The Occurrence of Borrelia burgdorferi sensu lato in Ixodes ricinus Ticks Collected from Nature-Educational and Tourist Trails in the Poprad Landscape Park
Abstract
1. Introduction
2. Materials and Methods
2.1. Sampling Area
2.2. Field Sampling
2.3. Laboratory Analysis
2.3.1. Ticks
2.3.2. PCR
2.4. Statistics
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Tomczyk, A.M.; Ewertowski, M.W. Recreational Trails in the Poprad Landscape Park, Poland: The Spatial Pattern of Trail Impacts and Use-Related, Environmental, and Managerial Factors. J. Maps 2016, 12, 1227–1235. [Google Scholar] [CrossRef]
- Nawieśniak, M.; Strutyński, M.; Hernik, J. Hydromorphological and Landscape Valorization of the Poprad River Valley. Ann. Wars. Univ. Life Sci.—SGGW Land Recl. 2015, 47, 333–342. [Google Scholar] [CrossRef]
- Siuda, K. Kleszcze (Acari: Ixodida) Polski. II Systematyka i Rozmieszczenie; Polskie Towarzystwo Parazytologiczne: Warszawa, Poland, 1993. [Google Scholar]
- Rocha, S.C.; Velásquez, C.V.; Aquib, A.; Al-Nazal, A.; Parveen, N. Transmission Cycle of Tick-Borne Infections and Co-Infections, Animal Models and Diseases. Pathogens 2022, 11, 1309. [Google Scholar] [CrossRef] [PubMed]
- Medlock, J.M.; Hansford, K.M.; Bormane, A.; Derdakova, M.; Estrada-Peña, A.; George, J.C.; Van Bortel, W. Driving Forces for Changes in Geographical Distribution of Ixodes ricinus Ticks in Europe. Parasites Vectors 2013, 6, 1. [Google Scholar] [CrossRef]
- Zbrzeźniak, J.; Paradowska-Stankiewicz, I. Lyme Disease in Poland in 2020. Epidemiol. Rev. 2022, 76, 3. [Google Scholar] [CrossRef]
- Państwowy Zakład Higieny. Choroby Zakaźne i Zatrucia w Polsce w 2023 roku. Available online: https://wwwold.pzh.gov.pl/oldpage/epimeld/2023/Ch_2023.pdf (accessed on 10 January 2025).
- Barbour, A.G.; Hayes, S.F. Biology of Borrelia Species. Microbiol. Rev. 1986, 50, 381–400. [Google Scholar] [CrossRef]
- Bakken, J.S.; Dumler, J.S. Human Granulocytic Anaplasmosis. Infect. Dis. Clin. 2015, 29, 341–355. [Google Scholar] [CrossRef] [PubMed]
- Vannier, E.; Krause, P.J. Babesiosis. In Hunter’s Tropical Medicine and Emerging Infectious Diseases; Elsevier: Amsterdam, The Netherlands, 2020; pp. 799–802. [Google Scholar] [CrossRef]
- Siuda, K. Kleszcze (Ixodida) o znaczeniu epidemiologicznym w Polsce. In Biologia Molekularna Patogenów Przenoszonych Przez Kleszcze; Skotarczak, B., Ed.; PZWL: Warszawa, Poland, 2006. [Google Scholar]
- Kahl, O.; Gray, J.S. The Biology of Ixodes ricinus with Emphasis on Its Ecology. Ticks Tick-Borne Dis. 2023, 14, 102114. [Google Scholar] [CrossRef] [PubMed]
- Jongejan, F.; Uilenberg, G. The Global Importance of Ticks. Parasitology 2004, 129 (Suppl. S1), S3–S14. [Google Scholar] [CrossRef] [PubMed]
- Guy, E.; Stanek, G. Detection of Borrelia burgdorferi in Patients with Lyme Disease by the Polymerase Chain Reaction. J. Clin. Pathol. 1991, 44, 610–611. [Google Scholar] [CrossRef]
- Wodecka, B.; Rymaszewska, A.; Sawczuk, M. Detectability of Tick-Borne Agents DNA in the Blood of Dogs Undergoing Treatment for Borreliosis. Ann. Agric. Environ. Med. 2009, 16, 9–14. [Google Scholar] [PubMed]
- Massung, R.F.; Slater, K.; Owens, J.H. Nested PCR Assay for Detection of Granulocytic Ehrlichiae. J. Clin. Microbiol. 1998, 36, 1090–1095. [Google Scholar] [CrossRef]
- Blaschitz, M.; Narodoslavsky-Gföller, M.; Kanzler, M.; Stanek, G.; Walochnik, J. Babesia Species Occurring in Austrian Ixodes ricinus Ticks. Appl. Environ. Microbiol. 2008, 74, 4841–4846. [Google Scholar] [CrossRef] [PubMed]
- Vucelja, M.; Krčmar, S.; Habuš, J.; Perko, V.M.; Boljfetić, M.; Bjedov, L.; Margaletić, J. Altitudinal Distribution, Seasonal Dynamics, and Borrelia burgdorferi Sensu Lato Infections in Hard Ticks (Acari: Ixodidae) in Different Forest Communities in Inland Croatia. Sustainability 2023, 15, 4862. [Google Scholar] [CrossRef]
- Materna, J.; Daniel, M.; Danielová, V. Altitudinal Distribution Limit of the Tick Ixodes ricinus Shifted Considerably Towards Higher Altitudes in Central Europe: Results of Three Years Monitoring in the Krkonoše Mts. (Czech Republic). Cent. Eur. J. Public Health 2005, 13, 24–28. [Google Scholar] [PubMed]
- Menzano, A.; Tizzani, P.; Farber, M.D.; Garcia-Vozmediano, A.; Martinelli, L.; Rossi, L.; Tomassone, L. Zoonotic Tick-Borne Pathogens in Ticks from Vegetation and Alpine Ibex (Capra ibex) in the Maritime Alps, Italy. Animals 2024, 14, 2251. [Google Scholar] [CrossRef] [PubMed]
- Stańczak, J.; Racewicz, M.; Kubica-Biernat, B.; Kruminis-Lozowska, W.; Dąbrowski, J.; Adamczyk, A.; Markowska, M. Prevalence of Borrelia burgdorferi sensu lato in Ixodes ricinus ticks (Acari, Ixodidae) in different Polish woodlands. Ann. Agric. Environ. Med. 1999, 6, 127–132. [Google Scholar] [PubMed]
- Strzelczyk, J.K.; Wiczkowski, A.; Spausta, G.; Ciarkowska, J.; Zalewska-Ziob, M.; Izdebska-Straszak, G.; Strzelczyk, J.; Kasperczyk, J. Obecność krętków Borrelia burgdorferi sensu lato u kleszczy Ixodes ricinus na terenach rekreacyjnych okolic Tarnowskich Gór i Zabrza w latach 2001–2003. Przegl. Epidemiol. 2006, 60, 589–595. [Google Scholar] [PubMed]
- Asman, M.; Pindel, Ł.; Solarz, K. Occupational Risk of Infections with Borrelia burgdorferi sensu lato, B. burgdorferi sensu stricto, B. garinii, and B. afzelii in Agricultural Workers on the Territory of Beskid Żywiecki (South Poland). In Stawonogi: Znaczenie Medyczne i Gospodarcze; Buczek, A., Błaszak, C., Eds.; Koliber: Lublin, Poland, 2012; pp. 163–170. [Google Scholar]
- Lenčáková, D.; Hizo-Teufel, C.; Peťko, B.; Schulte-Spechtel, U.; Stanko, M.; Wilske, B.; Fingerle, V. Prevalence of Borrelia burgdorferi s.l. OspA types in Ixodes ricinus ticks from selected localities in Slovakia and Poland. Int. J. Med. Microbiol. 2006, 296, 108–118. [Google Scholar] [CrossRef] [PubMed]
- Zając, Z.; Kulisz, J.; Woźniak, A.; Bartosik, K.; Foucault-Simonin, A.; Moutailler, S.; Cabezas-Cruz, A. Tick Activity, Host Range, and Tick-Borne Pathogen Prevalence in Mountain Habitats of the Western Carpathians, Poland. Pathogens 2023, 12, 1186. [Google Scholar] [CrossRef] [PubMed]
- Grochowska, A.; Dunaj-Małyszko, J.; Pancewicz, S.; Czupryna, P.; Milewski, R.; Majewski, P.; Moniuszko-Malinowska, A. Prevalence of Tick-Borne Pathogens in Questing Ixodes ricinus and Dermacentor reticulatus Ticks Collected from Recreational Areas in Northeastern Poland with Analysis of Environmental Factors. Pathogens 2022, 11, 468. [Google Scholar] [CrossRef] [PubMed]
- Zając, Z.; Obregon, D.; Foucault-Simonin, A.; Wu-Chuang, A.; Moutailler, S.; Galon, C.; Kulisz, J.; Woźniak, A.; Bartosik, K.; Cabezas-Cruz, A. Disparate dynamics of pathogen prevalence in Ixodes ricinus and Dermacentor reticulatus ticks occurring sympatrically in diverse habitats. Sci. Rep. 2023, 13, 10645. [Google Scholar] [CrossRef]
- Koczanowicz, S.; Nowak-Chmura, M.; Witecka, J.; Rączka, G.; Asman, M. The Potential Risk of Human Exposure to Tick-Borne Infection by Borrelia burgdorferi Sensu Lato, Anaplasma phagocytophilum, and Babesia microti in Selected Recreational Areas of the Poprad Landscape Park in Southern Poland. Ann. Agric. Environ. Med. 2024, 31, 345–350. [Google Scholar] [CrossRef] [PubMed]
- Bartosik, K.; Lachowska-Kotowska, P.; Szymańska, J.; Pabis, A.; Buczek, A. Lyme Borreliosis in Southeastern Poland: Relationships with Environmental Factors and Medical Attention Standards. Ann. Agric. Environ. Med. 2011, 18, 131–137. [Google Scholar] [PubMed]
- Tarageľová, V.R.; Mahríková, L.; Selyemová, D.; Václav, R.; Derdáková, M. Natural Foci of Borrelia lusitaniae in a Mountain Region of Central Europe. Ticks Tick-Borne Dis. 2016, 7, 350–356. [Google Scholar] [CrossRef] [PubMed]
- Wodecka, B. flaB Gene as a Molecular Marker for Distinct Identification of Borrelia Species in Environmental Samples by the PCR-Restriction Fragment Length Polymorphism Method. Appl. Environ. Microbiol. 2011, 77, 7088–7092. [Google Scholar] [CrossRef] [PubMed]
- Gryczyńska, A.; Welc-Falęciak, R. Long-term Study of the Prevalence of Borrelia burgdorferi s.l. Infection in Ticks (Ixodes ricinus) Feeding on Blackbirds (Turdus merula) in NE Poland. Exp. Appl. Acarol. 2016, 70, 381–394. [Google Scholar] [CrossRef] [PubMed]
- Kiewra, D.; Stańczak, J.; Richter, M. Ixodes ricinus Ticks (Acari, Ixodidae) as a Vector of Borrelia burgdorferi sensu lato and Borrelia miyamotoi in Lower Silesia. Tick Tick-Borne Dis. 2014, 5, 892–897. [Google Scholar] [CrossRef] [PubMed]
- Stańczak, J.; Kubica-Biernat, B.; Racewicz, M.; Kruminis-Łozowska, W.; Kur, J. Detection of Three Genospecies of Borrelia burgdorferi sensu lato in Ixodes ricinus Ticks Collected in Different Regions of Poland. Int. J. Med. Microbiol. 2000, 290, 559–566. [Google Scholar] [CrossRef] [PubMed]
- Kurtenbach, K.; De Michelis, S.; Etti, S.; Schäfer, S.M.; Sewell, H.S.; Brade, V.; Kraiczy, P. Host Association of Borrelia burgdorferi sensu lato—The Key Role of Host Complement. Trends Microbiol. 2002, 10, 74–79. [Google Scholar] [CrossRef] [PubMed]
- Balmelli, T.; Piffaretti, J.C. Association between Different Clinical Manifestations of Lyme Disease and Different Species of Borrelia burgdoferi sensu lato. Res. Microbiol. 1995, 146, 329–340. [Google Scholar] [CrossRef] [PubMed]
- Asman, M.; Solarz, K.; Szilman, E.; Cuber, P.; Gasior, T.; Tondaś, E.; Matzullok, A.; Kusion, N.; Florek, K. Detection of Protozoans Babesia microti and Toxoplasma gondii and Their Co-Existence in Ticks (Acari: Ixodida) Collected in Tarnogórski District (Upper Silesia, Poland). Ann. Agric. Environ. Med. 2015, 22, 80–83. [Google Scholar] [CrossRef] [PubMed]
- Asman, M.; Pindel, Ł.; Solarz, K. Ryzyko Narażenia na Kleszcze (Acari: Ixodida) oraz Borrelia burgdorferi sensu lato i Anaplasma phagocytophilum na wybranych terenach gminy Jeleśnia (Beskid Żywiecki). In Stawonogi: Aspekty Medyczne i Weterynaryjne; Buczek, A., Błaszak, C., Eds.; Koliber: Lublin, Poland, 2013; pp. 257–266. [Google Scholar]
- De Pelsmaeker, N.; Korslund, L.; Steifetten, Ø. High-Elevational Occurrence of Two Tick Species, Ixodes ricinus and I. trianguliceps, at Their Northern Distribution Range. Parasites Vectors 2021, 14, 161. [Google Scholar] [CrossRef]
- Gray, J.S.; Kirstein, F.; Robertson, J.N.; Stein, J.; Kahl, O. Borrelia burgdorferi sensu lato in Ixodes ricinus ticks and rodents in a recreational park in south-western Ireland. Exp. Appl. Acarol. 1999, 23, 717–729. [Google Scholar] [CrossRef] [PubMed]
- Stańczak, J.; Gabre, R.M.; Kruminis-Łozowska, W.; Racewicz, M. Ixodes ricinus as a vector of Borrelia burgdorferi sensu lato, Anaplasma phagocytophilum and Babesia microti in urban and suburban forests. Ann. Agric. Environ. Med. 2004, 11, 109–114. [Google Scholar]
Primer | Sequence (5′–3′) | Gene Detected | Size of Amplification Product [bp] | PCR Conditions [°C/s] | N° of Cycles | ||
---|---|---|---|---|---|---|---|
Denaturation | Annealing | Extension | |||||
132f | TGGTATGGGAGTTTCTGG | flaB | 774 | 94/30 | 50/45 | 72/60 | 40 |
905r | TCTGTCATTGTAGCATCTTT | ||||||
220f | CAGACAACAGAGGGAAAT | 605 | 94/30 | 54/45 | 72/60 | 40 | |
824r | TCAAGTCTATTTTGGAAAGCACC | ||||||
ge3a | CACATGCAAGTCGAACGGAT TATTC | 16S rRNA | 932 | 94/30 | 55/30 | 72/60 | 40 |
ge10r | TTCCGTTAAGAAGGATCTAATCTCC | ||||||
ge9f | AACGGATTATTCTTTATAG CTTGCT | 546 | 94/30 | 55/30 | 72/60 | 30 | |
ge2 | GGCAGTATTAAAAGCAGCTCCAGG | ||||||
Babfor | GACTAGGGATTGGAGGTC | 18S rRNA | 620 | 94/60 | 53/45 | 72/90 | 35 |
Babrev | GAATAATTCACCGGATCACTC |
Collection Site * | Developmental Stage | Number of Studied Ticks | Number and Percentage of Uninfected Ticks | Number and Percentage of Ticks Infected with Borrelia burgdorferi sensu lato |
---|---|---|---|---|
1 | Male | 6 | 0 (0.0%) | 6 (100.0%) |
Female | 7 | 6 (85.7%) | 1 (14.3%) | |
Nymph | 59 | 35 (59.3%) | 24 (40.7%) | |
Total | 72 | 41 (56.9%) | 31 (43.1%) | |
2 | Male | 50 | 36 (72.0%) | 14 (28.0%) |
Female | 41 | 23 (56.1%) | 18 (43.9%) | |
Nymph | 19 | 16 (84.2%) | 3 (15.8%) | |
Total | 110 | 75 (68.2%) | 35 (31.8%) | |
3 | Male | 5 | 5 (100.0%) | 0 (0.0%) |
Female | 11 | 11 (100.0%) | 0 (0.0%) | |
Nymph | 15 | 15 (100.0%) | 0 (0.0%) | |
Total | 31 | 31 (100.0%) | 0 (0.0%) | |
1–3 | Male | 61 | 41 (67.2%) | 20 (32.8%) |
Female | 59 | 40 (67.8%) | 19 (32.2%) | |
Nymph | 93 | 66 (71.0%) | 27 (29.0%) | |
Grand total | 213 | 147 (69.0%) | 66 (31.0%) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Koczanowicz, S.; Nowak-Chmura, M.; Kocoń, A.; Rączka, G.; Asman, M. The Occurrence of Borrelia burgdorferi sensu lato in Ixodes ricinus Ticks Collected from Nature-Educational and Tourist Trails in the Poprad Landscape Park. Pathogens 2025, 14, 117. https://doi.org/10.3390/pathogens14020117
Koczanowicz S, Nowak-Chmura M, Kocoń A, Rączka G, Asman M. The Occurrence of Borrelia burgdorferi sensu lato in Ixodes ricinus Ticks Collected from Nature-Educational and Tourist Trails in the Poprad Landscape Park. Pathogens. 2025; 14(2):117. https://doi.org/10.3390/pathogens14020117
Chicago/Turabian StyleKoczanowicz, Sylwia, Magdalena Nowak-Chmura, Anna Kocoń, Grzegorz Rączka, and Marek Asman. 2025. "The Occurrence of Borrelia burgdorferi sensu lato in Ixodes ricinus Ticks Collected from Nature-Educational and Tourist Trails in the Poprad Landscape Park" Pathogens 14, no. 2: 117. https://doi.org/10.3390/pathogens14020117
APA StyleKoczanowicz, S., Nowak-Chmura, M., Kocoń, A., Rączka, G., & Asman, M. (2025). The Occurrence of Borrelia burgdorferi sensu lato in Ixodes ricinus Ticks Collected from Nature-Educational and Tourist Trails in the Poprad Landscape Park. Pathogens, 14(2), 117. https://doi.org/10.3390/pathogens14020117