Next Article in Journal
Lymphocyte Subset Imbalance in Cardiometabolic Diseases: Are T Cells the Missing Link?
Previous Article in Journal
Adipose-Derived Stromal Cells Exposed to RGD Motifs Enter an Angiogenic Stage Regulating Endothelial Cells
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 26
Issue 3
10.3390/ijms26030869
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Phylogenetic Relationship and Characterization of the Complete Mitochondrial Genome of the Cuckoo Species Clamator coromandus (Aves: Cuculidae)

by
Yu Zhang
1,
Hao Gao
1,
Fan Zhang
1,
Chengxing Xia
2,
Guopan Li
1 and
Shaobin Li
1,*
1
College of Life Sciences, Yangtze University, Jingzhou 434025, China
2
College of Fisheries, Huazhong Agricultural University, Wuhan 430070, China
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2025, 26(3), 869; https://doi.org/10.3390/ijms26030869
Submission received: 5 November 2024 / Revised: 11 January 2025 / Accepted: 18 January 2025 / Published: 21 January 2025
(This article belongs to the Section Molecular Genetics and Genomics)
Browse Figures
Versions Notes

Abstract

The chestnut-winged cuckoo (Clamator coromandus) is a bird species known for its brood parasitism, laying eggs in the nests of other bird species. However, there is a paucity of genetic information available for this species and their genus Clamator. In this study, we present the first complete mitochondrial genome sequence of C. coromandus and compare it with other species within the Cuculidae family. The mitogenome is a closed circular molecule consisting of 17,082 bp with an organization typical of the mitochondrial genomes of Cuculidae. Alignment of the control regions across Cuculidae species revealed substantial genetic variation and a significant abundance of AT content. A significant difference was detected in AT-skews between brood-parasitic and parental-care species. A distinctive long poly-C sequence was located at the 5′ end of domain I. Phylogenetically, C. coromandus is more closely related to Piaya cayana than Ceuthmochares aereus. The phylogenetic analysis indicated a general divergence between species with brood parasitism and those with parental care, with transitions between these behaviors within brood parasitism branches, suggesting multiple evolutionary occurrences of these traits. The complete mitogenome of C. coromandus serves as a valuable resource for further investigation into the taxonomic status and phylogenetic history of Clamator species.

1. Introduction

The family Cuculidae, the cuckoos, malkohas, ani’s, and roadrunners (147 species in 24 genera) [1], is notable for its diverse social behaviors and reproductive strategies. It is best known for its brood-parasitic members, which lay their eggs in the nests of other bird species, thereby relinquishing parental responsibilities [1,2]. Brood parasitism has evolved independently at least three times within this family, with many species exhibiting this behavior [3]. These cuckoos parasitize a remarkable variety of hosts globally, often laying eggs that closely mimic those of their hosts. Some species’ young may even eject host eggs from the nest upon hatching [4]. Primarily forest dwellers, these birds are often elusive, detected more by their distinctive, simple whistled calls than by sight.
The chestnut-winged cuckoo (Clamator coromandus), a member of the genus Clamator, is well-known for its striking plumage and unique behaviors [5]. The genus Clamator currently contains four species, but little information is available on them. The chestnut-winged cuckoo is a medium-sized bird, weighing between 66 and 86 g. It is notable for its metallic glossy black plumage, spiky crest, and narrow white nape-band. This species breeds across northern India and Nepal, extending eastward to southern and eastern China, with an altitudinal distribution up to 2450 m [6,7]. The chestnut-winged cuckoo typically lays its eggs in the nests of other bird species. As an insectivorous and migratory species, it winters in southern India, Sri Lanka, and the Greater Sundas. It thrives in diverse habitats, from wooded areas to scrub, bushes, orchards, plantations, and tall reedbeds [8].
However, C. coromandus remains a poorly understood species, with existing knowledge primarily limited to basic species accounts [1,4,5]. This study addresses this gap in research concerning its genetic characteristics by sequencing and reporting the complete mitochondrial genome of C. coromandus. We generated new data from this species and compared them with mitogenome sequences of other cuckoo species available in GenBank (Table 1). Our objectives were threefold: (a) to elucidate the sequences, features, and structures of the mitochondrial genome of C. coromandus, (b) to compare the mitogenome sequences between interspecific brood parasitism and parental care species, and (c) to describe the taxonomic status and phylogenetic relationships of C. coromandus within the family Cuculidae. The complete mitochondrial genome provides valuable insights into the evolutionary history and phylogenetic positioning of C. coromandus and related species within the broader avian phylogeny. Our findings contribute to a better understanding of species identification and genetic evolution within the Cuculidae family.

2. Results

2.1. Genome Content and Organization

The complete mitochondrial genome (mitogenome) of C. coromandus is a closed circular molecule and 17,082 bp in length. It contains the typical set of 37 genes found in vertebrate mitogenomes, including 13 protein-coding genes (PCGs), 22 transfer RNA (tRNA) genes, 2 ribosomal RNA (rRNA) genes (12S rRNA and 16S rRNA), a control region (CR), and an additional pseudo-control region (CCR) (Table 2, Figure 1). Compared to the classical mitochondrial structure, the mitogenome of C. coromandus has four duplicate genes (ND6, trnT, trnP, and trnE) and an extra CR, referred to as a CCR. ND6 and 8 tRNAs are transcribed from the light strand (L), while the other 12 PCGs, 14 tRNAs, 2 rRNAs, and 2 noncoding regions (CR, CCR) are located on the heavy (H) strand. The nucleotide composition of the mitogenome of C. coromandus is biased towards A and T (55.87%: A = 32.46%, T = 23.42%, G = 13.10%, and C = 31.03%). In the full mitogenome of C. coromandus, the AT- and GC-skews were 0.16 and −0.41. The A + T content of the CR was notably higher than that of the PCGs, tRNAs, and rRNAs (Table S1).
Mitochondrial genes overlapped by a total of 35 bp across 11 different locations, ranging from 1 to 10 bp. The longest overlap (10 bp) was found between the ATP6 and ATP8 genes, while the shortest overlap (1 bp) was observed in 12S rRNA-tRNA-Phe, tRNA-Val-12S rRNA, 16S rRNA-tRNA-Val, tRNA-Leu-16S rRNA, tRNA-Met-tRNA-Gln, COXⅢ-ATP6, and tRNA-Leu-tRNA-Ser genes. Additionally, some PCGsshared 1–10 nucleotides with adjacent tRNA genes. Furthermore, 17 intergenic spacers were present in the mitogenome of C. coromandus, totaling 86 bp. The longest spacer sequence was 15 nucleotides long, located between the ND1 and tRNA-Ile genes (Table 2).
AT/GC skews were essentially similar in the mitochondrial PCGs, two rRNA genes, and the mitogenomes of other species of Cuculidae, except for a few genes (ND1, ND3, and ND6; Table S2). Notably, Centropus bengalensis exhibited a negative AT-skew in, while the other fourteen species had positive AT-skews (Table S2). For ND3 genes, Centropus unirufus showed a negative AT-skew, whereas the other fourteen species had positive AT-skews. Apparent positive AT-skew and negative GC-skew biases were identified for all 12 PCGs (except for ND1, ND3, and ND6) encoded by the H-strand, whereas the reverse was detected in ND6 encoded by the L-strand (Table S2).
From the perspective of overall mitochondria and 13PCGs (Table S2), both brood parasites and parental care species exhibited similar AT/GC skews, with positive AT-skews and negative in GC-skews. Nonparametric tests (Table 3) revealed significant differences between brood parasites and parental care species in the AT-skews of overall mitochondria and 13PCGs (p < 0.05), while no significant differences were found in GC-skews (p > 0.05).

2.2. Protein-Coding Genes and Codon Usage Patterns

The 13 mitochondrial PCGs of C. coromandus span 11,391 bp, which account for 66.68% of the total mitogenome sequence. These PCGs consist of 3797 codons in total. Most PCGs use ATG as the start codon, except for ND3 and ND6, which start with ATT and CTA, respectively (Table 2). TAA is the most frequent stop codon in the mitogenome of C. coromandus. COXⅢ, ND4, and ND6 have incomplete stop codons (T-), ND1 and ND5 end with AGA, ND2 ends with TAG, and COXI ends with AGG. All other stop codons are the standard terminal codon (TAA). Among the 64 available codons, the most commonly used ones were for proline (P; CCA; 3.92%), threonine (T; ACA; 3.95%), phenylalanine (F; UUC; 4.19%), isoleucine (I; AUC; 5.38%), and leucine (L; CUA; 7.31%). Leucine was the most frequently used amino acid in C. coromandus (Table 4, Figure 2). In contrast, the codons UUG, GUG, GCG, UGU, CGU, CGG, and GGG were rarely used, accounting for only 1.14% of the amino acids. Among the 60 codons analyzed, 28 had Relative Synonymous Codon Usage (RSCU) values greater than or equal to 1.00, indicating a preference for these codons. Leucine (Leu) has a higher preference for CUA, and the RSCU value is the highest in mitochondrial genome PCGs, which is 3.03. Methionine (AUG) and Tryptophan (UGG) showed no codon preference (RSCU = 1) (Table 4). The stop codons UAA, UAG, AGA, and AGG do not encode amino acids. Most amino acids have at least two different codons, while leucine has six codons (Figure 2). The base composition of the three codon positions of the 13 PCGs is shown in Table S3. The A + T content is 51.89% at the first position, 58.78% at the second position, and 54.54% at the third position. Hence, the second position has the highest A + T content, whereas the first position has the highest C + G content (48.11%; second position: 41.22%; third position: 45.46%). Moreover, the first positions and third positions have a positive AT-skew and negative GC-skews, but the second positions have negative AT- and GC-skews (Table S3). Among the 13 PCGs in the mitogenome of C. coromandus (Table 2), ATP8 has the highest A + T content (58.9%), and COXI has the lowest (52.9%).

2.3. Transfer and Ribosomal RNA Genes

The mitogenome of C. coromandus contains the typical set of 22 tRNA genes with conventional secondary structures. The total length of mitochondrial tRNA genes is 1542 bp, with individual genes sizes ranging from 65 bp (tRNA-Cys) to 74 bp (tRNA-Leu1 and tRNA-Ser1). Most tRNAs can be folded into the canonical cloverleaf secondary structure, except for tRNA-Ser (GCT), which lacks the DHU arm and loop but contains the TΨC arm and loop. A total of 31 unmatched base pairs were found in the tRNAs of C. coromandus, with the most common being G-U (22 instances), followed by U-U (2 instances), A-C (4 instances), U-C (1 instance), A-A (1 instance), and C-C (1 instance) (Figure S1). The 12S rRNA gene is located between tRNA-Phe and tRNA-Val, while the 16S rRNA gene is situated between tRNA-Val and tRNA-Leu (Figure 1). The lengths of the 12S rRNA and 16S rRNA were 975 bp and 1596 bp, respectively (Table 2). The base composition of the 12S rRNA gene is 20.21% T, 26.97% C, 32.92% A, and 19.9% G, with an A + T content of 53.13%. The 16S rRNA gene has a base composition of 21.74% T, 25.31% C, 34.71% A, and 18.23% G, with an A + T content of 56.45%.

2.4. Noncoding Regions

The noncoding region of the mitogenome of C. coromandus comprises two major control regions. The first CR is 1143 bp long and is located between tRNA-Thr and tRNA-Pro. The second is a short noncoding region, referred to as the CCR, which is 384 bp in length and situated after the tRNA-Glu gene (Figure 1). The CCR sequence is the shortest among all sequences in the mitogenome (Table 5). The base frequencies in the CR of C. coromandus are 30.53% T, 27.12% C, 29.31% A, and 13.04% G, whereas those in the CCR are 12.50% T, 31.25% C, 54.95% A, and 1.30% G.
Hypervariable domain I (D I), located to the left (5′ end) of the CR, typically contains tandem repeat sequences with a copy number ranging from 1 to 8. The copy number varies both between species and among individuals within a species. At the 5′-end of D I, we observed a long continuous poly-C sequence (Figure 3), which appears to be a conserved feature. Conserved palindromic motifs 5′-TACAT-3′ and 5′-ATGTA-3′ were identified at the 5′ end of the CR of C. coromandus (Figure 3). The four conserved boxes (C, D, E, and F) and the CSB1 regions were also found in C. coromandus (Figure 3 and Figure 4a).
As shown in Figure 4a, the CCR of C. coromandus contains a 157 bp nonrepeating region (nr-CCR) at the 5′ end, followed by a cluster of tandem repeats at the 3′ end (r-CCR): 32 units of 7 bp repeat units (followed by a 6 bp incomplete repeat unit) (Figure 4, Table 5). In Eudynamys scolopaceu, two clusters of repetitive regions were observed in the CCR (Figure 4b): the first cluster (66 bp per unit, 5 times) at the 5′ region, and the second cluster (7 bp per unit, 23 times) at the 3′ region. These two regions are separated by a 28 bp nr-CCR and show no similarity to each other.

2.5. Phylogenetic Relationships

To explore the molecular phylogenetics and evolution of Cuculidae, a phylogenetic analysis was conducted based on the nucleotide sequence data of the 13 PCGs of C. coromandus and 14 other species ofCuculidae. Clangula hyemalis was used as the outgroup. The maximum likelihood tree is shown in Figure 5. The maximum likelihood trees showed stable topological structures with high nodal support values. Based on 14 other complete mitogenome sequences retrieved from NCBI GenBank (Table S1), most internal nodes were well-supported by bootstrap values (Figure 5). The results indicate that the genus Eudynamys is not monophyletic because Eudynamys taitensis was more closely related to species of Cuculus and Chrysococcyx than to E. scolopaceus (Figure 5). The phylogenetic tree reveals that among the 14 other species of Cuculidae, C. coromandus was closely related to Ceuthmochares aereus and Piaya cayana, with C. coromandus being most closely related to P. cayana. Comparisons of genetic divergence also indicated that C. coromandus was most similar P. cayana (Figure 6). The phylogenetic tree also indicates a general separation between interspecific brood parasitism and parental care, with a transition towards brood parasitism occurring twice within the evolutionary history of the cuckoos, once in the lineage leading to C. coromandus and once in the lineage leading to the clade formed by Eudynamys, Cuculus, and Chrysococcyx. We have marked the locations of the sampling points on the phylogenetic tree and found that all sampling sites of species in the Cuculus genus are located in China, with all species within this genus being brood parasites (Figure 5). From a phylogenetic perspective, cuckoos, as migratory birds, are distributed across various regions worldwide. We reconstructed the ancestral characteristics of the Cuculidae family (Figure 7). The phylogenetic analysis indicates a transition from parental care to brood parasitism within the cuckoo lineage. The results of our ancestral state reconstruction align with those presented in Figure 5.

3. Discussion

The complete mitochondrial genome of C. coromandus is a closed circular molecule, which is similar to other members of the Cuculidae family. It contains the typical set of 37 genes found in vertebrate mitogenomes. This configuration is consistent with other Cuculidae species [9]. Previous studies have suggested that the extra CR could confer selective advantages, such as a replicative advantage, to duplicated mitochondrial DNAs over those with a single CR [10,11]. In addition, we observed mitochondrial genome rearrangements in C. coromandus. Specifically, an additional noncoding sequence was found between the tRNA-Glu and tRNA-Phe genes aside from the original control region located between tRNA-Thr and tRNA-Pro [12]. The presence of the CCR is noted in the mitochondrial genomes of numerous bird species [13]. Other Cuculiformes species also possess a CR and a short CCR [14,15]. Similar rearrangements have been detected in representatives of Passeriformes, Procellariiformes, Falconiformes, Piciformes, and Psittaciformes [16,17,18]. Studies have also found that the duplication of CRs in the mitochondrial genome is associated with longer lifespans in birds compared to mammals of similar weight [19]. The gene arrangement pattern of the mitochondrial genome of C. coromandus is identical to that of other species of Cuculidae, all of which have the remnant CCR gene order, differing from the standard bird gene order [20,21]. AT-skew, GC-skew, and A + T content are commonly used to assess differences in the nucleotide composition of mitochondrial genomes [22]. This mitogenome has greater A + T content (55.87%) (Table S1) compared to the G + C content (44.13%), which is similar to other species of Cuculidae [23,24]. Some PCGsshare nucleotides with adjacent tRNA genes. This compact and economical arrangement is a common feature of mitochondrial DNA [25].
COXⅢ, ND4, and ND6 have incomplete stop codons (T-). These incomplete stop codons are presumably completed through post-transcriptional polyadenylation using a poly-A tail [26]. Codon preference refers to the phenomenon where specific codons are utilized more prevalently than others in the DNA or RNA sequences of certain organisms, which can influence gene expression and protein assembly [27]. Leucine (Leu) has a higher preference for CUA. Methionine (AUG) and Tryptophan (UGG) showed no codon preference. Consistent with other vertebrates [28], there is a strong bias against G at the third codon position in all 13 PCGs. The G content is 5.93% at the third codon position (Table S2).
Meanwhile, tRNA-Ser (GCT) lacks a DHU arm and loop. This feature is typical of vertebrate mitogenomes [29] and is generally observed in vertebrate tRNA genes [30]. Structural compensation mechanisms may render the missing arm in tRNA-Ser functional [31]. Most anticodons are identical to those observed in other Cuculidae species, and the CCA 3′-terminal group is added during processing. A total of 31 unmatched base pairs were found in the tRNAs of C. coromandus. Stem mismatches are common in tRNA genes and are likely repaired through post-transcriptional editing [32]. Compared to other birds, most mismatched nucleotides were G–U pairs, which can form weak bonds in tRNAs and noncanonical pairs in tRNA secondary structures [33]. The gene order, arrangement, length, base composition, and RNA structure of the ribosomal RNA genes (12S rRNA and 16S rRNA) are similar to those in other Cuculidae birds.
Both vertebrates and invertebrates CRs exhibit high A + T content and possess replication initiation features [34]. The A + T content of the CR of C. coromandus is 59.8%, and the CCR is 67.5% (Table 2). The control region of C. coromandus shares structural similarities with Chrysococcyx minutillus and Chrysococcyx russatus, and it exhibits common characteristics found in other birds [35]. Generally, three distinct CR domains are recognized: (a) the highly variable, left-end domain I (D I); (b) the conserved, central domain (D II); and (c) the right-end domain III (D III) [36]. A conserved palindromic motif can be identified at the 5′ end of the CR of C. coromandus [37]. The CCR of C. coromandus contains a cluster of tandem repeats (Figure 4, Table 5). In E. scolopaceu, two clusters of repetitive regions were observed in the CCR (Figure 4b). These variable tandem repeats are the primary cause of length variability in mitochondrial genome control regions and the entire mitogenome [38,39].
In this study, a phylogenetic analysis was conducted on the nucleotide sequence data of 13 PCGs from C. coromandus and 14 otherspecies of Cuculidae. C. hyemalis was selected as the outgroup. The complete mitochondrial genome of C. coromandus will hopefully contribute to the systematic and molecular identification of Cuculidae. The phylogenetic trees indicate that E. scolopaceus is not a sister-taxon of E. taitensis. Our current study provides further evidence for a closer phylogenetic relationship between C. coromandus and P. cayana compared to other species included in our data [40], suggesting the need for further investigation. C. coromandus, as a brood-parasitic species, is more closely related to parental care (P. cayana) (Figure 5). Species that are more similar in terms of brood parasitic behavior are not necessarily more closely related in the phylogeny of the Cuculidae family [41]. This result is consistent with our study. All clades were well-resolved, illustrating that despite their rapid evolutionary rates, mitogenomes possess species-specific evolutionary relationships that can be effectively elucidated through enhanced taxon sampling [42]. By adding sampling points for species on the phylogenetic tree, we observed that cuckoos inhabit numerous regions globally; however, all sampling points for species within the Cuculus genus are confined to China. Research into the migration routes and wintering grounds of Cuculus canorus has demonstrated that their migration paths exhibit relative stability with minimal variation, ultimately leading them to winter in Africa [43,44]. From the perspective of the phylogenetic tree, the sampling point for C. canorus was situated in Sichuan Province, China, thereby providing valuable data for studying the migratory behavior of this species. Darwin initially proposed that parasitic cuckoos evolved from parental cuckoos [45]. Our findings demonstrate a general distinction between interspecific brood parasitism and parental care, with transitions between these behaviors occurring at least twice within the evolutionary history of cuckoos. Following our reconstruction of ancestral traits within Cuculidae (Figure 7), we found that these results corroborate findings from this study, which supports the hypothesis regarding a transition from parental care to interspecific brood parasitism.

4. Materials and Methods

4.1. Sample Collection and Genomic DNA Extraction

Muscle tissue from a male C. coromandus (Figure S2) was collected from an individual that died accidentally from glass collision near the east gate of the ancient city in Jingzhou County, Hubei Province, China (latitude: 30°20′5″ N; longitude: 112°12′57″ E; Figure 8) on 29 October 2022. This species can be easily distinguished by its body size and plumage patterns [46]. The sex of the individuals was determined using a pair of universal primers for avian sex identification [47]. Whole-genome DNA was extracted from the muscle tissue according to the protocol of TIANamp Genomic DNA kits (Tiangen, Beijing, China). The remaining sample is now stored in herbarium room 317 of the #1 Teaching Building on the West campus of Yangtze University (www.yangtzeu.edu.cn, Dr. Shaobin Li, shaobinlee@126.com).

4.2. Mitochondrial DNA Amplification and Sequencing

High-throughput sequencing technology was employed to sequence the mitochondrial genome of C. coromandus from the muscle tissue. Genomic DNA was extracted, and a DNA library was constructed using the TruSeq Nano DNA HT Sample Prep Kit (Illumina, San Diego, CA, USA). The library was sequenced on an Illumina HiSeq/NovaSeq platform with a 2 × 150 paired-end sequencing strategy.

4.3. Assembly, Annotation, and Analysis of the Mitochondrial Genome

The complete mitochondrial genome sequence of C. coromandus was assembled using the SeqMan module of DNASTAR software (DNASTAR, Inc., Madison, WI, USA) [48]. PCGs were identified through sequence comparisons with known sequences of other birds using the CLUSTAL W program. Transfer RNA (tRNA) genes and their secondary structures were identified using tRNAscan-SE 1.21 [49] or based on their proposed secondary structures and anticodons [50]. Ribosomal RNA genes (rRNAs) were identified via NCBI BLAST search and comparisons. An online tool, CGVIEW, was employed to draw the mitogenome structure map (https://cgview.ca/ accessed on 17 January 2025) [51]. Codon usage and nucleotide composition statistics were computed using MEGA 7.0 [52]. If RSCU = 1, there is no preference for the use of this codon, and if RSCU > 1, the codon is used preferentially by amino acids, while if RSCU < 1, the codon usage is contrary. Composition skew analysis was performed with the formulas AT-skew = [A − T]/[A + T] and GC-skew = [G − C]/[G + C] [53]. The 15 species of Cuculidae were divided into two categories, namely, brood parasites and parental care (Table 1). We employed the non-parametric Mann–Whitney U test to determine whether AT/GC-skew nucleotides differ between brood parasites and parental care using SPSS 20.0 software. Because the sample size was too small (brood parasites: n = 8; parental care: n = 7) and the two groups of data did not follow a normal distribution, non-parametric tests were used for comparison. Based on the next-generation sequencing method, the complete sequence of the mitochondrial genome of C. coromandus was assembled and compared with the species of the same family reported in GenBank to determine the start and end points of the control region. By conducting a comprehensive alignment of the reported mitochondrial control region structures in birds [35,54,55,56], we analyzed the structure of the mitochondrial control region of C. coromandus and identified three regions within its control region: the termination-associated sequence (ETAS), the central conserved region (CD), and the conserved sequence block (CSB). The core of ETAS is TACAT, and its reverse complementary sequence is ATGTA, which can form a hairpin structure. In the CD, three characteristic fragments were identified, namely CSB-D, CSB-E, and CSB-F. The CSB typically contains three conserved sequences: CSB1, CSB2, and CSB3. The sequence of the complete mitogenome of C. coromandus was deposited in GenBank under accession number OM687253.

4.4. Phylogenetic Analysis

The PCGs were extracted from mitogenomes using PhyloSuite v.1.1.16 [57]. Repetitive sequences were removed to obtain a final set of protein-coding regions for constructing the phylogenetic tree. Sequence data were initially aligned using ClustalX 1.83 [58] with default parameters. The mitogenome of C. coromandus was analyzed in this study, along with 14 other Cuculidae mitogenomes retrieved from NCBI GenBank (Table S1). The concatenated sequences of the 13 PCGs of complete mitochondrial genomes were used. The best-fit substitution models (GTR  +  G  +  I) of nucleotide sequences were tested using MEGA. We evaluated the confidence of each branch by performing 1000 bootstrap replications. Finally, the trimmed PCGs were concatenated to construct a phylogenetic tree using MEGA. We added the sampling points of species samples on the phylogenetic tree. With the exception of the sampling site for C. coromandus, all other sampling locations for 14 additional cuckoo species were obtained from previous studies [14,15,23,24,59,60]. We download 1000 alternative phylogenetic trees of cuckoos from birdtree.org [61] and constructed a maximum clade credibility tree, which is adequate for addressing phylogenetic uncertainty [62]. The parasitic behavior state of ancestral nodes is considered the response variable, while the parasitic behavior of extant cuckoo species (i.e., non-brood parasitic cuckoos or brood parasitic cuckoos) is considered the independent variable (n = 142 species). We reconstructed ancestral states of brood-parasitism’s presence using the “ace” Function in R package, and our model choice was “ER” (equal-rates model), with the type being discrete character [63]. All 142 species of cuckoos included in the analysis are present in previous studies [3,4,6,41,64]. All analyses were carried out in R 4.3.3 [65] using the R package phytools [66].

5. Conclusions

This study represents the first comprehensive report and analysis of the complete mitochondrial genome of C. coromandus. The mitogenome structure of C. coromandus is typical for birds and shows high similarity to other reported Cuculidae mitogenomes. Our results revealed a significant difference in AT-skews between interspecific brood parasitism and parental care. Notably, a long continuous poly-C sequence was discovered at the 5′ end of the displacement loop (D-loop) region. Additionally, one type of tandem repeat unit was identified in the CCR. Phylogenetic analyses indicate a closer relationship between C. coromandus and P. cayana compared to C. coromandus and C. aereus. While interspecific brood parasitism and parental care are generally separated, transitions between these behaviors occur occasionally within the evolutionary tree. This suggests that both traits have evolved multiple times across different evolutionary lineages. Consequently, our findings provide a valuable resource for future studies on the mitochondrial genomic evolution of the Cuculidae family. However, many aspects of Cuculidae phylogeny remain unresolved. Further analysis using additional molecular markers, such as nuclear genes or the genome, and larger taxon sampling is necessary to clarify the phylogenetic relationships among species within this family.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms26030869/s1.

Author Contributions

Y.Z.: conceptualization, data curation, formal analysis, methodology, writing—original draft; H.G.: data curation, formal analysis, methodology, writing—original draft; F.Z.: formal analysis, methodology, writing—review and editing; C.X.: data curation, formal analysis, methodology; G.L.: data curation, formal analysis, methodology, writing—original draft; S.L.: conceptualization, data curation, formal analysis, funding acquisition, methodology, writing—review and editing. All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported by the National Natural Sciences Foundation of China (grant number 32170481 and 32211530420).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The complete mitogenome of C. coromandus was deposited in GenBank under the accession number OM687253. Raw sequence data are deposited in the NCBI Sequence Read Archive under accession number SRR18063420.

Acknowledgments

We are grateful to Ji Huang, Jinlong Liu, and Jinlan Qin for their assistances in this work. We also appreciate the constructive suggestions from Wei Chen and Letian Xu.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Billerman, S.M.; Keeney, B.K.; Rodewald, P.G.; Schulenberg, T.S. Birds of the World; Cornell Laboratory of Ornithology: Ithaca, NY, USA, 2022; Database. [Google Scholar]
  2. Wang, N.; Shan, C.; Chen, D.; Hu, Y.; Sun, Y.; Wang, Y.; Liang, B.; Liang, W. “Isolation by Gentes with Asymmetric Migration” shapes the genetic structure of the common cuckoo in China. Integr. Zool. 2025, 20, 144–159. [Google Scholar] [CrossRef] [PubMed]
  3. Hasegawa, M.; Arai, E. Differential visual ornamentation between brood parasitic and parental cuckoos. J. Evol. Biol. 2018, 31, 446–456. [Google Scholar] [CrossRef] [PubMed]
  4. Erritzøe, J.; Mann, C.F.; Brammer, F.; Fuller, R.A. Cuckoos of the World; Christopher Helm: London, UK, 2012. [Google Scholar]
  5. del Hoyo, J.; Elliott, A.; Christie, D. Handbook of the Birds of the World, Vol. 10: Cuckoo-Shrikes to Thrushes; Dickinson, E.C., Dekker, R., Eds.; Lynx Edicions: Barcelona, Spain, 2005. [Google Scholar]
  6. Yang, C.; Liang, W.; Antonov, A.; Cai, Y.; Stokke, B.G.; Fossøy, F.; Moksnes, A.; Røskaft, E. Diversity of parasitic cuckoos and their hosts in China. Chin. Birds 2012, 3, 9–32. [Google Scholar] [CrossRef]
  7. Zheng, G.M. A Checklist on the Classification and Distribution of the Birds of China; Science Press: Beijing, China, 2023. [Google Scholar]
  8. Wu, J.; Shi, Y. Attribution index for changes in migratory bird distributions: The role of climate change over the past 50 years in China. Ecol. Inform. 2016, 31, 147–155. [Google Scholar] [CrossRef]
  9. Lee, Y.S.; Cheong, E.; Park, J.Y.; Hur, W.-H.; Choi, Y.-S.; Nam, H.-K.; Kim, D.-W. Complete mitochondrial genome of Asian koel Eudynamys scolopaceus (Aves: Cuculiformes) from South Korea. Mitochondrial DNA Part B 2022, 7, 1893–1895. [Google Scholar] [CrossRef]
  10. Tang, Y.; Manfredi, G.; Hirano, M.; Schon, E.A. Maintenance of human rearranged mitochondrial DNAs in long-term cultured transmitochondrial cell lines. Mol. Biol. Cell 2000, 11, 2349–2358. [Google Scholar] [CrossRef]
  11. Umeda, S.; Tang, Y.; Okamoto, M.; Hamasaki, N.; Schon, E.A.; Kang, D. Both heavy strand replication origins are active in partially duplicated human mitochondrial DNAs. Biochem. Biophys. Res. Commun. 2001, 286, 681–687. [Google Scholar] [CrossRef]
  12. Kang, H.; Li, B.; Ma, X.; Xu, Y. Evolutionary progression of mitochondrial gene rearrangements and phylogenetic relationships in Strigidae (Strigiformes). Gene 2018, 674, 8–14. [Google Scholar] [CrossRef]
  13. Eberhard, J.R.; Wright, T.F. Rearrangement and evolution of mitochondrial genomes in parrots. Mol. Phylogenet. Evol. 2015, 94, 34–46. [Google Scholar] [CrossRef]
  14. Wang, N.; Liang, B.; Huo, J.; Liang, W. Complete mitochondrial genome and the phylogenetic position of the Lesser Cuckoo, Cuculus poliocephalus (Aves: Cuculiformes). Mitochondrial DNA Part A 2015, 27, 4409–4410. [Google Scholar] [CrossRef]
  15. Qiu, S.; Liu, H.; Cai, Y.-S.; Hou, W.; Dou, L.; Zhang, X.-Y.; Li, J. Complete mitochondrial genome and the phylogenetic position of the common cuckoo, Cuculus canorus bakeri (Aves: Cuculiformes). Mitochondrial DNA Part B 2019, 4, 2802–2803. [Google Scholar] [CrossRef]
  16. Mindell, D.P.; Sorenson, M.D.; Dimcheff, D.E. Multiple independent origins of mitochondrial gene order in birds. Proc. Natl. Acad. Sci. USA 1998, 95, 10693–10697. [Google Scholar] [CrossRef] [PubMed]
  17. Eberhard, J.R.; Wright, T.F.; Bermingham, E. Duplication and concerted evolution of the mitochondrial control region in the parrot genus Amazona. Mol. Biol. Evol. 2001, 18, 1330–1342. [Google Scholar] [CrossRef] [PubMed]
  18. Abbott, C.L.; Double, M.C.; Trueman, J.W.; Robinson, A.; Cockburn, A. An unusual source of apparent mitochondrial heteroplasmy: Duplicate mitochondrial control regions in Thalassarche albatrosses. Mol. Ecol. 2005, 14, 3605–3613. [Google Scholar] [CrossRef] [PubMed]
  19. Skujina, I.; McMahon, R.; Lenis, V.P.E.; Gkoutos, G.V.; Hegarty, M. Duplication of the mitochondrial control region is associated with increased longevity in birds. Aging 2016, 8, 1781–1789. [Google Scholar] [CrossRef]
  20. Barker, F.K.; Benesh, M.K.; Vandergon, A.J.; Lanyon, S.M. Contrasting evolutionary dynamics and information content of the avian mitochondrial control region and ND2 gene. PLoS ONE 2012, 7, e46403. [Google Scholar] [CrossRef]
  21. Gibb, G.C.; Kardailsky, O.; Kimball, R.T.; Braun, E.L.; Penny, D. Mitochondrial genomes and avian phylogeny: Complex characters and resolvability without explosive radiations. Mol. Biol. Evol. 2007, 24, 269–280. [Google Scholar] [CrossRef]
  22. Hassanin, A.; Léger, N.; Deutsch, J. Evidence for multiple reversals of asymmetric mutational constraints during the evolution of the mitochondrial genome of Metazoa, and consequences for phylogenetic inferences. Syst. Biol. 2005, 54, 277–298. [Google Scholar] [CrossRef]
  23. Wang, G.; Tang, C.; Li, J.; Huang, Q.; Nong, J.; Wei, L.; Zhou, Q. Complete mitogenome of the Common Koel Eudynamys scolopaceus Linnaeus 1758 (Aves: Cuculidae). Mitochondrial DNA Part B 2022, 7, 831–833. [Google Scholar] [CrossRef]
  24. Tian, Y.; Xu, J.; Dou, L.; Zheng, A.; Qiao, L.; Xie, J.; Zhang, X. The complete mitochondrial genome of Indian Cuckoo Cuculus micropterus (Aves: Cuculiformes). Mitochondrial DNA Part B 2021, 6, 2556–2558. [Google Scholar] [CrossRef]
  25. Curole, J.P.; Kocher, T.D. Mitogenomics: Digging deeper with complete mitochondrial genomes. Trends Ecol. Evol. 1999, 14, 394–398. [Google Scholar] [CrossRef] [PubMed]
  26. Ojala, D.; Montoya, J.; Attardi, G. tRNA punctuation model of RNA processing in human mitochondria. Nature 1981, 290, 470–474. [Google Scholar] [CrossRef]
  27. Parvathy, S.T.; Udayasuriyan, V.; Bhadana, V. Codon usage bias. Mol. Biol. Rep. 2022, 49, 539–565. [Google Scholar] [CrossRef] [PubMed]
  28. Zhang, J.-F.; Nie, L.-W.; Wang, Y.; Hu, L.-L. The complete mitochondrial genome of the large-headed frog, Limnonectes bannaensis (Amphibia: Anura), and a novel gene organization in the vertebrate mtDNA. Gene 2009, 442, 119–127. [Google Scholar] [CrossRef]
  29. Wolstenholme, D.R. Animal Mitochondrial DNA: Structure and evolution. Int. Rev. Cytol. 1992, 141, 173–216. [Google Scholar] [PubMed]
  30. Pereira, S.L. Mitochondrial genome organization and vertebrate phylogenetics. Genet. Mol. Biol. 2000, 23, 745–752. [Google Scholar] [CrossRef]
  31. Steinberg, S.; Cedergren, R. Structural compensation in atypical mitochondrial tRNAs. Nat. Struct. Mol. Biol. 1994, 1, 507–510. [Google Scholar] [CrossRef]
  32. Lavrov, D.V.; Brown, W.M.; Boore, J.L. A novel type of RNA editing occurs in the mitochondrial tRNAs of the centipede Lithobius forficatus. Proc. Natl. Acad. Sci. USA 2000, 97, 13738–13742. [Google Scholar] [CrossRef]
  33. Gutell, R.R.; Lee, J.C.; Cannone, J.J. The accuracy of ribosomal RNA comparative structure models. Curr. Opin. Struct. Biol. 2002, 12, 301–310. [Google Scholar] [CrossRef]
  34. Boore, J.L. Animal mitochondrial genomes. Nucleic Acids Res. 1999, 27, 1767–1780. [Google Scholar] [CrossRef]
  35. Ruokonen, M.; Kvist, L. Structure and evolution of the avian mitochondrial control region. Mol. Phylogenetics Evol. 2002, 23, 422–432. [Google Scholar] [CrossRef] [PubMed]
  36. Baker, A.J.; Marshall, H.D. Mitochondrial control region sequences as tools for understanding evolution. Avian Mol. Evol. S. 1997, 51–82. [Google Scholar] [CrossRef]
  37. Saccone, C.; Pesole, G.; Sbisá, E. The main regulatory region of mammalian mitochondrial DNA: Structure-function model and evolutionary pattern. J. Mol. Evol. 1991, 33, 83–91. [Google Scholar] [CrossRef] [PubMed]
  38. Kim, K.S.; Lee, S.E.; Jeong, H.W.; Ha, J.H. The complete nucleotide sequence of the domestic dog (Canis familiaris) mitochondrial genome. Mol. Phylogenetics Evol. 1998, 10, 210–220. [Google Scholar] [CrossRef]
  39. Zhang, H.; Dou, H.; Yang, X.; Zhao, C.; Liu, G.; Zhang, J. The complete mitochondrial genome sequence of the Sparrowhawk (Accipiter nisus). Mitochondrial DNA Part A 2014, 27, 1648–1649. [Google Scholar] [CrossRef]
  40. Payne, R.B. Bird Families of the World: Cuckoos; Oxford University Press: Oxford, UK, 2005. [Google Scholar]
  41. Morelli, F.; Benedetti, Y.; Møller, A.P.; Liang, W.; Carrascal, L.M. Cuckoos host range is associated positively with distribution range and negatively with evolutionary uniqueness. J. Anim. Ecol. 2018, 87, 765–773. [Google Scholar] [CrossRef]
  42. Rubinstein, N.D.; Feldstein, T.; Shenkar, N.; Botero-Castro, F.; Griggio, F.; Mastrototaro, F.; Delsuc, F.; Douzery, E.J.P.; Gissi, C.; Huchon, D. Deep sequencing of mixed total DNA without barcodes allows efficient assembly of highly plastic ascidian mitochondrial genomes. Genome Eiol. Evol. 2013, 5, 1185–1199. [Google Scholar] [CrossRef]
  43. Sokolov, L.V.; Lubkovskaia, R.S.; Bulyuk, V.N. Migration Routes and Wintering Grounds of Common Cuckoos (Cuculus canorus, Cuculiformes, Cuculidae) from the Southeastern Part of the Baltic Region (Based on Satellite Telemetry). Biol. Bull. 2022, 49, 889–898. [Google Scholar] [CrossRef]
  44. Willemoes, M.; Strandberg, R.; Klaassen, R.H.G.; Tøttrup, A.P.; Vardanis, Y.; Howey, P.W.; Thorup, K.; Wikelski, M.; Alerstam, T. Narrow-front loop migration in a population of the common cuckoo Cuculus canorus, as revealed by satellite telemetry. PLoS ONE 2014, 9, e83515. [Google Scholar] [CrossRef]
  45. Darwin, C. On the Origins of Species by Means of Natural Selection; Murray: London, UK, 1859; Volume 247. [Google Scholar]
  46. Payne, R.B.; Kirwan, G.M. Chestnut-winged Cuckoo (Clamator coromandus), Version 1.0. In Birds of the World; del Hoyo, J., Elliott, A., Sargatal, J., Christie, D.A., de Juana, E., Eds.; Cornell Lab of Ornithology: Ithaca, NY, USA, 2020. [Google Scholar] [CrossRef]
  47. Li, S.; Shi, R.; Li, W.; Li, G. Grazing pressure affects offspring sex ratio in a socially monogamous passerine on the Tibet Plateau. J. Avian Biol. 2018, 49, jav-01660. [Google Scholar] [CrossRef]
  48. Burland, T.G. DNASTAR’s Lasergene sequence analysis software. Bioinform. Methods Protoc. 1999, 132, 71–91. [Google Scholar]
  49. Lowe, T.M.; Eddy, S.R. tRNAscan-SE: A program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acids Res. 1997, 25, 955–964. [Google Scholar] [CrossRef] [PubMed]
  50. Kumazawa, Y.; Nishida, M. Sequence evolution of mitochondrial tRNA genes and deep-branch animal phylogenetics. J. Mol. Evol. 1993, 37, 380–398. [Google Scholar] [CrossRef] [PubMed]
  51. Stothard, P.; Wishart, D.S. Circular genome visualization and exploration using CGView. Bioinformatics 2005, 21, 537–539. [Google Scholar] [CrossRef]
  52. Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef]
  53. Perna, N.T.; Kocher, T.D. Patterns of nucleotide composition at fourfold degenerate sites of animal mitochondrial genomes. J. Mol. Evol. 1995, 41, 353–358. [Google Scholar] [CrossRef]
  54. Marshall, H.D.; Baker, A.J. Structural conservation and variation in the mitochondrial control region of fringilline finches (Fringilla spp.) and the greenfinch (Carduelis chloris). Mol. Biol. Evol. 1997, 14, 173–184. [Google Scholar] [CrossRef]
  55. Randi, E.; Lucchini, V. Organization and evolution of the mitochondrial DNA control region in the avian genus Alectoris. J. Mol. Evol. 1998, 47, 449–462. [Google Scholar] [CrossRef]
  56. Yang, R.; Wu, X.; Yan, P.; Su, X.; Yang, B. Complete mitochondrial genome of Otis tarda (Gruiformes: Otididae) and phylogeny of Gruiformes inferred from mitochondrial DNA sequences. Mol. Biol. Rep. 2009, 37, 3057–3066. [Google Scholar] [CrossRef]
  57. Zhang, D.; Gao, F.; Jakovlić, I.; Zhou, H.; Zhang, J.; Li, W.X.; Wang, G.T. PhyloSuite: An integrated and scalable desktop platform for streamlined molecular sequence data management and evolutionary phylogenetics studies. Mol. Ecol. Resour. 2019, 20, 348–355. [Google Scholar] [CrossRef]
  58. Thompson, J.D.; Gibson, T.J.; Plewniak, F.; Jeanmougin, F.; Higgins, D.G. The CLUSTAL_X windows interface: Flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 1997, 25, 4876–4882. [Google Scholar] [CrossRef] [PubMed]
  59. Qu, J.; Cong, J.; Guo, C.; Hou, J.; Zhen, J.; Shi, B. Complete mitochondrial genome of the greater Coucal, Centropus sinensis (Aves: Cuculiformes). Mitochondrial DNA Part A 2015, 28, 311–312. [Google Scholar] [CrossRef]
  60. Langmore, N.E.; Grealy, A.; Noh, H.-J.; Medina, I.; Skeels, A.; Grant, J.; Murray, K.D.; Kilner, R.M.; Holleley, C.E. Coevolution with hosts underpins speciation in brood-parasitic cuckoos. Science 2024, 384, 1030–1036. [Google Scholar] [CrossRef] [PubMed]
  61. Jetz, W.; Thomas, G.H.; Joy, J.B.; Hartmann, K.; Mooers, A.O. The global diversity of birds in space and time. Nature 2012, 491, 444–448. [Google Scholar] [CrossRef]
  62. Rubolini, D.; Liker, A.; Garamszegi, L.Z.; Møller, A.P.; Saino, N. Using the BirdTree.org website to obtain robust phylogenies for avian comparative studies: A primer. Curr. Zool. 2015, 61, 959–965. [Google Scholar] [CrossRef]
  63. Zimin, A.; Zimin, S.V.; Grismer, L.L.; Bauer, A.M.; Chapple, D.G.; Dembitzer, J.; Roll, U.; Meiri, S. Microhabitat and adhesive toepads shape gecko limb morphology. Integr. Zool. 2024, 1–17. [Google Scholar] [CrossRef] [PubMed]
  64. Krüger, O.; Davies, N.B. The evolution of cuckoo parasitism: A comparative analysis. Proc. R. Soc. B Biol. Sci. 2002, 269, 375–381. [Google Scholar] [CrossRef]
  65. R Core Team. R Version 4.3.3 (Angel Food Cake); R Foundation for Statistical Computing: Vienna, Austria, 2024; Available online: https://www.R-project.org/ (accessed on 17 January 2025).
  66. Revell, L.J. Phytools: An R package for phylogenetic comparative biology (and other things). Methods Ecol. Evol. 2011, 3, 217–223. [Google Scholar] [CrossRef]
Ijms 26 00869 g001
Figure 1. Complete mitochondrial genome organization and gene arrangement of Clamator coromandus. Genes coded on the H-strand are indicated in the outer ring, while the genes coded on the L-strand are indicated in the inner ring. Genes are abbreviated as follows: ATP6 and ATP8 (subunits 6 and 8 of ATPase), COXI − COXIII (cytochrome c oxidase subunits 1−3), Cytb (cytochrome b), and ND1 − ND6 and ND4L (NADH dehydrogenase subunits 1−6 and 4L). Ribosomal RNA of 12S and 16S, D-loop (control region), Trn, and one-letter amino acid abbreviations were used to label the corresponding tRNA genes.
Figure 1. Complete mitochondrial genome organization and gene arrangement of Clamator coromandus. Genes coded on the H-strand are indicated in the outer ring, while the genes coded on the L-strand are indicated in the inner ring. Genes are abbreviated as follows: ATP6 and ATP8 (subunits 6 and 8 of ATPase), COXI − COXIII (cytochrome c oxidase subunits 1−3), Cytb (cytochrome b), and ND1 − ND6 and ND4L (NADH dehydrogenase subunits 1−6 and 4L). Ribosomal RNA of 12S and 16S, D-loop (control region), Trn, and one-letter amino acid abbreviations were used to label the corresponding tRNA genes.
Ijms 26 00869 g001
Ijms 26 00869 g002
Figure 2. Relative Synonymous Codon Usage (RSCU) in the mitogenome of C. coromandus. The box below the bar indicates all codons encoding each amino acid, and the height of the above column indicates the sum of all RSCU values.
Figure 2. Relative Synonymous Codon Usage (RSCU) in the mitogenome of C. coromandus. The box below the bar indicates all codons encoding each amino acid, and the height of the above column indicates the sum of all RSCU values.
Ijms 26 00869 g002
Ijms 26 00869 g003
Figure 3. Nucleotide sequence forecast of the mitochondrial CR and CCR of C. coromandus. Several conserved motifs were identified along this fragment: putative ETAS elements (underlined), boxes (F, E, D, C), Bird similarity-box, blocks (CSB1), and repeated sequences (CAAACAA). Palindromic motifs (TACAT, ATGTA) are also represented in the figure. All complete repeating units are underlined for emphasis and easy identification.
Figure 3. Nucleotide sequence forecast of the mitochondrial CR and CCR of C. coromandus. Several conserved motifs were identified along this fragment: putative ETAS elements (underlined), boxes (F, E, D, C), Bird similarity-box, blocks (CSB1), and repeated sequences (CAAACAA). Palindromic motifs (TACAT, ATGTA) are also represented in the figure. All complete repeating units are underlined for emphasis and easy identification.
Ijms 26 00869 g003
Ijms 26 00869 g004
Figure 4. (a) Structure of CR and CCR in C. coromandus. Positions of the conserved motifs in CR and division into the three domains D I, D II, and D III are shown. (b) Structure of CCR in Eudynamys scolopaceus, Chrysococcyx minutillus, Chrysococcyx russatus, and Cuculus poliocephalus. nr-CCRs are depicted as gray bars. Regions containing incomplete units are depicted as hatched bars. nr-CCR, nonrepetitive region in CCR; r-CCR, repetitive region in CCR.
Figure 4. (a) Structure of CR and CCR in C. coromandus. Positions of the conserved motifs in CR and division into the three domains D I, D II, and D III are shown. (b) Structure of CCR in Eudynamys scolopaceus, Chrysococcyx minutillus, Chrysococcyx russatus, and Cuculus poliocephalus. nr-CCRs are depicted as gray bars. Regions containing incomplete units are depicted as hatched bars. nr-CCR, nonrepetitive region in CCR; r-CCR, repetitive region in CCR.
Ijms 26 00869 g004
Ijms 26 00869 g005
Figure 5. Results of phylogenetic analyses based on maximum likelihood (ML) analyses for 15 Cuculidae taxa based on 13 PCG sequences. Clangula hyemalis (MWO77850) was used as an outgroup. The ultrafast bootstrap values are shown at the nodes. ⊙ represents interspecific brood parasitism, ◯ represents parental care. SC: Sichuan Province of China; GZ: Guizhou Province of China; AUS: Australia; NZ: New Zealand; GX: Guangxi Province of China; GH: Ghana; HB: Hubei Province of China; GUY: Guyana; PH: Philippines; HN: Hainan Province of China; PAN: Panama; USA: United States of America.
Figure 5. Results of phylogenetic analyses based on maximum likelihood (ML) analyses for 15 Cuculidae taxa based on 13 PCG sequences. Clangula hyemalis (MWO77850) was used as an outgroup. The ultrafast bootstrap values are shown at the nodes. ⊙ represents interspecific brood parasitism, ◯ represents parental care. SC: Sichuan Province of China; GZ: Guizhou Province of China; AUS: Australia; NZ: New Zealand; GX: Guangxi Province of China; GH: Ghana; HB: Hubei Province of China; GUY: Guyana; PH: Philippines; HN: Hainan Province of China; PAN: Panama; USA: United States of America.
Ijms 26 00869 g005
Ijms 26 00869 g006
Figure 6. Nucleotide sequence identity alignment of 13 PCGs in 15 species of Cuculidae. The numbers in the 1st ranks and rows of this figure represent the species numbers in Table 1.
Figure 6. Nucleotide sequence identity alignment of 13 PCGs in 15 species of Cuculidae. The numbers in the 1st ranks and rows of this figure represent the species numbers in Table 1.
Ijms 26 00869 g006
Ijms 26 00869 g007
Figure 7. Ancestral trait reconstruction of Cuculidae: 0 represents parental care, while 1 signifies brood parasitism. Myiarchus swainsoni and Cursorius temminckii were utilized as outgroups.
Figure 7. Ancestral trait reconstruction of Cuculidae: 0 represents parental care, while 1 signifies brood parasitism. Myiarchus swainsoni and Cursorius temminckii were utilized as outgroups.
Ijms 26 00869 g007
Ijms 26 00869 g008
Figure 8. Sampling location map of the chestnut-winged cuckoo, C. coromandus (red triangle represents the sampling point near the east gate of the ancient city, Jingzhou County, Hubei Province of China).
Figure 8. Sampling location map of the chestnut-winged cuckoo, C. coromandus (red triangle represents the sampling point near the east gate of the ancient city, Jingzhou County, Hubei Province of China).
Ijms 26 00869 g008
Table 1. Mitogenomes of Cuculidae with accession numbers used in this study.
Table 1. Mitogenomes of Cuculidae with accession numbers used in this study.
Species NumberScientific NameGenBank NumberReproductive Strategy
1Clamator coromandusOM687253interspecific brood parasitism
2Eudynamys scolopaceusOM115963interspecific brood parasitism
3Chrysococcyx minutillusOQ363454interspecific brood parasitism
4Chrysococcyx russatusOQ363419interspecific brood parasitism
5Ceuthmochares aereusNC052776parental care
6Cuculus poliocephalusNC028414interspecific brood parasitism
7Eudynamys taitensisNC011709interspecific brood parasitism
8Cuculus micropterusMZ048030interspecific brood parasitism
9Cuculus canorusMN067867interspecific brood parasitism
10Piaya cayanaMN356301parental care
11Crotophaga sulcirostris *MN356290parental care
12Geococcyx californianusEU410488parental care
13Centropus bengalensisMN356332parental care
14Centropus sinensisKT947122parental care
15Centropus unirufusNC052811parental care
*: multiple females lay in a joint nest.
Table 2. Characteristics of the mitochondrial genome of C. coromandus.
Table 2. Characteristics of the mitochondrial genome of C. coromandus.
GenePositionSizesCodonIntergenic Nucleotide bStrand cA + T%
FromToNucleotide (bp)StartStop a
tRNA-Phe17070 H45.7
12S rRNA701044975 −1H53.1
tRNA-Val1044111572 −1H58.3
16S rRNA111527101596 −1H56.5
tRNA-Leu2710278374 −1H48.7
ND127953772978ATGAGA11H54.8
tRNA-Ile3788385871 15H57.8
tRNA-Gln3871394171 12L67.6
tRNA-Met3941400969 −1H53.6
ND2401050501041ATGTAG0H57.5
tRNA-Trp5049511870 −2H62.9
tRNA-Ala5120518869 1L56.5
tRNA-Asn5192526473 3L46.6
tRNA-Cys5269533365 4L56.9
tRNA-Tyr5334540370 0L52.9
COXⅠ540569551551ATGAGG1H52.9
tRNA-Ser6947702074 −9L54.1
tRNA-Asp7023709169 2H59.4
COXⅡ70937776684ATGTAA1H53.1
tRNA-Lys7781784868 4H60.3
ATP878508017168ATGTAA1H58.9
ATP680088691684ATGTAA−10H54.8
COXⅢ86919474784ATGT-−1H54.2
tRNA-Gly9475954369 0H62.3
ND395449895352ATTTAA0H56.0
tRNA-Arg9900996869 4H65.2
ND4L997010,266297ATGTAA1H53.2
ND410,26011,6371378ATGT-−7H55.5
tRNA-His11,63811,70770 0H65.7
tRNA-Ser11,70811,77366 0H51.5
tRNA-Leu11,77311,84371 −1H59.2
ND511,84413,6521809ATGAGA0H56.7
Cytb13,66114,8031143ATGTAA8H55.0
tRNA-Thr14,80714,87670 3H62.9
Control region14,87716,0191143 0H59.8
tRNA-Pro16,02016,08970 0L64.3
ND616,10116,622522CTAT-11L54.0
tRNA-Glu16,62716,69872 4L56.9
Pseudo-control region16,69917,082384 0H67.5
a T—represents incomplete stop codons. b Intergenic bp indicates gap nucleotides (positive value) or overlapped nucleotides (negative value) between two adjacent genes. c H and L indicate genes transcribed on the heavy and light strands, respectively.
Table 3. Results of non-parametric Mann–Whitney test analysis of AT/GC-skews in 13 PCGs and overall.
Table 3. Results of non-parametric Mann–Whitney test analysis of AT/GC-skews in 13 PCGs and overall.
M (QL, QU)ZP
13PCGsAT-skewsinterspecific brood parasitism0.100 (0.090~0.123)−2.6390.008
parental care0.070 (0.050~0.080)
GC-skewsinterspecific brood parasitism−0.405 (−0.425~−0.400)−0.9450.344
parental care−0.400 (−0.420~−0.370)
overallAT-skewsinterspecific brood parasitism0.160 (0.150~0.175)−2.5980.009
parental care0.140 (0.110~0.140)
GC-skewsinterspecific brood parasitism−0.400 (−0.410~−0.393)−1.4130.158
parental care−0.390 (−0.410~−0.370)
Note: M stands for median, QL stands for lower quartile, and QU stands for upper quartile.
Table 4. Codon usage in the mitochondrial protein-coding genes of C. coromandus.
Table 4. Codon usage in the mitochondrial protein-coding genes of C. coromandus.
CodonCountRSCU%CodonCountRSCU%CodonCountRSCU%CodonCountRSCU%
UUU (F)34.00.360.92UCU (S)36.00.680.97UAU (Y)44.00.581.19UGU (C)5.00.380.14
UUC (F)155.01.644.19UCC (S)116.02.203.14UAC (Y)107.01.422.90UGC (C)21.01.620.57
UUA (L)55.00.621.49UCA (S)110.02.092.98UAA (*)56.00.991.52UGA (W)81.01.442.19
UUG (L)9.00.100.24UCG (S)13.00.250.35UAG (*)32.00.570.87UGG (W)11.01.000.30
CUU (L)53.00.601.43CCU (P)30.00.410.81CAU (H)52.00.671.41CGU (R)7.00.510.19
CUC (L)114.01.283.08CCC (P)98.01.352.65CAC (H)103.01.332.79CGC (R)28.02.020.76
CUA (L)270.03.037.31CCA (P)145.01.993.92CAA (Q)119.01.723.22CGA (R)33.02.390.89
CUG (L)33.00.370.89CCG (P)18.00.250.49CAG (Q)19.00.280.51CGG (R)2.00.140.05
AUU (I)72.00.551.95ACU (T)54.00.641.46AAU (N)29.00.350.78AGU (S)11.00.210.30
AUC (I)199.01.525.38ACC (T)128.01.513.46AAC (N)135.01.653.65AGC (S)30.00.570.81
AUA (M)122.00.933.30ACA (T)146.01.723.95AAA (K)99.01.782.68AGA (*)10.00.720.27
AUG (M)24.01.000.65ACG (T)11.00.130.30AAG (K)12.00.220.32AGG (*)3.00.220.08
GUU (V)12.00.390.32GCU (A)46.00.731.24GAU (D)19.00.570.51GGU (G)15.00.360.41
GUC (V)43.01.401.16GCC (A)129.02.043.49GAC (D)48.01.431.30GGC (G)47.01.141.27
GUA (V)61.01.981.65GCA (A)73.01.151.98GAA (E)76.01.602.06GGA (G)96.02.332.60
GUG (V)7.00.230.19GCG (A)5.00.080.14GAG (E)19.00.400.51GGG (G)7.00.170.19
Note: The asterisk (*) represents the stop codon.
Table 5. Sequence characteristics of CCRs in 15 species of Cuculidae birds.
Table 5. Sequence characteristics of CCRs in 15 species of Cuculidae birds.
Scientific NameAccession NumberGenome Length (bp)CCR
TypesTandem RepeatsSingle Repeat Unit
C. coromandusOM68725317,082132.6 × (7)CAAACAA
E. scolopaceusOM11596317,61025.1 × (66)CACCACCACCCTCCCCGCTGAAATTACATTAACAAATTACATCATATCACCCATAATTTTATATTT
23.1 × (7)AAACAAC
C. minutillusOQ36345417,190112.8 × (12)AAAACAAACAAC
C. russatusOQ36341917,211112.8 × (12)AAAACAAACAAC
C. aereusNC05277617,187---
C. poliocephalusNC02841417,508133.4 × (7)CAACAAA
E. taitensisNC01170917,559116.9 × (7)AAACAAC
C. micropterusMZ04803017,541---
C. canorusMN06786717,457---
P. cayanaMN35630117,007---
C. sulcirostrisMN35629016,933---
G. californianusEU41048817,091131.7 × (7)CAAACAA
C. bengalensisMN35633217,107---
C. sinensisKT94712217,159---
C. unirufusNC05281117,089---
Note: The bars indicate that the species have no CCR. In a complete mitochondrion sequence, there are tandem repeat units outside of the CCR region, but this study (Table 5) only counted the tandem repeat units in the CCR segment. 32.6 × (7) = 32.6 repeats of 7 bp (a single repeat unit is 7 bp in length).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhang, Y.; Gao, H.; Zhang, F.; Xia, C.; Li, G.; Li, S. Phylogenetic Relationship and Characterization of the Complete Mitochondrial Genome of the Cuckoo Species Clamator coromandus (Aves: Cuculidae). Int. J. Mol. Sci. 2025, 26, 869. https://doi.org/10.3390/ijms26030869

AMA Style

Zhang Y, Gao H, Zhang F, Xia C, Li G, Li S. Phylogenetic Relationship and Characterization of the Complete Mitochondrial Genome of the Cuckoo Species Clamator coromandus (Aves: Cuculidae). International Journal of Molecular Sciences. 2025; 26(3):869. https://doi.org/10.3390/ijms26030869

Chicago/Turabian Style

Zhang, Yu, Hao Gao, Fan Zhang, Chengxing Xia, Guopan Li, and Shaobin Li. 2025. "Phylogenetic Relationship and Characterization of the Complete Mitochondrial Genome of the Cuckoo Species Clamator coromandus (Aves: Cuculidae)" International Journal of Molecular Sciences 26, no. 3: 869. https://doi.org/10.3390/ijms26030869

APA Style

Zhang, Y., Gao, H., Zhang, F., Xia, C., Li, G., & Li, S. (2025). Phylogenetic Relationship and Characterization of the Complete Mitochondrial Genome of the Cuckoo Species Clamator coromandus (Aves: Cuculidae). International Journal of Molecular Sciences, 26(3), 869. https://doi.org/10.3390/ijms26030869

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop