Protective Effect of Indole-3-Aldehyde in Murine COVID-19-Associated Pulmonary Aspergillosis
Abstract
1. Introduction
2. Materials and Methods
2.1. Mice, Infections, and Treatments
2.2. SiRNA Design and Delivery
2.3. TUNEL Staining
2.4. Real-Time PCR
2.5. Cytokine Determination by ELISA
2.6. Cells, Infection, and Treatments
2.7. Plaque Reduction Assay
2.8. Cytopathic Effect Inhibition Assay
2.9. Statistical Analysis
3. Results
3.1. SARS-CoV-2 Spike Protein Worsens Aspergillus Infection in a Murine Model of CAPA
3.2. 3-IAld Protects against CAPA
3.3. 3-IAld Restores Mucosal Homeostasis in CAPA via the Aryl Hydrocarbon Receptor
3.4. 3-IAld Counteracts the SARS-CoV-2 Immunomodulatory Effects in Nasal Epithelial Cells
3.5. 3-IAld Exerts Direct Antiviral Effects In Vitro
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- World Health Organization. WHO Fungal Priority Pathogens List to Guide Research, Development and Public Health Action; 9240060251; Organización Mundial de la Salud (OMS): Geneva, Switzerland, 2022. [Google Scholar]
- Denning, D.W. Global incidence and mortality of severe fungal disease. Lancet Infect. Dis. 2024, 24, e428–e438. [Google Scholar] [CrossRef] [PubMed]
- van de Veerdonk, F.L.; Gresnigt, M.S.; Romani, L.; Netea, M.G.; Latge, J.P. Aspergillus fumigatus morphology and dynamic host interactions. Nat. Rev. Microbiol. 2017, 15, 661–674. [Google Scholar] [CrossRef] [PubMed]
- Costantini, C.; van de Veerdonk, F.L.; Romani, L. COVID-19-Associated Pulmonary Aspergillosis: The Other Side of the Coin. Vaccines 2020, 8, 713. [Google Scholar] [CrossRef] [PubMed]
- Koehler, P.; Bassetti, M.; Chakrabarti, A.; Chen, S.C.A.; Colombo, A.L.; Hoenigl, M.; Klimko, N.; Lass-Florl, C.; Oladele, R.O.; Vinh, D.C.; et al. Defining and managing COVID-19-associated pulmonary aspergillosis: The 2020 ECMM/ISHAM consensus criteria for research and clinical guidance. Lancet Infect Dis. 2021, 21, e149–e162. [Google Scholar] [CrossRef] [PubMed]
- Muthu, V.; Agarwal, R.; Rudramurthy, S.M.; Thangaraju, D.; Shevkani, M.R.; Patel, A.K.; Shastri, P.S.; Tayade, A.; Bhandari, S.; Gella, V.; et al. Prevalence of co-existent COVID-19-associated pulmonary aspergillosis (CAPA) and its impact on early mortality in patients with COVID-19-associated pulmonary mucormycosis (CAPM). Mycoses 2024, 67, e13745. [Google Scholar] [CrossRef] [PubMed]
- Goncalves, S.M.; Pereira, I.; Feys, S.; Cunha, C.; Chamilos, G.; Hoenigl, M.; Wauters, J.; van de Veerdonk, F.L.; Carvalho, A. Integrating genetic and immune factors to uncover pathogenetic mechanisms of viral-associated pulmonary aspergillosis. mBio 2024, 15, e0198223. [Google Scholar] [CrossRef] [PubMed]
- Gangneux, J.P.; Dannaoui, E.; Fekkar, A.; Luyt, C.E.; Botterel, F.; De Prost, N.; Tadie, J.M.; Reizine, F.; Houze, S.; Timsit, J.F.; et al. Fungal infections in mechanically ventilated patients with COVID-19 during the first wave: The French multicentre MYCOVID study. Lancet Respir. Med. 2022, 10, 180–190. [Google Scholar] [CrossRef] [PubMed]
- Bay, P.; Audureau, E.; Preau, S.; Favory, R.; Guigon, A.; Heming, N.; Gault, E.; Pham, T.; Chaghouri, A.; Turpin, M.; et al. COVID-19 associated pulmonary aspergillosis in critically-ill patients: A prospective multicenter study in the era of Delta and Omicron variants. Ann. Intensive Care 2024, 14, 65. [Google Scholar] [CrossRef]
- Costantini, C. Chapter 15—The immune system and the microbiota: The two sides of mucosal tolerance. In Translational Autoimmunity; Rezaei, N., Ed.; Academic Press: Cambridge, MA, USA, 2022; Volume 1, pp. 297–315. [Google Scholar]
- Zelante, T.; Iannitti, R.G.; Cunha, C.; De Luca, A.; Giovannini, G.; Pieraccini, G.; Zecchi, R.; D’Angelo, C.; Massi-Benedetti, C.; Fallarino, F.; et al. Tryptophan catabolites from microbiota engage aryl hydrocarbon receptor and balance mucosal reactivity via interleukin-22. Immunity 2013, 39, 372–385. [Google Scholar] [CrossRef]
- Puccetti, M.; Pariano, M.; Renga, G.; Santarelli, I.; D’Onofrio, F.; Bellet, M.M.; Stincardini, C.; Bartoli, A.; Costantini, C.; Romani, L.; et al. Targeted Drug Delivery Technologies Potentiate the Overall Therapeutic Efficacy of an Indole Derivative in a Mouse Cystic Fibrosis Setting. Cells 2021, 10, 1601. [Google Scholar] [CrossRef]
- Zelante, T.; Puccetti, M.; Giovagnoli, S.; Romani, L. Regulation of host physiology and immunity by microbial indole-3-aldehyde. Curr. Opin. Immunol. 2021, 70, 27–32. [Google Scholar] [CrossRef] [PubMed]
- Gu, T.; Zhao, S.; Jin, G.; Song, M.; Zhi, Y.; Zhao, R.; Ma, F.; Zheng, Y.; Wang, K.; Liu, H.; et al. Cytokine Signature Induced by SARS-CoV-2 Spike Protein in a Mouse Model. Front. Immunol. 2020, 11, 621441. [Google Scholar] [CrossRef] [PubMed]
- Puccetti, M.; Giovagnoli, S.; Zelante, T.; Romani, L.; Ricci, M. Development of Novel Indole-3-Aldehyde-Loaded Gastro-Resistant Spray-Dried Microparticles for Postbiotic Small Intestine Local Delivery. J. Pharm. Sci. 2018, 107, 2341–2353. [Google Scholar] [CrossRef] [PubMed]
- Centofanti, F.; Buono, A.; Verboni, M.; Tomino, C.; Lucarini, S.; Duranti, A.; Pandolfi, P.P.; Novelli, G. Synthetic Methodologies and Therapeutic Potential of Indole-3-Carbinol (I3C) and Its Derivatives. Pharmaceuticals 2023, 16, 240. [Google Scholar] [CrossRef] [PubMed]
- Gidari, A.; Sabbatini, S.; Bastianelli, S.; Pierucci, S.; Busti, C.; Bartolini, D.; Stabile, A.M.; Monari, C.; Galli, F.; Rende, M.; et al. SARS-CoV-2 Survival on Surfaces and the Effect of UV-C Light. Viruses 2021, 13, 408. [Google Scholar] [CrossRef]
- Gidari, A.; Sabbatini, S.; Schiaroli, E.; Bastianelli, S.; Pierucci, S.; Busti, C.; Saraca, L.M.; Capogrossi, L.; Pasticci, M.B.; Francisci, D. Synergistic Activity of Remdesivir-Nirmatrelvir Combination on a SARS-CoV-2 In Vitro Model and a Case Report. Viruses 2023, 15, 1577. [Google Scholar] [CrossRef] [PubMed]
- Zelante, T.; Paolicelli, G.; Fallarino, F.; Gargaro, M.; Vascelli, G.; De Zuani, M.; Fric, J.; Laznickova, P.; Kohoutkova, M.H.; Macchiarulo, A.; et al. A microbially produced AhR ligand promotes a Tph1-driven tolerogenic program in multiple sclerosis. Sci. Rep. 2024, 14, 6651. [Google Scholar] [CrossRef] [PubMed]
- Stockinger, B.; Di Meglio, P.; Gialitakis, M.; Duarte, J.H. The aryl hydrocarbon receptor: Multitasking in the immune system. Annu. Rev. Immunol. 2014, 32, 403–432. [Google Scholar] [CrossRef] [PubMed]
- Gargaro, M.; Scalisi, G.; Manni, G.; Mondanelli, G.; Grohmann, U.; Fallarino, F. The Landscape of AhR Regulators and Coregulators to Fine-Tune AhR Functions. Int. J. Mol. Sci. 2021, 22, 757. [Google Scholar] [CrossRef]
- Hou, Y.J.; Okuda, K.; Edwards, C.E.; Martinez, D.R.; Asakura, T.; Dinnon, K.H., 3rd; Kato, T.; Lee, R.E.; Yount, B.L.; Mascenik, T.M.; et al. SARS-CoV-2 Reverse Genetics Reveals a Variable Infection Gradient in the Respiratory Tract. Cell 2020, 182, 429–446.e414. [Google Scholar] [CrossRef]
- Di Stadio, A.; Costantini, C.; Renga, G.; Pariano, M.; Ricci, G.; Romani, L. The Microbiota/Host Immune System Interaction in the Nose to Protect from COVID-19. Life 2020, 10, 345. [Google Scholar] [CrossRef] [PubMed]
- Pennarossa, G.; Arcuri, S.; Pasquariello, R.; Gandolfi, F.; Maranesi, M.; Brevini, T.A.L. Cruciferous vegetable-derived indole-3-carbinol prevents coronavirus cell egression mechanisms in tracheal and intestinal 3D in vitro models. Phytochemistry 2023, 212, 113713. [Google Scholar] [CrossRef] [PubMed]
- Centofanti, F.; Alonzi, T.; Latini, A.; Spitalieri, P.; Murdocca, M.; Chen, X.; Cui, W.; Shang, Q.; Goletti, D.; Shi, Y.; et al. Indole-3-carbinol in vitro antiviral activity against SARS-Cov-2 virus and in vivo toxicity. Cell Death Discov. 2022, 8, 491. [Google Scholar] [CrossRef] [PubMed]
- Novelli, G.; Liu, J.; Biancolella, M.; Alonzi, T.; Novelli, A.; Patten, J.J.; Cocciadiferro, D.; Agolini, E.; Colona, V.L.; Rizzacasa, B.; et al. Inhibition of HECT E3 ligases as potential therapy for COVID-19. Cell Death Dis. 2021, 12, 310. [Google Scholar] [CrossRef] [PubMed]
- Dorababu, A. Indole—A promising pharmacophore in recent antiviral drug discovery. RSC Med. Chem. 2020, 11, 1335–1353. [Google Scholar] [CrossRef] [PubMed]
- Hattori, S.I.; Higashi-Kuwata, N.; Hayashi, H.; Allu, S.R.; Raghavaiah, J.; Bulut, H.; Das, D.; Anson, B.J.; Lendy, E.K.; Takamatsu, Y.; et al. A small molecule compound with an indole moiety inhibits the main protease of SARS-CoV-2 and blocks virus replication. Nat. Commun. 2021, 12, 668. [Google Scholar] [CrossRef] [PubMed]
- Boriskin, Y.S.; Leneva, I.A.; Pecheur, E.I.; Polyak, S.J. Arbidol: A broad-spectrum antiviral compound that blocks viral fusion. Curr. Med. Chem. 2008, 15, 997–1005. [Google Scholar] [CrossRef] [PubMed]
- Blaising, J.; Levy, P.L.; Polyak, S.J.; Stanifer, M.; Boulant, S.; Pecheur, E.I. Arbidol inhibits viral entry by interfering with clathrin-dependent trafficking. Antivir. Res. 2013, 100, 215–219. [Google Scholar] [CrossRef]
- Blaising, J.; Polyak, S.J.; Pecheur, E.I. Arbidol as a broad-spectrum antiviral: An update. Antivir. Res. 2014, 107, 84–94. [Google Scholar] [CrossRef]
- Zhao, X.; Zhao, L.; Zhao, Y.; Huang, K.; Gong, W.; Yang, Y.; Zhao, L.; Xia, X.; Li, Z.; Sheng, F.; et al. 3-Indoleacetonitrile Is Highly Effective in Treating Influenza A Virus Infection In Vitro and In Vivo. Viruses 2021, 13, 1433. [Google Scholar] [CrossRef]
- Nojomi, M.; Yassin, Z.; Keyvani, H.; Makiani, M.J.; Roham, M.; Laali, A.; Dehghan, N.; Navaei, M.; Ranjbar, M. Effect of Arbidol (Umifenovir) on COVID-19: A randomized controlled trial. BMC Infect. Dis. 2020, 20, 954. [Google Scholar] [CrossRef] [PubMed]
- Jie, X.; Hongmei, Y.; Ping, F.; Kuikui, Z.; Bohan, Y.; Rui, M. Beneficial effect of Arbidol in the management of COVID-19 infection. Aging 2021, 13, 9253–9264. [Google Scholar] [CrossRef]
- Tanimoto, K.; Hirota, K.; Fukazawa, T.; Matsuo, Y.; Nomura, T.; Tanuza, N.; Hirohashi, N.; Bono, H.; Sakaguchi, T. Inhibiting SARS-CoV-2 infection in vitro by suppressing its receptor, angiotensin-converting enzyme 2, via aryl-hydrocarbon receptor signal. Sci. Rep. 2021, 11, 16629. [Google Scholar] [CrossRef]
- Johnson-Weaver, B.T.; Choi, H.W.; Yang, H.; Granek, J.A.; Chan, C.; Abraham, S.N.; Staats, H.F. Nasal Immunization With Small Molecule Mast Cell Activators Enhance Immunity to Co-Administered Subunit Immunogens. Front. Immunol. 2021, 12, 730346. [Google Scholar] [CrossRef]
- Renga, G.; Nunzi, E.; Pariano, M.; Puccetti, M.; Bellet, M.M.; Pieraccini, G.; D’Onofrio, F.; Santarelli, I.; Stincardini, C.; Aversa, F.; et al. Optimizing therapeutic outcomes of immune checkpoint blockade by a microbial tryptophan metabolite. J. Immunother. Cancer 2022, 10, e003725. [Google Scholar] [CrossRef]
- Bourgonje, A.R.; Offringa, A.K.; van Eijk, L.E.; Abdulle, A.E.; Hillebrands, J.L.; van der Voort, P.H.J.; van Goor, H.; van Hezik, E.J. N-Acetylcysteine and Hydrogen Sulfide in Coronavirus Disease 2019. Antioxid. Redox Signal. 2021, 35, 1207–1225. [Google Scholar] [CrossRef]
- Liu, Y.; Lv, J.; Liu, J.; Li, M.; Xie, J.; Lv, Q.; Deng, W.; Zhou, N.; Zhou, Y.; Song, J.; et al. Mucus production stimulated by IFN-AhR signaling triggers hypoxia of COVID-19. Cell Res. 2020, 30, 1078–1087. [Google Scholar] [CrossRef] [PubMed]
- Giovannoni, F.; Li, Z.; Remes-Lenicov, F.; Davola, M.E.; Elizalde, M.; Paletta, A.; Ashkar, A.A.; Mossman, K.L.; Dugour, A.V.; Figueroa, J.M.; et al. AHR signaling is induced by infection with coronaviruses. Nat. Commun. 2021, 12, 5148. [Google Scholar] [CrossRef]
- Shi, J.; Du, T.; Wang, J.; Tang, C.; Lei, M.; Yu, W.; Yang, Y.; Ma, Y.; Huang, P.; Chen, H.; et al. Aryl hydrocarbon receptor is a proviral host factor and a candidate pan-SARS-CoV-2 therapeutic target. Sci. Adv. 2023, 9, eadf0211. [Google Scholar] [CrossRef] [PubMed]
- Haid, S.; Matthaei, A.; Winkler, M.; Sake, S.M.; Gunesch, A.P.; Milke, V.; Kohler, N.M.; Ruckert, J.; Vieyres, G.; Kuhl, D.; et al. Repurposing screen identifies novel candidates for broad-spectrum coronavirus antivirals and druggable host targets. Antimicrob. Agents Chemother. 2024, 68, e0121023. [Google Scholar] [CrossRef]
- Boule, L.A.; Burke, C.G.; Jin, G.B.; Lawrence, B.P. Aryl hydrocarbon receptor signaling modulates antiviral immune responses: Ligand metabolism rather than chemical source is the stronger predictor of outcome. Sci. Rep. 2018, 8, 1826. [Google Scholar] [CrossRef] [PubMed]
- Holloman, B.L.; Cannon, A.; Wilson, K.; Nagarkatti, P.; Nagarkatti, M. Aryl Hydrocarbon Receptor Activation Ameliorates Acute Respiratory Distress Syndrome through Regulation of Th17 and Th22 Cells in the Lungs. mBio 2023, 14, e0313722. [Google Scholar] [CrossRef] [PubMed]
- Denison, M.S.; Faber, S.C. And Now for Something Completely Different: Diversity in Ligand-Dependent Activation of Ah Receptor Responses. Curr. Opin. Toxicol. 2017, 2, 124–131. [Google Scholar] [CrossRef]
- Swimm, A.; Giver, C.R.; DeFilipp, Z.; Rangaraju, S.; Sharma, A.; Ulezko Antonova, A.; Sonowal, R.; Capaldo, C.; Powell, D.; Qayed, M.; et al. Indoles derived from intestinal microbiota act via type I interferon signaling to limit graft-versus-host disease. Blood 2018, 132, 2506–2519. [Google Scholar] [CrossRef]
- Deprez, M.; Zaragosi, L.E.; Truchi, M.; Becavin, C.; Ruiz Garcia, S.; Arguel, M.J.; Plaisant, M.; Magnone, V.; Lebrigand, K.; Abelanet, S.; et al. A Single-Cell Atlas of the Human Healthy Airways. Am. J. Respir. Crit. Care Med. 2020, 202, 1636–1645. [Google Scholar] [CrossRef]
- Vieira Braga, F.A.; Kar, G.; Berg, M.; Carpaij, O.A.; Polanski, K.; Simon, L.M.; Brouwer, S.; Gomes, T.; Hesse, L.; Jiang, J.; et al. A cellular census of human lungs identifies novel cell states in health and in asthma. Nat. Med. 2019, 25, 1153–1163. [Google Scholar] [CrossRef] [PubMed]
- Sungnak, W.; Huang, N.; Becavin, C.; Berg, M.; Queen, R.; Litvinukova, M.; Talavera-Lopez, C.; Maatz, H.; Reichart, D.; Sampaziotis, F.; et al. SARS-CoV-2 entry factors are highly expressed in nasal epithelial cells together with innate immune genes. Nat. Med. 2020, 26, 681–687. [Google Scholar] [CrossRef]
- Costantini, C.; Nunzi, E.; Spolzino, A.; Palmieri, M.; Renga, G.; Zelante, T.; Englmaier, L.; Coufalikova, K.; Spacil, Z.; Borghi, M.; et al. Pharyngeal Microbial Signatures Are Predictive of the Risk of Fungal Pneumonia in Hematologic Patients. Infect. Immun. 2021, 89, e0010521. [Google Scholar] [CrossRef]
- Costantini, C.; Nunzi, E.; Spolzino, A.; Merli, F.; Facchini, L.; Spadea, A.; Melillo, L.; Codeluppi, K.; Marchesi, F.; Marchesini, G.; et al. A High-Risk Profile for Invasive Fungal Infections Is Associated with Altered Nasal Microbiota and Niche Determinants. Infect. Immun. 2022, 90, e0004822. [Google Scholar] [CrossRef]
- Costantini, C.; Nunzi, E.; Romani, L. From the nose to the lungs: The intricate journey of airborne pathogens amid commensal bacteria. Am. J. Physiol. Cell Physiol. 2022, 323, C1036–C1043. [Google Scholar] [CrossRef]




| Murine Primers | |
| β-actin (Beta-Actin) | forward AGCCATGTACGTAGCCATCC reverse CTCTCAGCTGTGGTGGTGAA | 
| Ace2 (Angiotensin-Converting Enzyme 2) | forward TCCATT-GGTCTTCTGCCATCC reverse AACGATCTCCCGCTTCATCTC | 
| Ahr (Aryl Hydrocarbon Receptor) | forward TCCATCCTGGAAATTCGAACC reverse TCTTCATCCGTCAGTGGTCTC | 
| Ahrr (Aryl Hydrocarbon Receptor Repressor) | forward AGAGGGTTCCCCGTGCAG reverse ACTCACCACCAGAGCGAAGC | 
| Cyp1b1 (Cytochrome P450 Family 1 Subfam.B Member 1) | forward TTCTCCAGCTTTTTGCCTGT reverse TAATGAAGCCGTCCTTGTCC | 
| Human Primers | |
| β-actin (Beta-Actin) | forward CACTCTTCCAGCCTTCCTTCC reverse ACAGCACTGTGTTGGCGTAC | 
| IL1B (Interleukin 1 Beta) | forward AAGCTCCTGTGGCAATTGAA reverse TCCTCCTTCTGGAACTGCTG | 
| IL10 (Interleukin 10) | forward CCTGCCTAACATGCTTCGAGA reverse TCTTGGTTCTCAGCTTGGGG | 
| IFNA1 (Interferon Alpha 1) | forward ACCCACAGCCTGGATAACAG reverse ACTGGTTGCCATCAAACTCC | 
| IFNB1 (Interferon Beta 1) | forward AGTAGGCGACACTGTTCGTG reverse GCCTCCCATTCAATTGCCAC | 
| OAS1 (2′-5′-Oligoadenylate Synthetase 1) | forward GAGACCCAAAGGGTTGGAGG reverse TCATCGTCTGCACTGTTGCT | 
| PPARG (Peroxisome Proliferator-Activated Receptor Gamma) | forward TCGAGGACACCGGAGAGG reverse CACGGAGCTGATCCCAAAGT | 
| NQO1 (NAD(P)H Quinone Dehydrogenase 1) | forward GGTTTGGAGTCCCTGCCATT reverse ACCAGTGGTGATGGAAAGCA | 
| HMOX1 (Heme Oxygenase 1) | forward TGACCCATGACACCAAGGAC reverse AGTGTAAGGACCCATCGGAGA. | 
| Viral Primers | |
| Orf8 (Open Reading Frame 8) | forward GGTGCTGACTGAGAGCAATAA reverse CACATTAGAGCCGGTTGAGTAG | 
| RdRp (RNA-dependent RNA polymerase) | Forward ACGCTCAAAGCTACTGAGGAGAC reverse GGTCTAGGTTTACCAACTTCCC | 
| Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. | 
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pariano, M.; Gidari, A.; Stincardini, C.; Pierucci, S.; Bastianelli, S.; Puccetti, M.; Giovagnoli, S.; Bellet, M.M.; Fabi, C.; Castronari, R.; et al. Protective Effect of Indole-3-Aldehyde in Murine COVID-19-Associated Pulmonary Aspergillosis. J. Fungi 2024, 10, 510. https://doi.org/10.3390/jof10070510
Pariano M, Gidari A, Stincardini C, Pierucci S, Bastianelli S, Puccetti M, Giovagnoli S, Bellet MM, Fabi C, Castronari R, et al. Protective Effect of Indole-3-Aldehyde in Murine COVID-19-Associated Pulmonary Aspergillosis. Journal of Fungi. 2024; 10(7):510. https://doi.org/10.3390/jof10070510
Chicago/Turabian StylePariano, Marilena, Anna Gidari, Claudia Stincardini, Sara Pierucci, Sabrina Bastianelli, Matteo Puccetti, Stefano Giovagnoli, Marina M. Bellet, Consuelo Fabi, Roberto Castronari, and et al. 2024. "Protective Effect of Indole-3-Aldehyde in Murine COVID-19-Associated Pulmonary Aspergillosis" Journal of Fungi 10, no. 7: 510. https://doi.org/10.3390/jof10070510
APA StylePariano, M., Gidari, A., Stincardini, C., Pierucci, S., Bastianelli, S., Puccetti, M., Giovagnoli, S., Bellet, M. M., Fabi, C., Castronari, R., Antognelli, C., Costantini, C., Ricci, M., Francisci, D., & Romani, L. (2024). Protective Effect of Indole-3-Aldehyde in Murine COVID-19-Associated Pulmonary Aspergillosis. Journal of Fungi, 10(7), 510. https://doi.org/10.3390/jof10070510
 
        




 
       