A yceI Gene Involves in the Adaptation of Ralstonia solanacearum to Methyl Gallate and Other Stresses
Abstract
:1. Introduction
2. Materials and Methods
2.1. Bacterial Strains and Growth Condition
2.2. Quantitative Real-Time (qRT-PCR) of yceI
2.3. Gene Deletion and Over-Expression in R. solanacearum
2.4. Sensitivity of R. solanacearum to MG
2.5. Sensitivity of R. solanacearum to Stresses (Non-Optimal Temperature, Non-Optimal pH and 1% NaCl)
2.6. Determining the Colonization and Virulence of R. solanacearum
2.7. Determining the Control Effect of MG against the Strains
2.8. Statistical Analysis
3. Results
3.1. YceI Is Involved in the Sensitivity of R. solanacearum to MG
3.2. YceI Is Involved in Adaptability of R. solanacearum to Stresses including Low Temperature, and 1% NaCl but Not to Non-Optimal pH
3.3. YceI Is Associated with Colonization and Virulence of R. solanacearum
3.4. Control Effect of MG on Bacterial Wilt Caused by yceI-Deletion Mutant
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Genin, S.; Boucher, C. Ralstonia solanacearum: Secrets of a major pathogen unveiled by analysis of its genome. Mol. Plant Pathol. 2002, 3, 111–118. [Google Scholar] [CrossRef]
- Elphinstone, J.G.; Allen, C.; Prior, P.; Hayward, A.C. The current bacterial wilt situation: A global overview. In Bacterial Wilt the Disease & the Ralstonia Solanacearum Species Complex; APS Press: Saint Paul, MN, USA, 2005; pp. 9–28. [Google Scholar]
- Grey, B.E.; Steck, T.R. The viable but nonculturable state of Ralstonia solanacearum may be involved in long-term survival and plant infection. Appl. Environ. Microb. 2001, 67, 3866–3872. [Google Scholar] [CrossRef] [Green Version]
- Xie, X.M.; Shen, H.; Sun, J. Research advance in integrated management of tomato bacterial wilt. China Fruit Veg. 2018, 38, 63–67. (In Chinese) [Google Scholar]
- Antsotegi, M.; Markina, A.; Ugalde, U. Copper resistance in Aspergillus nidulans relies on the P1-type ATPase CrpA, regulated by the transcription factor AceA. Front. Microbiol. 2017, 8, 912. [Google Scholar] [CrossRef]
- Mellano, M.A.; Cooksey, D.A. Nucleotide sequence and organization of copper resistance genes from Pseudomonas syringae pv. tomato. J. Bacteriol. 1988, 170, 2879–2883. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hoegler, K.J.; Hecht, M.H. A de novo protein confers copper resistance in Escherichia coli. Protein Sci. 2016, 25, 1249–1259. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, S. Research on VBNC State and Function Analysis of the Related Gene rpoS in Ralstonia solanacearum. Master’s Thesis, Chinese Academy of Agricultural Sciences, Beijing, China, 2018. [Google Scholar]
- Hwang, S.; Zhang, Q.; Ryu, S.; Jeon, B. Transcriptional regulation of the cmeABC multidrug efflux pump and the kata catalase by cosr in Campylobacter jejuni. J. Bacteriol. 2012, 194, 6883. [Google Scholar] [CrossRef] [Green Version]
- Remi, B.; Meriem, E.G.; Dominique, M.; Marc, C.; François, D. BcrC from bacillus subtilis acts as an undecaprenyl pyrophosphate phosphatase in bacitracin resistance. J. Biol. Chem. 2005, 280, 28852–28857. [Google Scholar]
- Bahrehmand, F.; Kiani, A.; Vaisi-Raygani, A.; Bashiri, H.; Pourmotabbed, T. Pharmacogenetics of drug metabolizing enzyme: Thiopurine methyl transferase phenotypes and multidrug resistance 1 gene polymorphism in inflammatory bowel disease. Cell Mol. Biol. 2016, 62, 102. [Google Scholar]
- Schindler, B.D.; Kaatz, G.W. Multidrug efflux pumps of Gram-positive bacteria. Drug Resist. Updates 2016, 27, 1–13. [Google Scholar] [CrossRef]
- Bigger, J.W. Treatment of staphylococcal infections with penicillin by intermittent sterilisation. Lancet 1944, 244, 497–500. [Google Scholar] [CrossRef]
- Yuan, G.Q.; Li, Q.Q.; Wang, J.; Qin, J.; Cao, Z.H.; Lin, W. Advance in botanical fungicides I. Antimicrobial plant resource. Guangxi Agric. Sci. 2010, 41, 30–34. (In Chinese) [Google Scholar]
- Thomas, S. Secondary compounds of protective agents. Annu. Rev. Plant. Biol. 1997, 28, 479–501. [Google Scholar]
- Chaubal, R.; Deshpande, V.H.; Deshpande, N.R. Methyl gallate, the medicinally important compound: A review. Electron. J. Environ. Agric. Food Chem. 2005, 4, 956–962. [Google Scholar]
- Kang, M.S.; Jang, H.S.; Oh, J.S.; Yang, K.H.; Choi, N.K.; Lim, H.S. Effects of methyl gallate and gallic acid on the production of inflammatory mediators interleukin-6 and interleukin-8 by oral epithelial cells stimulated with Fusobacterium nucleatum. J. Microbiol. 2009, 47, 760–767. [Google Scholar] [CrossRef] [PubMed]
- Yuan, G.Q.; Li, Q.Q.; Qin, J.; Ye, Y.F.; Lin, W. Isolation of methyl gallate from Toxicodendron sylvestre and its effect on tomato bacterial wilt. Plant Dis. 2012, 96, 1143–1147. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yuan, G.Q.; Chen, Y.Y.; Fan, W.W. Physical modes of action of methyl gallate for controlling tomato bacterial wilt and its effect on secondary metabolites of tomato roots. Plant Prot. 2016, 42, 80–85. (In Chinese) [Google Scholar]
- Fan, W.W.; Yu, G.M.; Yuan, G.Q. Differential protein analysis of Ralstonia solanacearum strain Rs-T02 after methyl gallate treatment. Acta Phytopathol. Sin. 2016, 46, 47–55. [Google Scholar]
- Wang, K.H.; Zou, C.W.; Yuan, G.Q.; Lin, W.; Li, Q.Q. Transcriptome profiling in Ralstonia solanacearum Rs-T02 treated with methyl gallate. Acta Phytopathol. Sin. 2019, 49, 51–61. [Google Scholar]
- El-Halfawy, O.M.; Klett, J.; Ingram, R.J. Antibiotic capture by bacterial lipocalins uncovers an extracellular mechanism of intrinsic antibiotic resistance. Mbio 2017, 8, e00225-17. [Google Scholar] [CrossRef] [Green Version]
- Stancik, L.M.; Stancik, D.M.; Schmidt, B.; Barnhart, D.M.; Yoncheva, Y.N.; Slonczewski, J.L. PH-dependent expression of periplasmic proteins and amino acid catabolism in Escherichia coli. J. Bacteriol. 2002, 184, 4246–4258. [Google Scholar] [CrossRef] [Green Version]
- Handa, N.; Terada, T.; Doi-Katayama, Y.; Hirota, H.; Tame, J.R.H.; Park, S.Y.; Kuramitsu, S.; Shirouzu, M.; Yokoyama, S. Crystal structure of a novel polyisoprenoid-binding protein from Thermus thermophilus HB8. Protein Sci. 2005, 14, 1004–1010. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- El-Halfawy, O.M.; Valvano, M.A. Chemical communication of antibiotic resistance by a highly resistant subpopulation of bacterial cells. PLoS ONE 2013, 8, e68874. [Google Scholar]
- Zou, C.; Wang, K.H.; Meng, J.R. Draft genome sequence of Ralstonia solanacearum strain Rs-T02, which represents the most prevalent phylotype in Guangxi, China. Genome Announc. 2016, 4, e00241-16. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Imazaki, I.; Nakaho, K. Pyruvate-amended modified SMSA medium: Improved sensitivity for detection of Ralstonia solanacearum. J. General Plant Pathol. 2010, 76, 52–61. [Google Scholar] [CrossRef]
- Kenneth, J.L.; Thomas, D.S. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2002, 25, 402–408. [Google Scholar]
- Karpel, R.; Alon, T.; Glaser, G. Expression of a sodium proton antiporter (NhaA) in Escherichia coli is induced by Na+ and Li+ ions. J. Biol. Chem. 1991, 266, 21753–21759. [Google Scholar] [CrossRef]
- Takeaki, I.; Ichiro, M.; Hideki, T. Transcriptome analysis of quantitative resistance-specific response upon Ralstonia solanacearum infection in tomato. PLoS ONE 2012, 7, e46763. [Google Scholar]
- Dai, F.; Luo, G.; Wang, Z. Transcriptional analysis of different mulberry cultivars in response to Ralstonia solanacearum. Can. J. Forest. Res. 2016, 46, 152–162. [Google Scholar] [CrossRef]
- Singh, N.; Phukan, T.; Sharma, P.L. An Innovative Root Inoculation Method to Study Ralstonia solanacearum Pathogenicity in Tomato Seedlings. Phytopathology 2018, 108, 436–442. [Google Scholar] [CrossRef] [Green Version]
- Patskovsky, Y.V.; Strokopytov, B.; Ramagopal, U.; Almo, S.C.; Burley, S.K. Crystal Structure of the Escherichia coli YceI Periplasmic Protein. Protein Data Bank. Available online: https://www.rcsb.org/structure/1Y0G (accessed on 21 December 2004).
- Sisinni, L.; Cendron, L.; Favaro, G. Helicobacter pylori acidic stress response factor HP1286 is a YceI homolog with new binding specificity. FEBS J. 2010, 277, 1896–1905. [Google Scholar] [CrossRef] [PubMed]
- Kim, N.; Weeks, D.L.; Shin, J.M.; Scott, D.R.; Young, M.K.; Sachs, G. Proteins released by Helicobacter pylori in vitro. J. Bacteriol. 2002, 184, 6155–6162. [Google Scholar] [CrossRef] [Green Version]
- Toledo, H.; Valenzuela, M.; Rivas, A.; Jerez, C.A. Acid stress response in Helicobacter pylori. FEMS Microbiol. Lett. 2002, 213, 67–72. [Google Scholar] [CrossRef]
- Lee, C.; Kim, M.I.; Park, J. Crystal structure of the Pseudomonas aeruginosa PA0423 protein and its functional implication in antibiotic sequestration. Biochem. Biophys. Res. Commun. 2020, 528, 85–91. [Google Scholar] [CrossRef] [PubMed]
- Guerzoni, M.E.; Lanciotti, R.; Cocconcelli, P.S. Alteration in cellular fatty acid composition as a response to salt, acid, oxidative and thermal stresses in Lactobacillus helveticus. Microbiology 2001, 147 Pt 8, 2255–2264. [Google Scholar] [CrossRef] [Green Version]
- Shah, J. Plants under attack: Systemic signals in defence. Curr. Opin. Plant Biol. 2009, 12, 459–464. [Google Scholar] [CrossRef] [PubMed]
- Wang, W.; Miao, H.R.; Qiu, Y.X. Phenylaprapanoid metabolism of sweet potato against Pseudomonas solanacearum. Chin. J. Eco-Agric. 2009, 17, 944–948. (In Chinese) [Google Scholar] [CrossRef]
- Khan, Z.; Anjaneyulu, Y. Analysis of the distribution coefficients and mobility characteristics of phenols in different soil types. Environ. Geol. 2005, 48, 1–5. [Google Scholar] [CrossRef]
- Zhu, H.H.; Yao, Q. Localized and systemic increase of phenols in tomato roots induced by glomus versiforme inhibits Ralstonia solanacearum. J. Phytopathol. 2004, 152, 537–542. [Google Scholar] [CrossRef]
Primer | Sequence/5′-3′ | |
---|---|---|
Left-arm1 | CGACGGCCAGTGCCAAGCTTATTGCCGGAATCAGGGTGTC | For deletion mutant |
Left-arm2 | AAGTTCGAGACCCAGCTCAACGCTGGAGCTGCTCAAGAAG | For deletion mutant |
Right-arm1 | CTTCTTGAGCAGCTCCAGCGTTGAGCTGGGTCTCGAACTT | For deletion mutant |
Right-arm2 | ATGACCATGATTACGAATTCGATTCGGTCAGCGCATAGCC | For deletion mutant |
ORF1 | TCACACAGGAAACACATATGGGTGAAGCGGATCGTGCCGG | For over-expression strain |
ORF2 | TCGATACCGTCGACCTCGAGTCAGGGCTTCTTGAGCAGCT | For over-expression strain |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, K.-H.; Zheng, D.-H.; Yuan, G.-Q.; Lin, W.; Li, Q.-Q. A yceI Gene Involves in the Adaptation of Ralstonia solanacearum to Methyl Gallate and Other Stresses. Microorganisms 2021, 9, 1982. https://doi.org/10.3390/microorganisms9091982
Wang K-H, Zheng D-H, Yuan G-Q, Lin W, Li Q-Q. A yceI Gene Involves in the Adaptation of Ralstonia solanacearum to Methyl Gallate and Other Stresses. Microorganisms. 2021; 9(9):1982. https://doi.org/10.3390/microorganisms9091982
Chicago/Turabian StyleWang, Kai-Hao, De-Hong Zheng, Gao-Qing Yuan, Wei Lin, and Qi-Qin Li. 2021. "A yceI Gene Involves in the Adaptation of Ralstonia solanacearum to Methyl Gallate and Other Stresses" Microorganisms 9, no. 9: 1982. https://doi.org/10.3390/microorganisms9091982
APA StyleWang, K.-H., Zheng, D.-H., Yuan, G.-Q., Lin, W., & Li, Q.-Q. (2021). A yceI Gene Involves in the Adaptation of Ralstonia solanacearum to Methyl Gallate and Other Stresses. Microorganisms, 9(9), 1982. https://doi.org/10.3390/microorganisms9091982