Next Article in Journal
Dengue Virus Infection and Associated Risk Factors in Africa: A Systematic Review and Meta-Analysis
Next Article in Special Issue
Kinetics of Neutralizing Antibodies of COVID-19 Patients Tested Using Clinical D614G, B.1.1.7, and B 1.351 Isolates in Microneutralization Assays
Previous Article in Journal
Recombination Events Shape the Genomic Evolution of Infectious Bronchitis Virus in Europe
Previous Article in Special Issue
Experimental Challenge of Sheep and Cattle with Dugbe Orthonairovirus, a Neglected African Arbovirus Distantly Related to CCHFV
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Redondoviridae: High Prevalence and Possibly Chronic Shedding in Human Respiratory Tract, But No Zoonotic Transmission

by
Nguyen Thi Kha Tu
1,2,3,*,
Xutao Deng
4,5,
Nguyen Thi Thu Hong
2,
Nguyen Thi Han Ny
2,
Tran My Phuc
2,
Pham Thi Thanh Tam
2,
Duong An Han
3,
Luu Thi Thu Ha
3,
Guy Thwaites
2,6,
H. Rogier van Doorn
6,7,
Anna-Maija K. Virtala
8,†,
Eric Delwart
4,5,†,
Stephen Baker
9,†,
Olli Vapalahti
1,8,10,
Le Van Tan
2,* and
on behalf of the VIZIONS Consortium
1
Doctoral School in Health Sciences, Faculty of Medicine, University of Helsinki, 00014 Helsinki, Finland
2
Emerging Infection Group, Oxford University Clinical Research Unit, Ho Chi Minh City 7000, Vietnam
3
Dong Thap Provincial Center for Disease Control, Cao Lanh City 660273, Dong Thap Province, Vietnam
4
Department of Laboratory Medicine, University of California, San Francisco, CA 94143, USA
5
Vitalant Research Institute, San Francisco, CA 94118, USA
6
Centre for Tropical Medicine and Global Health, Nuffield Department of Medicine, University of Oxford, Oxford OX3 7LG, UK
7
Oxford University Clinical Research Unit, Ha Noi 8000, Vietnam
8
Department of Veterinary Biosciences, Faculty of Veterinary Medicine, University of Helsinki, 00014 Helsinki, Finland
9
Cambridge Institute of Therapeutic Immunology & Infectious Disease (CITIID), Department of Medicine, University of Cambridge, Cambridge CB2 0QQ, UK
10
Virology and Immunology, HUSLAB, Helsinki University Hospital, 00029 Helsinki, Finland
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
The members of the VIZIONS Consortium are listed in the Acknowledgements.
Viruses 2021, 13(4), 533; https://doi.org/10.3390/v13040533
Submission received: 8 January 2021 / Revised: 19 March 2021 / Accepted: 19 March 2021 / Published: 24 March 2021
(This article belongs to the Special Issue Viral Zoonoses and Global Public Health)

Abstract

Redondoviridae is a recently discovered DNA virus family consisting of two species, vientovirus and brisavirus. Here we used PCR amplification and sequencing to characterize redondoviruses in nasal/throat swabs collected longitudinally from a cohort of 58 individuals working with animals in Vietnam. We additionally analyzed samples from animals to which redondovirus DNA-positive participants were exposed. Redondoviruses were detected in approximately 60% of study participants, including 33% (30/91) of samples collected during episodes of acute respiratory disease and in 50% (29/58) of baseline samples (with no respiratory symptoms). Vientovirus (73%; 24/33) was detected more frequently in samples than brisaviruses (27%; 9/33). In the 23 participants with at least 2 redondovirus-positive samples among their longitudinal samples, 10 (43.5%) had identical redondovirus replication-gene sequences detected (sampling duration: 35–132 days). We found no identical redondovirus replication genes in samples from different participants, and no redondoviruses were detected in 53 pooled nasal/throat swabs collected from domestic animals. Phylogenetic analysis described no large-scale geographical clustering between viruses from Vietnam, the US, Spain, and China, indicating that redondoviruses are highly genetically diverse and have a wide geographical distribution. Collectively, our study provides novel insights into the Redondoviridae family in humans, describing a high prevalence, potentially associated with chronic shedding in the respiratory tract with lack of evidence of zoonotic transmission from close animal contacts. The tropism and potential pathogenicity of this viral family remain to be determined.

1. Introduction

Acute viral respiratory infections are associated with a significant global disease burden and are associated with the majority of epidemics and pandemics [1,2], including the ongoing SARS-CoV-2 pandemic [3]. Often, the etiological agent in the majority of the patients presenting with acute respiratory infections remains undetermined [4,5,6,7]. Therefore, it is critical to assess the potential clinical significance of newly discovered viruses, particularly to inform clinical management and health policymakers.
Redondoviridae is a novel virus family within the circular Rep-encoding single-stranded (CRESS) group of DNA viruses [8]. This family consists of only one genus, Torbevirus, which is divided into two species, vientovirus and brisavirus. The accepted species demarcation is ≤50% sequence similarity of the replication protein [8,9].
Redondoviruses have been exclusively detected in samples from humans, especially those collected from the respiratory tract [8,10,11,12]. Redondovirus DNA was detected in 15% (9/60), 11% (22/209), and 2% (2/100) of oropharyngeal samples taken from healthy adults in the US [8], Italy [10], and Spain [11]. Higher loads of redondovirus DNA were detected in respiratory samples from critically ill patients than in those from healthy individuals [8]. Redondoviruses may also be associated with periodontal disease because their abundance was noted to decrease with standard periodontal treatment [8]. Moreover, persistent detection of redondoviruses in serial endotracheal aspirates from critically ill subjects over 2–3 weeks has been documented [8].
Existing data suggest that redondoviruses are unlikely to be bacteriophage because they carry no prokaryotic ribosome binding site [8]. There is currently no evidence regarding the targeted detection of redondoviruses in animals, fresh water, marine, air, or soil samples [8]. Screening is generally performed via metagenomic sequence analysis, but PCR amplification remains the gold standard for the targeted detection of microbes. Additionally, data regarding the host range, prevalence, and key characteristics of this recently discovered virus family remain scarce.
Collectively, given the pathogenic potential of redondoviruses, as well as existing knowledge gaps regarding their epidemiology and evolution, we aimed to investigate their genetic diversity, epidemiological features, and potential for zoonotic transfer. These data might aid the prioritization of appropriate intervention strategies in the future.

2. Materials and Methods

2.1. The High-Risk Sentinel Cohort Study

Samples from this investigation were derived from a previously described cohort study conducted in Vietnam [6,13]. In brief, the cohort comprised healthy individuals working with animals in Dong Thap Province (n = 282) and Dak Lak Province (n = 299) in Mekong Delta and central highlands of Vietnam, respectively. Recruitment was initiated in March 2013 in Dong Thap Province and from February 2014 in Dak Lak Province. The study participants were followed for 3 years (4/2013–4/2016 for the Dong Thap site and 2/2014–2/2017 for the Dak Lak site).
We collected respiratory samples (nasal and throat swabs) from the participants and their animals at the beginning of each year when no respiratory symptoms were present. These samples were defined as baseline samples. Over the 3-year follow-up period, we collected disease-episode samples from the diseased participants and their animals whenever the participants reported they had an acute respiratory infection. Acute respiratory infection was defined as any signs/symptoms of respiratory tract infections with fever (≥38 °C).
Here we focused on nasal/throat swabs collected during all respiratory disease episodes reported in 2013 (n = 91). These samples were collected from 58 study participants residing in Dong Thap Province. Additionally, all baseline samples (n = 58) of these participants were analyzed. To assess the zoonotic potential of detected redondovirus, we tested nasal/throat swabs collected from animals to which the redondovirus-positive participants (farmers) were exposed during each specific disease episode.

2.2. Whole-Genome Amplification by Inverse PCR

The complete viral genome was amplified by inverse PCR using specific primers (Table 1) designed from metagenomic contigs. The PCR was conducted in a final 25 μL volume reaction mixture, containing 18 μL of Platinum™ PCR SuperMix High Fidelity (Invitrogen, Carlsbad, CA, USA), 1 μL of each reverse and forward primer at a concentration of 10 μM each, and 5 μL of extracted nucleic acid. PCR reactions were performed using a Mastercycler (Eppendorf, Hamburg, Germany) (Table 1).
Additionally, we employed a primer-walking strategy to close gaps within the genomes (Table 1). PCR amplicons were detected using 1% agarose gels and sequenced using a BigDye Terminator v1.1 cycle sequencing kit (Applied Biosystems, Carlsbad, CA, USA) on an ABI377 automatic sequencer (Applied Biosystems), following the manufacturer’s instructions.
To minimize the likelihood that vientovirus sequences were derived from nucleic acid extraction kits, which has been previously reported [14,15], we used 2 nucleic acid extractions. One source was newly extracted from the original sample using a MagNApure 96 platform (Roche Diagnostics, Mannheim, Germany) [13]. The other comprised residual nucleic acid materials after mNGS sequencing extracted by the QIAamp 96 Virus QIAcube HT Kit (QIAGEN GmbH, Hilden, Germany) [16].

2.3. PCR Screening and Genetic Characterization of Redondoviruses in Respiratory Samples and Animal Contacts

We used residual nucleic acid extractions from human disease-episode samples [13] for the PCR screening of redondoviruses. We extracted nucleic acid using the MagNApure 96 platform. For samples collected at baseline or from animals, nucleic acid was freshly isolated from the original materials using the QIAamp viral RNA kit (QIAgen GmbH, Hilden, Germany), following the manufacturer’s instructions.
To investigate the prevalence of redondoviruses in human and animal samples, we employed a generic single-round PCR assay targeting a conserved region of the capsid protein-coding gene. The primer sequences are described in Table 1.
To genetically characterize the amplified redondovirus nucleic acid, we applied a generic PCR to amplify the entire replication protein-coding gene in samples positive by the capsid-gene PCR (Table 1). The PCR primers were newly designed from the complete genome generated as part of the initial experiment described above and available redondovirus sequences deposited in the GenBank [8].
We used Sanger sequencing to sequence the generated PCR amplicons. The PCR and sequencing procedures used were comparable to those used for confirmatory PCR and sequencing above, with some modifications to the thermal cycling conditions (Table 1). Negative controls were included in each PCR detection experiment. The PCR-associated experiments were conducted in unidirectional molecular diagnostic facilities consisting of three physically separated laboratories for reagent preparation, nucleic acid extraction, and amplification to minimize the risk of contamination.

2.4. Phylogenetic Analysis

Sequence alignments were conducted in MUSCLE available in MEGA version X. Phylogenetic trees were constructed using the generated nucleotide for genetic characterization using the Maximum Likelihood method available in the MEGA software with a bootstrap value of 1000 replicates.

2.5. Nucleotide Sequence Accession Numbers

The redondovirus genomes and replication coding sequences described here were submitted to GenBank under the Accession Numbers MT759843, MT823476–MT823478, and MW216334–MW216337.

2.6. Statistics

Statistical associations and differences between variables were calculated using Pearson’s Chi-squared test or Fisher’s exact test for categorical data and t-test for continuous data, respectively, by pairwise comparisons in STATA software (version 12.0). p-values were adjusted for multiple comparisons by the Benjamini and Hochberg method [17] with a false discovery rate (FDR) calculator [18]. A value of p ≤ 0.05 was considered significant.

2.7. Ethics

The high-risk sentinel cohort study received approvals from the Ethics Committees at the University of Oxford, United Kingdom, and at the sub-Departments of Animal Health and General Hospital in Dong Thap Province and Dak Lak Province and in the Hospital of Tropical Diseases in Ho Chi Minh City in Vietnam, as reported previously [16,19]. Written consent was obtained from each study participant.

3. Results

3.1. Detection and Genetic Characterization of a Vientovirus

We previously detected a contig derived from two reads related to the human lung-associated vientovirus AL strain (Accession Number: MK059760.1) in one sample using metagenomic sequencing [16]. Using inverse PCR, we recovered a full circular genome of this virus, which was 3054-bp. A sequence comparison found that the generated sequence was closely related to the reported genomes of vientovirus of the family Redondoviridae (sharing a 79% sequence identity (2404/3054 bp)). The obtained sequence possessed a typical genomic structure of this viral family, containing three open reading frames (ORF1-3) encoding for capsid, replication, and a protein of unknown function (530, 350, and 200 AA, respectively). The coding region of the capsid protein and the protein of unknown function was arranged in an opposite orientation to the replication protein (Figure 1). Additionally, a typical stem-loop structure (“TATTATTTAT”) was identified upstream of the 5′ end of the replication protein-coding region (Figure 1).
A pairwise comparison demonstrated that the capsid and replication protein sequences share the highest similarity (97.7% and 59.1%) with respective protein sequences (Accession Numbers: QCD25327.1 and QCD25302.1, respectively), corresponding with 98.1% and 66.6% of similarities at the nucleotide level of the vientovirus (Accession Numbers: MK059768 and MK059760). Phylogenetic analysis of replication-gene nucleic acid showed a close relatedness with previously reported vientovirus sequences (Figure 2). The detected virus was confirmed as vientovirus, which we named vientovirus VZ (Accession Number: MT759843).

3.2. Detection of Redondoviruses in Respiratory Samples

We performed subsequent PCR screening and detected redondovirus DNA in 29 of 58 (50%) baseline samples from 58 participants (Table 2). We additionally detected redondovirus DNA in 30/91 (32.7%) disease-episode samples from the same participants (Table 2).
Overall, after combining the data from the baseline and disease-episode samples, we detected redondoviruses in at least one longitudinal sample collected at baseline and disease episodes in over half of the participants (33/58; 56.9%) (Table 2).
Sequencing of the PCR amplicons was successful in 26/29 and 27/30 positive samples at baseline and during disease episodes, respectively. Of the 26 sequences obtained from the baseline samples, 6 (23.1%) belonged to brisavirus, and 20 (76.9%) belonged to vientovirus (Table 2). Of the 27 sequences obtained from the disease-episode samples, 9 sequences (33.3%) belonged to brisavirus, and 18 (66.7%) belonged to vientovirus (Table 2).

3.3. The Genetic Diversity of Redondoviruses

We next compared 16 complete replication protein-coding sequences of redondoviruses that we obtained in the present study with those isolated from the US, Spain, and China available in GenBank. A pairwise comparison and phylogenetic analysis revealed that there was no extensive geographical clustering among viruses detected in Vietnam, the US, Spain, and China (Figure 2).

3.4. Evidence of Possible Persistence of Redondoviruses in Nasopharynx

Of the 23 participants with at least two longitudinal samples that were positive for redondoviruses, 10 (43.5%) provided evidence of having an identical replication gene of redondovirus (610–1306 bp, equivalent to 58–100% of complete nucleic acid sequence coding replication protein) detected in their longitudinal samples within a window of 35–132 days (Table 3). In one patient (ID 60-07), we detected vientovirus VZ with the same replication protein-coding gene in nasal/throat swabs collected at baseline and disease episode No. 1. However, in subsequent disease episodes, a genetically related but nonidentical vientovirus was detected (Table 3).

3.5. The Demographics of Participants with and without Redondoviruses Detected in at Least One of Their Longitudinal Samples Taken at Baseline and Disease Episodes

The demographics of the 58 study participants with redondoviruses detected in at least one of their serial samples at both baseline and disease episodes are presented in Table 4. Notably, the redondovirus-positive participants were significantly older than those negative for redondoviruses (43.8 vs. 33.8, p = 0.02) (Table 4). The participants were more likely to test positive for redondoviruses if their occupation was a slaughterer (45.5% vs. 15%, p = 0.02) (Table 4).

3.6. Clinical Symptoms of Redondovirus-Infected Patients during Disease Episodes

Coughing was the most common clinical symptom recorded in the redondovirus-infected patients, followed by sneezing and a sore throat. Dyspnea and watery diarrhea were recorded in 10% (3/30)) and 13% (4/30) of the participants, respectively. There was no significant difference in respiratory symptoms between individuals with and without a redondovirus detected in respiratory samples (p = 0.24; (Table 5)). Likewise, there was no significant difference in clinical symptoms between the brisavirus- and vientovirus-positive participants (Table 5).

3.7. Coinfection in Samples Having Redondoviruses Detected with Other Respiratory Viruses

Taking into account the results of our previous PCR screening [13] and mNGS analysis [16], we identified a mixed infection of redondoviruses and other viruses in 28 samples. The codetected viruses included gemycircularvirus VIZIONS-2013, cyclovirus VIZIONS-2013, human rhinovirus, statovirus VIZIONS-2013, RSV A, gemycircularvirus, enterovirus, statovirus, and influenza A virus (Table 6).

3.8. Detection of Redondoviruses in Respiratory Samples of Animals

We screened 27 samples from 27 pigs from 5 households, 13 pooled samples from 27 chickens from 5 households, 8 pooled samples from 17 Muscovy ducks from 2 households, 1 sample from a duck, and 4 pooled samples from 6 dogs from 4 households for redondovirus by generic PCR. None tested positive.

4. Discussion

Here we report the detection and genetic characterization of several redondovirus species of the recently discovered Redondoviridae family [8,12] in longitudinal upper respiratory tract samples of individuals at potential risk of zoonotic disease exposure and their animal contacts [6]. We found that nearly 60% of tested human participants were positive for either brisavirus or vientovirus of the family Redondoviridae, while none of the animals tested were positive for these viruses; these data are largely in agreement with a previous report [8]. Notably, we identified the same redondovirus replication protein-coding gene in longitudinal samples of 10 participants for up to 5 months. In a previous study, redondovirus DNA was detectable in serial samples collected from several patients over 2–3 weeks [8]. Collectively, these data suggest the persistence of the redondoviruses in the human respiratory tract, although sequence comparison at the whole-genome level is needed to confirm the relatedness between these redondovirus strains. Collectively, this study provides additional evidence supporting the possibility that redondoviruses, or their host(s) if not human cells, can colonize the human respiratory tract. Therefore, their pathogenic potential for humans warrants further research.
The prevalence (56.9%) of redondoviruses detected in our study participants was higher than the reported prevalence of 15% in the oropharynx of healthy Americans [8], 11% among Italians [10], and 2% among Spanish subjects [11]. However, phylogenetic analysis found no large-scale geographical clustering between viruses detected in Vietnam, the US, Spain, and China, indicating the wide geographic distribution and genetic diversity of redondoviruses.
Additionally, we observed a higher proportion of redondoviruses detected in samples at baseline than during disease episodes of the study participants. However, higher copy numbers of redondovirus DNA were previously reported in oropharyngeal samples of critically ill patients versus those of healthy individuals [8]. Thus, future studies should assess the kinetics of redondoviral loads over the course of the illness as well as between disease episodes and at baseline.
This work represents the first PCR screening study for redondoviruses in domestic animals from one of the recognized global hotspots of emerging infections. The sampled domestic animals were from households of study participants who tested positive for redondovirus. We found no evidence for redondoviruses in the respiratory tracts of these domestic animals. The absence of redondovirus in animal samples is in line with a recent report that used metagenomics [8]. The data also suggest that cross-species transmission was unlikely to occur among our study subjects. However, sequences of CRESS-DNA viruses have been widely found in animals [20,21]. More recently, deltaviruses that were theoretically confined to humans were detected in birds, snakes, fish, amphibians, and invertebrates [22,23]. Notably, we found that redondovirus-positive individuals were more likely to be animal slaughters. Therefore, whether similar or more divergent redondoviruses can be detected in animals merits further research.
Whether redondoviruses replicate in humans, other eukaryotic cellular residents of the respiratory tract, or are passively inhaled and deposited on respiratory surfaces remains unknown. An airborne environmental source seems unlikely given that closely associated animals tested PCR negative. Replication of redondoviruses in human cells also remains a possibility as a related family of CRESS-DNA viruses, the Circoviridae, includes members known to infect mammals [24,25].
There were no significant differences in clinical symptoms of acute respiratory illness in patients with and without redondoviruses detected in their samples, indicating, as is true for most respiratory pathogens, that clinical symptoms cannot be used to identify different etiologies. Additionally, we cannot exclude the possibility that the symptoms were caused by non-Redondoviridae viruses. Evidence for any association or causal relationship between this virus family and acute respiratory or other diseases, or lack of such association, still needs more studies; this is true also for some other newly found viruses, such as anelloviruses [8].
We found a significant difference in the detection of redondoviruses along with other respiratory viruses in this study. A previous publication demonstrated that anelloviruses were often codetected with redondoviruses [8]. Therefore, we propose the further screening of samples for redondoviruses and anelloviruses to provide a better understanding of the interaction between redondoviruses and anelloviruses.

5. Conclusions

Our study adds to the growing body of knowledge regarding the epidemiological features and genetic diversity of the new Redondoviridae family. Importantly, we found no evidence of cross-species transmission between humans and their animal contacts. Whether redondoviruses are associated with respiratory or other infections in humans requires further research.

Author Contributions

Conceptualization, methodology and visualization, N.T.K.T., A.-M.K.V., S.B., O.V., and L.V.T.; Investigation and resources, N.T.K.T., N.T.T.H., N.T.H.N., T.M.P., P.T.T.T., D.A.H., and L.T.T.H.; Formal analysis, data curation and validation, N.T.K.T., X.D., E.D., A.-M.K.V., O.V., and L.V.T.; Writing—original draft preparation, N.T.K.T.; Writing—review and editing, N.T.K.T., G.T., H.R.v.D., E.D., A.-M.K.V., S.B., O.V., and L.V.T.; Supervision, A.-M.K.V., O.V., and L.V.T.; Project administration, S.B., L.V.T.; Funding Acquisition, S.B. and L.V.T.; Final approval of the submitted manuscript, all authors. All authors have read and agreed to the published version of the manuscript.

Funding

This study was funded by the Wellcome Trust of Great Britain (106680/B/14/Z, 204904/Z/16/Z and WT/093724).

Institutional Review Board Statement

The study was conducted according to the guidelines of the Oxford Tropical Research Ethics Committee (OxTREC) (No. 157-12) of the University of Oxford, United Kingdom, and at the Ethics Committees of the sub-Departments of Animal Health in Dong Thap Province (No. 850A/QĐ-BVĐT-TCCB), Dak Lak Province (No. 5407/UBND-TH) and the Hospital of Tropical Diseases in Ho Chi Minh City (No. 137/BVBNĐ-KH) in Vietnam.

Informed Consent Statement

Informed consent was obtained from all subjects involved in the study.

Data Availability Statement

Not applicable.

Acknowledgments

We deeply acknowledge all the cohort members and the VIZIONS Consortium members listed below for their participations and contributions in the study. The VIZIONS Consortium members (alphabetical order by surname) from the Oxford University Clinical Research Unit are Bach Tuan Kiet, Stephen Baker, Alessandra Berto, Maciej F. Boni, Juliet E. Bryant, Bui Duc Phu, James I. Campbell, Juan Carrique-Mas, Dang Manh Hung, Dang Thao Huong, Dang Tram Oanh, Jeremy N. Day, Dinh Van Tan, H. Rogier van Doorn, Duong An Han, Jeremy J. Farrar, Hau Thi Thu Trang, Ho Dang Trung Nghia, Hoang Bao Long, Hoang Van Duong, Huynh Thi Kim Thu, Lam Chi Cuong, Le Manh Hung, Le Thanh Phuong, Le Thi Phuc, Le Thi Phuong, Le Xuan Luat, Luu Thi Thu Ha, Ly Van Chuong, Mai Thi Phuoc Loan, Behzad Nadjm, Ngo Thanh Bao, Ngo Thi Hoa, Ngo Tri Tue, Nguyen Canh Tu, Nguyen Dac Thuan, Nguyen Dong, Nguyen Khac Chuyen, Nguyen Ngoc An, Nguyen Ngoc Vinh, Nguyen Quoc Hung, Nguyen Thanh Dung, Nguyen Thanh Minh, Nguyen Thi Binh, Nguyen Thi Hong Tham, Nguyen Thi Hong Tien, Nguyen Thi Kim Chuc, Nguyen Thi Le Ngoc, Nguyen Thi Lien Ha, Nguyen Thi Nam Lien, Nguyen Thi Ngoc Diep, Nguyen Thi Nhung, Nguyen Thi Song Chau, Nguyen Thi Yen Chi, Nguyen Thieu Trinh, Nguyen Thu Van, Nguyen Van Cuong, Nguyen Van Hung, Nguyen Van Kinh, Nguyen Van Minh Hoang, Nguyen Van My, Nguyen Van Thang, Nguyen Van Thanh, Nguyen Van Vinh Chau, Nguyen Van Xang, Pham Ha My, Pham Hong Anh, Pham Thi Minh Khoa, Pham Thi Thanh Tam, Pham Van Lao, Pham Van Minh, Phan Van Be Bay, Maia A. Rabaa, Motiur Rahman, Corinne Thompson, Guy Thwaites, Ta Thi Dieu Ngan, Tran Do Hoang Nhu, Tran Hoang Minh Chau, Tran Khanh Toan, Tran My Phuc, Tran Thi Kim Hong, Tran Thi Ngoc Dung, Tran Thi Thanh Thanh, Tran Thi Thuy Minh, Tran Thua Nguyen, Tran Tinh Hien, Trinh Quang Tri, Vo Be Hien, Vo Nhut Tai, Vo Quoc Cuong, Voong Vinh Phat, Vu Thi Lan Huong, Vu Thi Ty Hang, and Heiman Wertheim; from the Centre for Immunity, Infection, and Evolution, University Of Edinburgh: Carlijn Bogaardt, Margo Chase-Topping, Al Ivens, Lu Lu, Dung Nyugen, Andrew Rambaut, Peter Simmonds, and Mark Woolhouse; from The Wellcome Trust Sanger Institute, Hinxton, United Kingdom: Matthew Cotten, Bas B. Oude Munnink, Paul Kellam, and My Vu Tra Phan; from the Laboratory of Experimental Virology, Department of Medical Microbiology, Center for Infection and Immunity Amsterdam (CINIMA), Academic Medical Center of the University of Amsterdam, Amsterdam, the Netherlands: Martin Deijs, Lia van der Hoek, Maarten F. Jebbink, and Seyed Mohammad Jazaeri Farsani; and from Metabiota, CA: Karen Saylors and Nathan Wolfe.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. WHO. Research Needs for the Battle Against Respiratory Viruses (BRaVe); WHO: Geneva, Switzerland, 2013; pp. 1–35. [Google Scholar]
  2. European Respiratory Society. The Global Impact of Respiratory Disease, 2nd ed.; European Respiratory Society: Lausanne, Switzerland, 2017. [Google Scholar]
  3. World Health Organisation. Coronavirus Disease (COVID-19) Situational Report 51. 2019. Available online: https://www.who.int/docs/default-source/coronaviruse/situation-reports/20200311-sitrep-51-covid-19.pdf?sfvrsn=1ba62e57_10 (accessed on 12 March 2020).
  4. Prasetyo, A.A.; Desyardi, M.N.; Tanamas, J.; Suradi; Reviono; Harsini; Kageyama, S.; Chikumi, H.; Shimizu, E. Respiratory Viruses and Torque Teno Virus in Adults with Acute Respiratory Infections. Intervirology 2015, 58, 57–68. [Google Scholar] [CrossRef] [PubMed]
  5. Vong, S.; Guillard, B.; Borand, L.; Rammaert, B.; Goyet, S.; Te, V.; Try, P.L.; Hem, S.; Rith, S.; Ly, S.; et al. Acute lower respiratory infections in ≥5 year -old hospitalized patients in Cambodia, a low-income tropical country: Clinical characteristics and pathogenic etiology. BMC Infect. Dis. 2013, 13, 97. [Google Scholar] [CrossRef]
  6. Tu, N.T.K.; The VIZIONS Consortium; Tue, N.T.; Vapalahti, O.; Virtala, A.-M.K.; Van Tan, L.; Rabaa, M.A.; Carrique-Mas, J.; Thwaites, G.E.; Baker, S. Occupational Animal Contact in Southern and Central Vietnam. EcoHealth 2019, 16, 759–771. [Google Scholar] [CrossRef] [PubMed]
  7. Anh, N.T.; Hong, N.T.T.; Nhu, L.N.T.; Thanh, T.T.; Lau, C.-Y.; Limmathurotsakul, D.; Deng, X.; Rahman, M.; Chau, N.V.V.; Van Doorn, H.R.; et al. Viruses in Vietnamese Patients Presenting with Community-Acquired Sepsis of Unknown Cause. J. Clin. Microbiol. 2019, 57, 1–13. [Google Scholar] [CrossRef]
  8. Abbas, A.A.; Taylor, L.J.; Dothard, M.I.; Leiby, J.S.; Fitzgerald, A.S.; Khatib, L.A.; Collman, R.G.; Bushman, F.D. Redondoviridae, a Family of Small, Circular DNA Viruses of the Human Oro-Respiratory Tract Associated with Periodontitis and Critical Illness. Cell Host Microbe 2019, 25, 719–729.e4. [Google Scholar] [CrossRef] [PubMed]
  9. International Committee on Taxonomy of Viruses (ICTV). Unclassified Viruses. Available online: https://talk.ictvonline.org/ictv-reports/ictv_online_report/unclassified-viruses/w/unclassified-viruses#Vertebrate (accessed on 17 April 2020).
  10. Spezia, P.G.; Macera, L.; Mazzetti, P.; Curcio, M.; Biagini, C.; Sciandra, I.; Turriziani, O.; Lai, M.; Antonelli, G.; Pistello, M.; et al. Redondovirus DNA in human respiratory samples. J. Clin. Virol. 2020, 131, 104586. [Google Scholar] [CrossRef] [PubMed]
  11. Lázaro-Perona, F.; Dahdouh, E.; Román-Soto, S.; Jiménez-Rodríguez, S.; Rodríguez-Antolín, C.; De La Calle, F.; Agrifoglio, A.; Membrillo, F.J.; García-Rodríguez, J.; Mingorance, J. Metagenomic Detection of Two Vientoviruses in a Human Sputum Sample. Viruses 2020, 12, 327. [Google Scholar] [CrossRef] [PubMed]
  12. Cui, L.; Wu, B.; Zhu, X.; Guo, X.; Ge, Y.; Zhao, K.; Qi, X.; Shi, Z.; Zhu, F.; Sun, L.; et al. Identification and genetic characterization of a novel circular single-stranded DNA virus in a human upper respiratory tract sample. Arch. Virol. 2017, 162, 3305–3312. [Google Scholar] [CrossRef] [PubMed]
  13. Nguyen, T.T.K.; Ngo, T.T.; Tran, P.M.; Pham, T.T.T.; Vu, H.T.T.; Nguyen, N.T.H.; Thwaites, G.; Virtala, A.K.; Vapalahti, O.; Baker, S.; et al. Respiratory viruses in individuals with a high frequency of animal exposure in southern and highland Vietnam. J. Med Virol. 2019, 92, 971–981. [Google Scholar] [CrossRef] [PubMed]
  14. Salter, S.J.; Cox, M.J.; Turek, E.M.; Calus, S.T.; Cookson, W.O.; Moffatt, M.F.; Turner, P.; Parkhill, J.; Loman, N.J.; Walker, A.W. Reagent and laboratory contamination can critically impact sequence-based microbiome analyses. BMC Biol. 2014, 12, 1–12. [Google Scholar] [CrossRef]
  15. Asplund, M.; Kjartansdóttir, K.; Mollerup, S.; Vinner, L.; Fridholm, H.; Herrera, J.; Friis-Nielsen, J.; Hansen, T.; Jensen, R.; Nielsen, I.; et al. Contaminating viral sequences in high-throughput sequencing viromics: A linkage study of 700 sequencing libraries. Clin. Microbiol. Infect. 2019, 25, 1277–1285. [Google Scholar] [CrossRef]
  16. Thi Kha Tu, N.; Thi Thu Hong, N.; Thi Han Ny, N.; My Phuc, T.; Thi Thanh Tam, P.; Doorn, H.R.v.; Dang Trung Nghia, H.; Thao Huong, D.; An Han, D.; Thi Thu Ha, L.; et al. The Virome of Acute Respiratory Diseases in Individuals at Risk of Zoonotic Infections. Viruses 2020, 12, 960. [Google Scholar] [CrossRef] [PubMed]
  17. Benjamini, Y.; Hochberg, Y. Controlling the False Discovery Rate—A Practical and Powerful Approach to Multiple Testing. J. R. Stat. Soc. Ser. B Methodol. 1995, 57, 289–300. [Google Scholar] [CrossRef]
  18. Seed-Based d Mapping. FDR Online Calculator. 2020. Available online: https://www.sdmproject.com/utilities/?show=FDR (accessed on 15 December 2020).
  19. Carrique-Mas, J.J.; Tue, N.T.; Bryant, J.E.; Saylors, K.; Cuong, N.V.; Hoa, N.T.; An, N.N.; Hien, V.B.; Lao, P.V.; Tu, N.C.; et al. The baseline characteristics and interim analyses of the high-risk sentinel cohort of the Vietnam Initiative on Zoonotic InfectiONS (VIZIONS). Sci. Rep. 2015, 5, 17965. [Google Scholar] [CrossRef] [PubMed]
  20. Li, L.; Shan, T.; Soji, O.B.; Alam, M.M.; Kunz, T.H.; Zaidi, S.Z.; Delwart, E. Possible cross-species transmission of circoviruses and cycloviruses among farm animals. J. Gen. Virol. 2010, 92, 768–772. [Google Scholar] [CrossRef] [PubMed]
  21. Li, L.; Kapoor, A.; Slikas, B.; Bamidele, O.S.; Wang, C.; Shaukat, S.; Alam Masroor, M.; Wilson, M.L.; Ndjango, J.-B.N.; Peeters, M.; et al. Multiple Diverse Circoviruses Infect Farm Animals and Are Commonly Found in Human and Chimpanzee Feces. J. Virol. 2009, 84, 1674–1682. [Google Scholar] [CrossRef] [PubMed]
  22. Hetzel, U.; Szirovicza, L.; Smura, T.; Prähauser, B.; Vapalahti, O.; Kipar, A.; Hepojoki, J. Identification of a Novel Deltavirus in Boa Constrictors. mBio 2019, 10, e00014-19. [Google Scholar] [CrossRef] [PubMed]
  23. Szirovicza, L.; Hetzel, U.; Kipar, A.; Martinez-Sobrido, L.; Vapalahti, O.; Hepojoki, J. Snake Deltavirus Utilizes Envelope Proteins of Different Viruses To Generate Infectious Particles. mBio 2020, 11. [Google Scholar] [CrossRef] [PubMed]
  24. Brunborg, I.M.; Moldal, T.; Jonassen, C.M. Quantitation of porcine circovirus type 2 isolated from serum/plasma and tissue samples of healthy pigs and pigs with postweaning multisystemic wasting syndrome using a TaqMan-based real-time PCR. J. Virol. Methods 2004, 122, 171–178. [Google Scholar] [CrossRef] [PubMed]
  25. Cuong, N.V.; Carrique-Mas, J.; Thu, H.T.V.; Hien, N.D.; Hoa, N.T.; Nguyet, L.A.; Anh, P.H.; Bryant, J. Serological and virological surveillance for porcine reproductive and respiratory syndrome virus, porcine circovirus type 2, and influenza A viruses among smallholder swine farms of the Mekong Delta, Vietnam. J. Swine Health Prod. 2014, 22, 224–231. [Google Scholar]
Figure 1. Putative genome organization of vientovirus VZ. Vientovirus VZ has typical genome features of a virus of the Redondoviridae family. Cap: capsid protein; Rep: replication protein; ORF3: open reading frame 3 encoding an unknown protein.
Figure 1. Putative genome organization of vientovirus VZ. Vientovirus VZ has typical genome features of a virus of the Redondoviridae family. Cap: capsid protein; Rep: replication protein; ORF3: open reading frame 3 encoding an unknown protein.
Viruses 13 00533 g001
Figure 2. Phylogenetic tree of complete nucleic acid sequences of the replication protein-coding gene of redondoviruses. The sequence Accession Numbers are included on the tips of the tree. Black circles denote redondovirus strains detected in the present study.
Figure 2. Phylogenetic tree of complete nucleic acid sequences of the replication protein-coding gene of redondoviruses. The sequence Accession Numbers are included on the tips of the tree. Black circles denote redondovirus strains detected in the present study.
Viruses 13 00533 g002
Table 1. Newly designed primer sequences for the PCRs.
Table 1. Newly designed primer sequences for the PCRs.
Primer NameFor PurposeSequencePCR Products (bp)Target (Regions)Thermal Cycles
Vientovirus VZ-inverse_FWhole genomeTATTTGTGGCCTTACTCCTTGT3000Replication gene
(2628–2649′)
95 °C for 2 m; 45 cycles of 95 °C for 15 s, 52 °C for 30 s, 72 °C for 2 m 45 s; 72 °C for 5 m
Vientovirus VZ-inverse_RWhole genomeGGACATATAGCAGAAAAAGGTGATGReplication gene
(2577–2552′)
Vientovirus VZ-walking_FWhole genomeAGACTTGCTTCTATGGTTTGTAGT1400Capsid gene
(268–291′)
95 °C for 2 m; 45 cycles of 95 °C for 15 s, 48 °C for 30 s, 72 °C for 2 m; 72 °C for 5 m
Vientovirus VZ-walking_RWhole genomeTGATACACAATTCTTTTACCGTTGTCapsid gene
(1777–1752′)
Vientovirus VZ-close gap_FWhole genomeGGGGCCCTTGAACCACATTA750Replication gene
(2352–2372′)
95 °C for 2 m; 45 cycles of 95 °C for 15 s, 52 °C for 30 s, 72 °C for 1 m 15 s; 72 °C for 5 m
Vientovirus VZ-close gap_RWhole genomeGCAGCCCTCTTAAGCCTGTAReplication gene (132–112′)
Redondovirus-capsid gene_FPCR screeningGGCTTAAGAGGGCTGCTAGG460Capsid gene (116–136′)95 °C for 5 m; 45 cycles of 95 °C for 20 s, 52 °C for 30 s, 72 °C for 1 m; 72 °C for 5 m
Redondovirus-capsid gene_RTCCTTGGATGCCATGAAACTCapsid gene
(575–555′)
Redondovirus-replication gene_FGenetic characterizationGTTGTCACTTGTGAAACGATGA1400Replication gene
(1711–1733′)
95 °C for 5 m; 45 cycles of 95 °C for 20 s, 50 °C for 30 s, 72 °C for 2 m; 72 °C for 5 m
Redondovirus-replication gene_RTCGACGATAAACTCTCTTTCTTGAReplication gene
(43–19′)
Table 2. Detection of redondoviruses from the study participants and each of the baseline and clinical samples.
Table 2. Detection of redondoviruses from the study participants and each of the baseline and clinical samples.
Redondoviruses NegativeRedondoviruses PositiveTotal
BrisavirusVientovirusUndefined *Subtotal
Study participants ^2592313358
Baseline samples2962032958
Disease-episode samples6191833091
* Redondovirus-screening PCR was positive, but no PCR sequence was obtained for species identification. ^ Number of participants who never got infected (negative) or got infected with redondoviruses at least once (positive) during the entire study are shown.
Table 3. Chart showing identical replication-gene sequences of brisavirus and vientovirus detected in samples at baseline and disease episodes. RedonV: redondoviruses; VienV: vientovirus; BrisaV: brisavirus. Vientovirus or brisavirus written with the same name and in the samples collected from the same participant have identical replication-gene sequences. Boxes with redondoviruses are samples positive with redondoviruses by PCRs, but no PCR-replication sequences were achieved for species identification.
Table 3. Chart showing identical replication-gene sequences of brisavirus and vientovirus detected in samples at baseline and disease episodes. RedonV: redondoviruses; VienV: vientovirus; BrisaV: brisavirus. Vientovirus or brisavirus written with the same name and in the samples collected from the same participant have identical replication-gene sequences. Boxes with redondoviruses are samples positive with redondoviruses by PCRs, but no PCR-replication sequences were achieved for species identification.
Study Year 2013
Baseline Disease Episode
1
Disease Episode
2
Disease Episode
3
Disease Episode
4
Disease Episode
5
Duration of Persistence (Days)
Participant ID 60-07VienV VZ
14-Apr
VienV VZ
09-Jul
VienV S39
11-Sep
VienV S39
26-Sep
RedonV
15-NoV
VienV S39
18-Dec
86 and 98, respectively
Participant ID 48-01VienV S19
14-Apr
VienV S19
10-Jul
87
Participant ID 81-15VienV S8
29-Mar
VienV S8
18-Jun
81
Participant ID 49-01VienV S15
14-Apr
VienV S15
20-Jun
67
Participant ID 51-02VienV S17
14-Apr
VienV S17
20-Jun
67
Participant ID 22-01BrisaV S32
29-Mar
BrisaV S32
08-Aug
132
Participant ID 81-23BrisaV S4
07-Apr
BrisaV S4
05-Jun
10-Jul 59
Participant ID 61-05RedonV
14-Apr
BrisaV S56
18-Oct
RedonV
08-Nov
BrisaV S56
25-Nov
38
Participant ID 60-1214-AprBrisaV S83
19-Nov
BrisaV S83
24-Dec
35
Table 4. The demographics of the study participants.
Table 4. The demographics of the study participants.
TotalRedondoviruses Positive *Redondoviruses Negativep-Value
Number of participants583325NA ^
Having chronic diseases (%)4 (6.9)1 (3)3 (12)0.3
Occupation (%)
Animal-raising farmer26 (44.8)13 (39.4)13 (52)0.3
Animal-health worker12 (20.7)5 (15.2)7 (28)0.1
Slaughterer18 (31)15 (45.5)3 (12)0.02
Rat trader2 (3.4)0 (0)2(8)NA
Females/males (ratio)16/42 (0.4)11/22 (0.5)6/19 (0.3)1
Median age in year (range)35.5 (7–76)43.8 (23–76)33.8 (7–72)0.02#
* Number of participants who got infected with redondoviruses at least once during the entire study. ^ NA: not applicable. The value is shown in a number format (percentage). p-values were calculated using Pearson’s Chi-squared test or Fisher’s exact test. The p-values were adjusted for multiple comparisons using the Benjamini and Hochberg procedure; # by t-test.
Table 5. Clinical symptoms from 58 patients at 91 disease episodes with and without redondoviruses detected.
Table 5. Clinical symptoms from 58 patients at 91 disease episodes with and without redondoviruses detected.
No. of Disease
Episodes
Redondoviruses PositiveRedondoviruses
Negative
p-Value #
TotalBrisavirus * Vientovirus *p-Value
N = 91N = 30N = 9N = 18NAN = 61NA
Fever91 (100)30 (100)9 (100)18 (100)161 (100)1
Cough75 (82.4)24 (80)8 (88.9)14 (77.8)151 (83.6)1
Sneezing69 (75.8)22 (73.3)5 (55.6)15 (83.3)0.74347 (77.0)1
Sore throat49 (53.8)19 (63.3)5 (55.6)13 (72.2)130 (49.2)1
Dyspnea9 (9.9)3 (10.0)1 (11.1)2 (11.1)16 (9.8)1
Headache57 (62.6)24 (80.0)8 (88.9)14 (77.8)133 (54.1)0.243
Body aches47 (51.6)19 (63.3)9 (100)10 (55.6)0.26128 (45.9)0.666
Watery diarrhea11 (12.1)4 (13.3)2 (22.2)2 (11.1)17 (11.5)1
Nausea2 (2.2)0 (0)0 (0)0 (0)NA2 (3.3)NA
The value is shown in a number format (percentage). NA: not applicable. p-values were conducted using Pearson’s Chi-squared test or Fisher’s exact test and adjusted for multiple comparisons using the Benjamini and Hochberg procedure; * 3 disease episodes with a redondovirus detected, but no PCR sequence was obtained for species identification; # between column “Total” of “Redondoviruses positive” vs. column “Redondoviruses negative”.
Table 6. Codetection of redondoviruses and other viruses in the respiratory samples analyzed in this study.
Table 6. Codetection of redondoviruses and other viruses in the respiratory samples analyzed in this study.
Redondoviruses Positive *Redondoviruses
Negative
p-Value #
TotalBrisavirus Vientovirusp-Value
33923NA25NA
Gemycircularvirus VIZIONS-2013 ^8 (24.2)2 (22.2)5 (21.7)17 (28)0.7
Cyclovirus VIZIONS-20134 (12.1)1 (11.1)3 (13)15 (20)0.5
Rhinovirus4 (12.1)0 (0)4 (17.4)0.31 (4)0.4
Respiratory syncytial virus A2 (6.1)0 (0)2 (8.7)10 (0)0.5
Statovirus VIZIONS-20132 (6.1)1 (11.1)1 (4.3)0.50 (0)0.5
Statovirus2 (6.1)0 (0)2 (8.7)10 (0)0.5
Enterovirus1 (3)0 (0)1 (4.3)11 (4)1
Influenza A virus1 (3)1 (11.1)0 (0) 0.30 (0)1
Metapneumovirus1 (3)0 (0)1 (4.3)10 (0)1
Gemycircularvirus1 (3)0 (0)1 (4.3)10 (0)1
Coronavirus OC430 (0)0 (0)0 (0)NA1 (4)0.4
* Number of participants who got infected with redondoviruses at least once during the entire study. NA: not applicable. The value is shown in a number format (percentage). p-values were calculated using Pearson’s Chi-squared test or Fisher’s exact test. The p-values were adjusted for multiple comparisons using the Benjamini and Hochberg procedure; # by t-test. ^ 1 sample with a redondovirus detected, but no PCR sequence was obtained for species identification. # between column “Total” vs. column “Redondoviruses negative”.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Tu, N.T.K.; Deng, X.; Hong, N.T.T.; Ny, N.T.H.; Phuc, T.M.; Tam, P.T.T.; Han, D.A.; Ha, L.T.T.; Thwaites, G.; Doorn, H.R.v.; et al. Redondoviridae: High Prevalence and Possibly Chronic Shedding in Human Respiratory Tract, But No Zoonotic Transmission. Viruses 2021, 13, 533. https://doi.org/10.3390/v13040533

AMA Style

Tu NTK, Deng X, Hong NTT, Ny NTH, Phuc TM, Tam PTT, Han DA, Ha LTT, Thwaites G, Doorn HRv, et al. Redondoviridae: High Prevalence and Possibly Chronic Shedding in Human Respiratory Tract, But No Zoonotic Transmission. Viruses. 2021; 13(4):533. https://doi.org/10.3390/v13040533

Chicago/Turabian Style

Tu, Nguyen Thi Kha, Xutao Deng, Nguyen Thi Thu Hong, Nguyen Thi Han Ny, Tran My Phuc, Pham Thi Thanh Tam, Duong An Han, Luu Thi Thu Ha, Guy Thwaites, H. Rogier van Doorn, and et al. 2021. "Redondoviridae: High Prevalence and Possibly Chronic Shedding in Human Respiratory Tract, But No Zoonotic Transmission" Viruses 13, no. 4: 533. https://doi.org/10.3390/v13040533

APA Style

Tu, N. T. K., Deng, X., Hong, N. T. T., Ny, N. T. H., Phuc, T. M., Tam, P. T. T., Han, D. A., Ha, L. T. T., Thwaites, G., Doorn, H. R. v., Virtala, A.-M. K., Delwart, E., Baker, S., Vapalahti, O., Tan, L. V., & on behalf of the VIZIONS Consortium. (2021). Redondoviridae: High Prevalence and Possibly Chronic Shedding in Human Respiratory Tract, But No Zoonotic Transmission. Viruses, 13(4), 533. https://doi.org/10.3390/v13040533

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop