Effects of a Resident Yeast from the Honeybee Gut on Immunity, Microbiota, and Nosema Disease
Abstract
1. Introduction
2. Materials and Methods
2.1. Yeast Isolation, Identification, and Growth Conditions (for Studies A and B)
2.2. Study A
2.2.1. Study A Overview
2.2.2. Bee Collection and Feeding Experiment
2.2.3. Total RNA Extraction, First-Strand cDNA Synthesis, and qPCR
2.3. Study B
2.3.1. Study B Overview
2.3.2. Bee Collection and Feeding Experiment
2.3.3. Total RNA Extraction, First-Strand cDNA Synthesis, and qPCR
2.4. Presentation and Statistical Analyses (for Studies A and B)
3. Results
3.1. Study A
3.1.1. W. anomalus Influenced Host Immunity, Physiology, and Gut Bacteria
3.1.2. W. anomalus Did Not Increase Short-Term Mortality When Fed to Bees
3.2. Study B
NEWs Responded Differently to W. anomalus, and N. ceranae Affected W. anomalus
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Cox-Foster, D.L.; Conlan, S.; Holmes, E.C.; Palacios, G.; Evans, J.D.; Moran, N.A.; Quan, P.-L.; Briese, T.; Hornig, M.; Geiser, D.M.; et al. A Metagenomic Survey of Microbes in Honey Bee Colony Collapse Disorder. Science 2007, 318, 283–287. [Google Scholar] [CrossRef] [PubMed]
- Zheng, H.; Steele, M.I.; Leonard, S.P.; Motta, E.V.S.; Moran, N.A. Honey bees as models for gut microbiota research. Lab Anim. 2018, 47, 317. [Google Scholar] [CrossRef] [PubMed]
- Raymann, K.; Moran, N.A. The role of the gut microbiome in health and disease of adult honey bee workers. Curr. Opin. Insect Sci. 2018, 26, 97–104. [Google Scholar] [CrossRef] [PubMed]
- Schwarz, R.S.; Moran, N.A.; Evans, J.D. Early gut colonizers shape parasite susceptibility and microbiota composition in honey bee workers. Proc. Natl. Acad. Sci. USA 2016, 113, 9345–9350. [Google Scholar] [CrossRef] [PubMed]
- Kwong, W.K.; Mancenido, A.L.; Moran, N.A. Immune system stimulation by the native gut microbiota of honey bees. R. Soc. Open Sci. 2017, 4, 170003. [Google Scholar] [CrossRef] [PubMed]
- Zheng, H.; Powell, J.E.; Steele, M.I.; Dietrich, C.; Moran, N.A. Honeybee gut microbiota promotes host weight gain via bacterial metabolism and hormonal signaling. Proc. Natl. Acad. Sci. USA 2017, 114, 4775–4780. [Google Scholar] [CrossRef] [PubMed]
- Cornman, R.S.; Tarpy, D.R.; Chen, Y.; Jeffreys, L.; Lopez, D.; Pettis, J.S.; van Engelsdorp, D.; Evans, J.D. Pathogen Webs in Collapsing Honey Bee Colonies. PLoS ONE 2012, 7, e43562. [Google Scholar] [CrossRef] [PubMed]
- Kwong, W.K.; Moran, N.A. Gut Microbial Communities of Social Bees. Nat. Rev. Microbiol. 2016, 14, 374–384. [Google Scholar] [CrossRef]
- Martinson, V.G.; Moy, J.; Moran, N.A. Establishment of Characteristic Gut Bacteria during Development of the Honeybee Worker. Appl. Environ. Microbiol. 2012, 78, 2830–2840. [Google Scholar] [CrossRef]
- Engel, P.; Martinson, V.G.; Moran, N.A. Functional diversity within the simple gut microbiota of the honey bee. Proc. Natl. Acad. Sci. USA 2012, 109, 11002–11007. [Google Scholar] [CrossRef]
- Moritz, B.; Crailsheim, K. Physiology of protein digestion in the midgut of the honeybee (Apis mellifera L.). J. Insect Physiol. 1987, 33, 923–931. [Google Scholar] [CrossRef]
- Sagili, R.R.; Pankiw, T.; Zhu-Salzman, K. Effects of soybean trypsin inhibitor on hypopharyngeal gland protein content, total midgut protease activity and survival of the honey bee (Apis mellifera L.). J. Insect Physiol. 2005, 51, 953–957. [Google Scholar] [CrossRef] [PubMed]
- Madden, A.A.; Epps, M.J.; Fukami, T.; Irwin, R.E.; Sheppard, J.; Sorger, D.M.; Dunn, R.R. The ecology of insect-yeast relationships and its relevance to human industry. Proc. R. Soc. B Biol. Sci. 2018, 285, 20172733. [Google Scholar] [CrossRef] [PubMed]
- Stefanini, I. Yeast-insect associations: It takes guts. Yeast Chichester Engl. 2018, 35, 315–330. [Google Scholar] [CrossRef] [PubMed]
- Fries, I.; Chauzat, M.-P.; Chen, Y.-P.; Doublet, V.; Genersch, E.; Gisder, S.; Higes, M.; McMahon, D.P.; Martín-Hernández, R.; Natsopoulou, M.; et al. Standard methods for Nosema research. J. Apic. Res. 2013, 52, 1–28. [Google Scholar] [CrossRef]
- Jensen, A.B.; Aronstein, K.; Flores, J.M.; Vojvodic, S.; Palacio, M.A.; Spivak, M. Standard methods for fungal brood disease research. J. Apic. Res. 2013, 52, 1–20. [Google Scholar] [CrossRef] [PubMed]
- Ptaszyńska, A.A.; Paleolog, J.; Borsuk, G. Nosema ceranae Infection Promotes Proliferation of Yeasts in Honey Bee Intestines. PLoS ONE 2016, 11, e0164477. [Google Scholar] [CrossRef] [PubMed]
- Gilliam, M. Are Yeasts Present in Adult Worker Honey Bees as a Consequence of Stress? Ann. Entomol. Soc. Am. 1973, 66, 1176. [Google Scholar] [CrossRef]
- Anderson, K.E.; Sheehan, T.H.; Eckholm, B.J.; Mott, B.M.; DeGrandi-Hoffman, G. An emerging paradigm of colony health: Microbial balance of the honey bee and hive (Apis mellifera). Insectes Sociaux 2011, 58, 431. [Google Scholar] [CrossRef]
- Yun, J.-H.; Jung, M.-J.; Kim, P.S.; Bae, J.-W. Social status shapes the bacterial and fungal gut communities of the honey bee. Sci. Rep. 2018, 8, 2019. [Google Scholar] [CrossRef]
- Gilliam, M. Microbiology of pollen and bee bread: The yeasts. Apidologie 1979, 10, 43–53. [Google Scholar] [CrossRef]
- Schaeffer, R.N.; Mei, Y.Z.; Andicoechea, J.; Manson, J.S.; Irwin, R.E. Consequences of a nectar yeast for pollinator preference and performance. Funct. Ecol. 2017, 31, 613–621. [Google Scholar] [CrossRef]
- Gilliam, M.; Wickerham, L.J.; Morton, H.L.; Martin, R.D. Yeasts isolated from honey bees, Apis mellifera, fed 2,4-D and antibiotics. J. Invertebr. Pathol. 1974, 24, 349–356. [Google Scholar] [CrossRef]
- Gilliam, M.; Morton, H.L.; Prest, D.B.; Martin, R.D.; Wickerham, L.J. The mycoflora of adult worker honeybees, Apis mellifera: Effects of 2,4,5-T and caging of bee colonies. J. Invertebr. Pathol. 1977, 30, 50–54. [Google Scholar] [CrossRef]
- Ricci, I.; Damiani, C.; Scuppa, P.; Mosca, M.; Crotti, E.; Rossi, P.; Rizzi, A.; Capone, A.; Gonella, E.; Ballarini, P.; et al. The yeast Wickerhamomyces anomalus (Pichia anomala) inhabits the midgut and reproductive system of the Asian malaria vector Anopheles stephensi. Environ. Microbiol. 2011, 13, 911–921. [Google Scholar] [CrossRef] [PubMed]
- Ricci, I.; Mosca, M.; Valzano, M.; Damiani, C.; Scuppa, P.; Rossi, P.; Crotti, E.; Cappelli, A.; Ulissi, U.; Capone, A.; et al. Different mosquito species host Wickerhamomyces anomalus (Pichia anomala): Perspectives on vector-borne diseases symbiotic control. Antonie Van Leeuwenhoek 2011, 99, 43–50. [Google Scholar] [CrossRef]
- Cappelli, A.; Ulissi, U.; Valzano, M.; Damiani, C.; Epis, S.; Gabrielli, M.G.; Conti, S.; Polonelli, L.; Bandi, C.; Favia, G.; et al. A Wickerhamomyces anomalus Killer Strain in the Malaria Vector Anopheles stephensi. PLoS ONE 2014, 9, e95988. [Google Scholar] [CrossRef]
- Padilla, B.; Gil, J.V.; Manzanares, P. Challenges of the Non-Conventional Yeast Wickerhamomyces anomalus in Winemaking. Fermentation 2018, 4, 68. [Google Scholar] [CrossRef]
- El Khoury, S.; Rousseau, A.; Lecoeur, A.; Cheaib, B.; Bouslama, S.; Mercier, P.-L.; Demey, V.; Castex, M.; Giovenazzo, P.; Derome, N. Deleterious Interaction Between Honeybees (Apis mellifera) and its Microsporidian Intracellular Parasite Nosema ceranae Was Mitigated by Administrating Either Endogenous or Allochthonous Gut Microbiota Strains. Front. Ecol. Evol. 2018, 6, 58. [Google Scholar] [CrossRef]
- White, T.J.; Bruns, T.D.; Lee, S.B.; Taylor, J.W.; Innis, M.A.; Gelfand, D.H.; Sninsky, J. Amplification and direct sequencing of fungal ribosomal RNA Genes for phylogenetics. In PCR Protocols; Academic Press: Amsterdam, The Netherlands, 1990; pp. 315–322. ISBN 978-0-12-372180-8. [Google Scholar]
- Kurtzman, C.P.; Robnett, C.J. Identification of clinically important ascomycetous yeasts based on nucleotide divergence in the 5′ end of the large-subunit (26S) ribosomal DNA gene. J. Clin. Microbiol. 1997, 35, 1216–1223. [Google Scholar]
- Evans, J.D.; Schwarz, R.S.; Chen, Y.P.; Budge, G.; Cornman, R.S.; Rua, P.D.; la Miranda, J.R.; de Foret, S.; Foster, L.; Gauthier, L.; et al. Standard methods for molecular research in Apis mellifera. J. Apic. Res. 2013, 52, 1–54. [Google Scholar] [CrossRef]
- Benaets, K.; Van Geystelen, A.; Cardoen, D.; De Smet, L.; de Graaf, D.C.; Schoofs, L.; Larmuseau, M.H.D.; Brettell, L.E.; Martin, S.J.; Wenseleers, T. Covert deformed wing virus infections have long-term deleterious effects on honeybee foraging and survival. Proc. R. Soc. B Biol. Sci. 2017, 284, 20162149. [Google Scholar] [CrossRef] [PubMed]
- Kevill, J.L.; de Souza, F.S.; Sharples, C.; Oliver, R.; Schroeder, D.C.; Martin, S.J. DWV-A Lethal to Honey Bees (Apis mellifera): A Colony Level Survey of DWV Variants (A, B, and C) in England, Wales, and 32 States across the US. Viruses 2019, 11, 426. [Google Scholar] [CrossRef] [PubMed]
- Evans, J.D.; Aronstein, K.; Chen, Y.P.; Hetru, C.; Imler, J.-L.; Jiang, H.; Kanost, M.; Thompson, G.J.; Zou, Z.; Hultmark, D. Immune pathways and defence mechanisms in honey bees Apis mellifera. Insect Mol. Biol. 2006, 15, 645–656. [Google Scholar] [CrossRef] [PubMed]
- Garcia-Gonzalez, E.; Genersch, E. Honey bee larval peritrophic matrix degradation during infection with Paenibacillus larvae, the aetiological agent of American foulbrood of honey bees, is a key step in pathogenesis. Environ. Microbiol. 2013, 15, 2894–2901. [Google Scholar] [PubMed]
- Cornman, R.S.; Lopez, D.; Evans, J.D. Transcriptional response of honey bee larvae infected with the bacterial pathogen Paenibacillus larvae. PLoS ONE 2013, 8, e65424. [Google Scholar] [CrossRef] [PubMed]
- Smet, L.D.; Hatjina, F.; Ioannidis, P.; Hamamtzoglou, A.; Schoonvaere, K.; Francis, F.; Meeus, I.; Smagghe, G.; de Graaf, D.C. Stress indicator gene expression profiles, colony dynamics and tissue development of honey bees exposed to sub-lethal doses of imidacloprid in laboratory and field experiments. PLoS ONE 2017, 12, e0171529. [Google Scholar]
- Evans, J.; Ping Chen, Y.; Di Prisco, G.; Pettis, J.; Williams, V. Bee cups: Single-use cages for honey bee experiments. J. Apic. Res. 2009, 48, 300–302. [Google Scholar] [CrossRef]
- Schwarz, R.S.; Teixeira, É.W.; Tauber, J.P.; Birke, J.M.; Martins, M.F.; Fonseca, I.; Evans, J.D. Honey bee colonies act as reservoirs for two Spiroplasma facultative symbionts and incur complex, multiyear infection dynamics. Microbiologyopen 2014, 3, 341–355. [Google Scholar] [CrossRef] [PubMed]
- Ye, J.; Coulouris, G.; Zaretskaya, I.; Cutcutache, I.; Rozen, S.; Madden, T.L. Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction. BMC Bioinform. 2012, 13, 134. [Google Scholar] [CrossRef] [PubMed]
- Klindworth, A.; Pruesse, E.; Schweer, T.; Peplies, J.; Quast, C.; Horn, M.; Glöckner, F.O. Evaluation of general 16S ribosomal RNA gene PCR primers for classical and next-generation sequencing-based diversity studies. Nucleic Acids Res. 2013, 41, e1. [Google Scholar] [CrossRef] [PubMed]
- Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic local alignment search tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef]
- Evans, J.D. Beepath: An ordered quantitative-PCR array for exploring honey bee immunity and disease. J. Invertebr. Pathol. 2006, 93, 135–139. [Google Scholar] [CrossRef] [PubMed]
- Vanengelsdorp, D.; Evans, J.D.; Saegerman, C.; Mullin, C.; Haubruge, E.; Nguyen, B.K.; Frazier, M.; Frazier, J.; Cox-Foster, D.; Chen, Y.; et al. Colony collapse disorder: A descriptive study. PLoS ONE 2009, 4, e6481. [Google Scholar] [CrossRef] [PubMed]
- de Azevedo, S.V.; Hartfelder, K. The insulin signaling pathway in honey bee (Apis mellifera) caste development-differential expression of insulin-like peptides and insulin receptors in queen and worker larvae. J. Insect Physiol. 2008, 54, 1064–1071. [Google Scholar] [CrossRef] [PubMed]
- Li, W.; Evans, J.D.; Li, J.; Su, S.; Hamilton, M.; Chen, Y. Spore load and immune response of honey bees naturally infected by Nosema ceranae. Parasitol. Res. 2017, 116, 3265–3274. [Google Scholar] [CrossRef] [PubMed]
- Nwokeoji, A.O.; Kilby, P.M.; Portwood, D.E.; Dickman, M.J. RNASwift: A rapid, versatile RNA extraction method free from phenol and chloroform. Anal. Biochem. 2016, 512, 36–46. [Google Scholar] [CrossRef]
- Galili, T.; O’Callaghan, A.; Sidi, J.; Sievert, C. heatmaply: An R package for creating interactive cluster heatmaps for online publishing. Bioinforma. Oxf. Engl. 2018, 34, 1600–1602. [Google Scholar] [CrossRef]
- Evans, J.D.; Lopez, D.L. Bacterial probiotics induce an immune response in the honey bee (Hymenoptera: Apidae). J. Econ. Entomol. 2004, 97, 752–756. [Google Scholar] [CrossRef]
- Crotti, E.; Balloi, A.; Hamdi, C.; Sansonno, L.; Marzorati, M.; Gonella, E.; Favia, G.; Cherif, A.; Bandi, C.; Alma, A.; et al. Microbial symbionts: A resource for the management of insect-related problems. Microb. Biotechnol. 2012, 5, 307–317. [Google Scholar] [CrossRef]
- Sandhu, D.K.; Waraich, M.K. Yeasts associated with pollinating bees and flower nectar. Microb. Ecol. 1985, 11, 51–58. [Google Scholar] [CrossRef] [PubMed]
- Gilliam, M.; Prest, D.B. Fungi isolated from the intestinal contents of foraging worker honey bees, Apis mellifera. J. Invertebr. Pathol. 1972, 20, 101–103. [Google Scholar] [CrossRef]
- Winston, M.L. The Biology of the Honey Bee; Harvard University Press: Cambridge, MA, USA, 1991; ISBN 978-0-674-07409-5. [Google Scholar]
- Ricigliano, V.A.; Fitz, W.; Copeland, D.C.; Mott, B.M.; Maes, P.; Floyd, A.S.; Dockstader, A.; Anderson, K.E. The impact of pollen consumption on honey bee (Apis mellifera) digestive physiology and carbohydrate metabolism. Arch. Insect Biochem. Physiol. 2017, 96, e21406. [Google Scholar] [CrossRef] [PubMed]
- Vega, F.E.; Dowd, P. The role of yeast as insect endosymbionts. In Insect-Fungal Associations: Ecology and Evolution; Oxford University Press: New York, NY, USA, 2005; pp. 211–243. [Google Scholar]
- Hong, S.-H.; Song, Y.-S.; Seo, D.-J.; Kim, K.-Y.; Jung, W.-J. Antifungal activity and expression patterns of extracellular chitinase and β-1,3-glucanase in Wickerhamomyces anomalus EG2 treated with chitin and glucan. Microb. Pathog. 2017, 110, 159–164. [Google Scholar] [CrossRef] [PubMed]
- Muccilli, S.; Wemhoff, S.; Restuccia, C.; Meinhardt, F. Exoglucanase-encoding genes from three Wickerhamomyces anomalus killer strains isolated from olive brine. Yeast 2013, 30, 33–43. [Google Scholar] [CrossRef] [PubMed]
- Erler, S.; Denner, A.; Bobiş, O.; Forsgren, E.; Moritz, R.F.A. Diversity of honey stores and their impact on pathogenic bacteria of the honeybee, Apis mellifera. Ecol. Evol. 2014, 4, 3960–3967. [Google Scholar] [CrossRef] [PubMed]
- Palmer-Young, E.C.; Tozkar, C.Ö.; Schwarz, R.S.; Chen, Y.; Irwin, R.E.; Adler, L.S.; Evans, J.D. Nectar and Pollen Phytochemicals Stimulate Honey Bee (Hymenoptera: Apidae) Immunity to Viral Infection. J. Econ. Entomol. 2017, 110, 1959–1972. [Google Scholar] [CrossRef] [PubMed]
- Rolfe, R.D. The role of probiotic cultures in the control of gastrointestinal health. J. Nutr. 2000, 130, 396S–402S. [Google Scholar] [CrossRef] [PubMed]
- Konrad, M.; Vyleta, M.L.; Theis, F.J.; Stock, M.; Tragust, S.; Klatt, M.; Drescher, V.; Marr, C.; Ugelvig, L.V.; Cremer, S. Social transfer of pathogenic fungus promotes active immunisation in ant colonies. PLoS Biol. 2012, 10, e1001300. [Google Scholar] [CrossRef] [PubMed]
- Smith, M.L. The Honey Bee Parasite Nosema ceranae: Transmissible via Food Exchange? PLoS ONE 2012, 7, e43319. [Google Scholar] [CrossRef] [PubMed]
- Powell, J.E.; Martinson, V.G.; Urban-Mead, K.; Moran, N.A. Routes of Acquisition of the Gut Microbiota of the Honey Bee Apis mellifera. Appl. Environ. Microbiol. 2014, 80, 7378–7387. [Google Scholar] [CrossRef] [PubMed]
- Maori, E.; Garbian, Y.; Kunik, V.; Mozes-Koch, R.; Malka, O.; Kalev, H.; Sabath, N.; Sela, I.; Shafir, S. A Transmissible RNA Pathway in Honey Bees. Cell Rep. 2019, 27, 1949–1959.e6. [Google Scholar] [CrossRef] [PubMed]


| Target | Forward Primer | Reverse Primer | Ref. |
|---|---|---|---|
| Deformed wing virus (DWV) | GAGATTGAAGCGCATGAACA | TGAATTCAGTGTCGCCCATA | [45] |
| Lactobacillus Firm-5 | GGAATACTTCGGTAGGAA | CTTATTTGGTATTAGCACC | [9] |
| S. alvi | CTTAGAGATAGGAGAGTG | TAATGATGGCAACTAATGACAA | [4] |
| G. apicola | GTATCTAATAGGTGCATCAATT | TCCTCTACAATACTCTAGTT | [4] |
| Universal bacteria | AGAGTTTGATCCTGGCTCAG | CTGCTGCCTCCCGTAGGAGT | [4] |
| W. anomalus | TTTTCGAATCGCATGACTTCGTGTC | GCCTTCCTTGGATGTGGTAGC | [25] |
| W. anomalus | GAGTGAAGCGGCAAAAGCTC | ACAAGAGCCAAACCCAAGGT | This work |
| N. ceranae | TATTGTAGAGAGGTGGGAGATT | GCTATGATCGCTTGCC | [15] |
| N. apis | CTAGTATATTTGAATATTTGTTTACAATGG | GCTATGATCGCTTGCC | [15] |
| Ribosomal protein (RPS5a) | AATTATTTGGTCGCTGGAATTG | TAACGTCCAGCAGAATGTGGTA | [4] |
| Actin related protein (Arp1) | CCAAAGACCCAAGCTCCCTA | TGGCTTATTGGTTTATGTTTTTCGT | [4] |
| Vitellogenin (Vg) | TCGACAACTGCGATCAAAGGA | TGGTCACCGACGATTGGATG | [4] |
| Insulin-like peptide 1 (AmILP1) | CGATAGTCCTGGTCGGTTTG | CAAGCTGAGCATAGCTGCAC | [46] |
| Insulin-like receptor 1 (AmILR1) | GGATCTGGTGTGGGACAGTT | ATCCCCACGTCGAGTATCTG | [46] |
| Insulin-like peptide 2 (AmILP2) | TTCCAGAAATGGAGATGGATG | TAGGAGCGCAACTCCTCTGT | [46] |
| Insulin-like receptor 2 (AmILR2) | GGGAAGAACATCGTGAAGGA | CATCACGAGCAGCGTGTACT | [46] |
| Apidaecin | TAGTCGCGGTATTTGGGAAT | TTTCACGTGCTTCATATTCTTCA | [44] |
| Hymenoptaecin | CTCTTCTGTGCCGTTGCATA | GCGTCTCCTGTCATTCCATT | [44] |
| Abaecin | AGATCTGCACACTCGAGGTCTG | TCGGATTGAATGGTCCCTGA | [47] |
| Eater | CATTTGCCAACCTGTTTGT | ATCCATTGGTGCAATTTGG | [44] |
| PGRP-S1 | CCCAACAATGCAGCTCTGAA | TTTGGTATTGGTTTGGACGTCC | [47] |
| PGRP-LC | TCGGAGCGAGATAGTGCATT | CCATCTGCGGTTGTCACTTC | [47] |
| GNBP1-1 | CTCGGGGTAGGAGTTGGTG | ACCATTGATCTTTTGCATGCCA | [47] |
| Peritrophin | GCAAACGAGATTTCAATGGCAATCTTCAG | CACATTGGTAATTGTATAGTACGTTCGCATC | [37] |
| Cytochrome P450 (CYP9Q1) | ATCCTGGCCAAGTGCAGCTTC | CAGCTCCTTCAATTGGATCAGCAAC | [37] |
| Control | |||
| Variable | by Variable | Spearman rs | Prob > |rs| |
| Firm-5 | UnvBacteria | 0.6844 | 0.0006 * |
| G. apicola | UnvBacteria | 0.606 | 0.0036 * |
| G. apicola | Firm-5 | 0.2891 | 0.2038 |
| S. alvi | UnvBacteria | 0.6727 | 0.0008 * |
| S. alvi | Firm-5 | 0.2714 | 0.234 |
| S. alvi | G. apicola | 0.6853 | 0.0006 * |
| W. anomalus-fed | |||
| Variable | by Variable | Spearman rs | Prob > |rs| |
| Firm-5 | UnvBacteria | 0.8682 | <0.0001 * |
| G. apicola | UnvBacteria | 0.8878 | <0.0001 * |
| G. apicola | Firm-5 | 0.87 | <0.0001 * |
| S. alvi | UnvBacteria | 0.8667 | <0.0001 * |
| S. alvi | Firm-5 | 0.71 | <0.0001 * |
| S. alvi | G. apicola | 0.7003 | <0.0001 * |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tauber, J.P.; Nguyen, V.; Lopez, D.; Evans, J.D. Effects of a Resident Yeast from the Honeybee Gut on Immunity, Microbiota, and Nosema Disease. Insects 2019, 10, 296. https://doi.org/10.3390/insects10090296
Tauber JP, Nguyen V, Lopez D, Evans JD. Effects of a Resident Yeast from the Honeybee Gut on Immunity, Microbiota, and Nosema Disease. Insects. 2019; 10(9):296. https://doi.org/10.3390/insects10090296
Chicago/Turabian StyleTauber, James P., Vy Nguyen, Dawn Lopez, and Jay D. Evans. 2019. "Effects of a Resident Yeast from the Honeybee Gut on Immunity, Microbiota, and Nosema Disease" Insects 10, no. 9: 296. https://doi.org/10.3390/insects10090296
APA StyleTauber, J. P., Nguyen, V., Lopez, D., & Evans, J. D. (2019). Effects of a Resident Yeast from the Honeybee Gut on Immunity, Microbiota, and Nosema Disease. Insects, 10(9), 296. https://doi.org/10.3390/insects10090296

