhuan brick tea on ulcerative colitis, along with the underlying mechanism. A spore suspension of E. amstelodami was administered to C57BL/6 mice to alleviate DSS-induced colitis. The findings indicated that administering E. amstelodami evidently enhanced the ultrastructure of colonic epithelium, showing characteristics such as enhanced TJ length, reduced microvilli damage, and enlarged intercellular space. After HLL supplementation, the activation of the liver inflammation pathway, including TLR4/NF-kB and NLRP3 inflammasome caused by DSS, was significantly suppressed, and bile acid metabolism, linking liver and gut, was enhanced, manifested by restoration of bile acid receptor (FXR, TGR5) level. The dysbiosis of the gut microbes in colitis mice was also restored by HLL intervention, characterized by the enrichment of beneficial bacteria (Lactobacillus, Bifidobacterium, Akkermansia, and Faecalibaculum) and fungi (Aspergillus, Trichoderma, Wallemia, Eurotium, and Cladosporium), which was closely associated with lipid metabolism and amino acid metabolism, and was negatively correlated with inflammatory gene expression. Hence, the recovery of gut microbial community structure, implicated deeply in the inflammatory index and metabolites profile, might play a crucial role in the therapeutic mechanism of HLL on colitis. Full article

The high demand for keratinolytic enzymes and the modest presentation of fungal keratinase diversity studies in scientific sources cause a significant interest in identifying new fungal strains of keratinase producers, isolating new enzymes and studying their properties. Four out of the 32 cultures showed a promising target activity on protein-containing agar plates—Aspergillus amstelodami A6, A. clavatus VKPM F-1593, A. ochraceus 247, and Cladosporium sphaerospermum 1779. The highest values of keratinolytic activity were demonstrated by extracellular proteins synthesized by Aspergillus clavatus VKPM F-1593 cultivated under submerged conditions on a medium containing milled chicken feathers. The enzyme complex preparation was obtained by protein precipitation from the culture liquid with ammonium sulfate, subsequent dialysis, and lyophilization. The fraction of a pure enzyme with keratinolytic activity (pI 9.3) was isolated by separating the extracellular proteins of A. clavatus VKPM F-1593 via isoelectric focusing. The studied keratinase was an alkaline subtilisin-like non-glycosylated protease active over a wide pH range with optimum keratinolysis at pH 8 and 50 °C. Full article

Flaxseed (Linum usitatissimum L.) displays functional properties and contains α-linolenic acid (omega-3). It also contains soluble and insoluble fiber, lignans, phenolic acids, flavonoids, phytic acid, vitamins, and minerals. However, its microbiota can cause fungal contaminations, drastically reducing its quality. The objective of this work was to identify the fungi present in bulk flaxseed through the internal transcribed spacer (ITS1) intergenic region using a metataxonomics approach. Fungal identification was performed via high-performance sequencing of the ITS1 region using ITS1 (GAACCWGCGGARGGATCA) and ITS2 (GCTGCGTTCTTCATCGATGC) as primers with 300 cycles and single-end sequencing in the MiSeq Sequencing System equipment (Illumina Inc., San Diego, CA, USA). Six genera and eight species of fungi were found in the sample. The genus Aspergillus stood out with three xerophilic species found, A. cibarius, A. Appendiculatus, and A. amstelodami, the first being the most abundant. The second most abundant genus was Wallemia, with the species W. muriae. This is one of the fungi taxa with great xerophilic potential, and some strains can produce toxins. Metataxonomics has proved to be a complete, fast, and efficient method to identify different fungi. Furthermore, high-performance genetic sequencing is an important ally in research, helping to develop novel technological advances related to food safety. Full article

Ammi majus L.; Family Apiaceae; is a plant indigenous to Egypt. Its fruits contain bioactive compounds such as furanocoumarins and flavonoids of important biological activities. An endophytic fungus was isolated from the fruits and identified as Aspergillus amstelodami (MK215708) by morphology, microscopical characterization, and molecular identification. To our knowledge this is the first time an endophytic fungus has been isolated from the fruits. The antimicrobial activity of the Ammi majus ethanol fruits extract (AME) and fungal ethyl acetate extract (FEA) were investigated, where the FEA showed higher antimicrobial activity, against all the tested standard strains. Phytochemical investigation of the FEA extract yielded five prenylated benzaldehyde derivative compounds isolated for the first time from this species: Dihydroauroglaucin (1), tetrahydroauroglaucin (2), 2-(3,6-dihydroxyhepta-1,4-dien-1-yl)-3,6-dihydroxy-5-(dimethylallyl)benzaldehyde (3), isotetrahydroauroglaucin )4), and flavoglaucin (5). Structure elucidation was carried out using (1H- and 13C-NMR). Fractions and the major isolated compound 1 were evaluated for their antimicrobial and antibiofilm activity. Compound 1 showed high antimicrobial activity against Escherichia coli with minimum inhibitory concentration (MIC) = 1.95 µg/mL, Streptococcus mutans (MIC = 1.95 µg/mL), and Staphylococcus aureus (MIC = 3.9 µg/mL). It exhibited high antibiofilm activity with minimum biofilm inhibitory concentration (MBIC) = 7.81 µg/mL against Staphylococcus aureus and Escherichia coli biofilms and MBIC = 15.63 µg/mL against Streptococcus mutans and Candida albicans and moderate activity (MBIC = 31.25 µg/mL) against Pseudomonas aeruginosa biofilm. This reveals that dihydroauroglaucin, a prenylated benzaldehyde derivative, has a broad spectrum antimicrobial activity. In conclusion, it was observed that the MICs of the FEA are much lower than that of the AME against all susceptible strains, confirming that the antimicrobial activity of Ammi majus may be due to the ability of its endophytic fungi to produce effective secondary metabolites. Full article

A new miniaturized sensor system with an internal optical reference for the detection of mold growth is presented. The sensor chip comprises a reaction chamber provided with a culture medium that promotes the growth of mold species from mold spores. The mold detection is performed by measuring impedance changes with integrated electrodes fabricated inside the reaction chamber. The impedance change in the culture medium is caused by shifts in the pH (i.e., from 5.5 to 8) as the mold grows. In order to determine the absolute pH value without the need for calibration, a methyl red indicator dye has been added to the culture medium. It changes the color of the medium as the pH passes specific values. This colorimetric principle now acts as a reference measurement. It also allows the sensitivity of the impedance sensor to be established in terms of impedance change per pH unit. Major mold species that are involved in the contamination of food, paper and indoor environments, like Fusarium oxysporum, Fusarium incarnatum, Eurotium amstelodami, Aspergillus penicillioides and Aspergillus restrictus, have been successfully analyzed on-chip. Full article

In this study, a fluorescence resonance energy transfer (FRET)-based quantum dot (QD) immunoassay for detection and identification of Aspergillus amstelodami was developed. Biosensors were formed by conjugating QDs to IgG antibodies and incubating with quencher-labeled analytes; QD energy was transferred to the quencher species through FRET, resulting in diminished fluorescence from the QD donor. During a detection event, quencher-labeled analytes are displaced by higher affinity target analytes, creating a detectable fluorescence signal increase from the QD donor. Conjugation and the resulting antibody:QD ratios were characterized with UV-Vis spectroscopy and QuantiT protein assay. The sensitivity of initial fluorescence experiments was compromised by inherent autofluorescence of mold spores, which produced low signal-to-noise and inconsistent readings. Therefore, excitation wavelength, QD, and quencher were adjusted to provide optimal signal-to-noise over spore background. Affinities of anti-Aspergillus antibody for different mold species were estimated with sandwich immunoassays, which identified A. fumigatus and A. amstelodami for use as quencher-labeled- and target-analytes, respectively. The optimized displacement immunoassay detected A. amstelodami concentrations as low as 10³ spores/mL in five minutes or less. Additionally, baseline fluorescence was produced in the presence of 10⁵ CFU/mL heat-killed E. coli O157:H7, demonstrating high specificity. This sensing modality may be useful for identification and detection of other biological threat agents, pending identification of suitable antibodies. Overall, these FRET-based QD-antibody biosensors represent a significant advancement in detection capabilities, offering sensitive and reliable detection of targets with applications in areas from biological terrorism defense to clinical analysis. Full article