Exploring the Link Between Mucin 2 and Weaning Stress-Related Diarrhoea in Piglets
Abstract
1. Introduction
2. Results
2.1. Diarrhoea in Piglets Within One Week After Weaning
2.2. Intestinal Tissue Pathological Injury Scores
2.3. Comparison of the Numbers and Volumes of Goblet Cells in Piglet Intestines
2.4. Intestinal MUC2 mRNA Expression Levels
2.5. Intestinal MUC2 Protein Expression Levels
2.6. Intestinal MUC2 Expression Localisation
3. Discussion
4. Materials and Methods
4.1. Animal Feeding and Husbandry
4.2. Sample Collection
piglet)/(total number of test piglets × duration of the trial) × 100%
4.3. Histological Examination
4.3.1. Preparation of Paraffin Sections
4.3.2. Haematoxylin and Eosin (H&E) Staining
4.3.3. Periodic Acid–Schiff (PAS) Staining
4.3.4. Immunohistochemistry (IHC)
4.4. qRT–PCR
4.5. Western Blot
4.6. Data Processing
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Wensley, M.R.; Tokach, M.D.; Woodworth, J.C.; Goodband, R.D.; Gebhardt, J.T.; DeRouchey, J.M.; McKilligan, D. Maintaining continuity of nutrient intake after weaning. II. Review of post-weaning strategies. Transl. Anim. Sci. 2021, 5, txab022. [Google Scholar] [CrossRef] [PubMed]
- Van Kerschaver, C.; Turpin, D.; Michiels, J.; Pluske, J. Reducing Weaning Stress in Piglets by Pre-Weaning Socialization and Gradual Separation from the Sow: A Review. Animals 2023, 13, 1644. [Google Scholar] [CrossRef] [PubMed]
- Tang, X.; Xiong, K.; Fang, R.; Li, M. Weaning stress and intestinal health of piglets: A review. Front. Immunol. 2022, 13, 1042778. [Google Scholar] [CrossRef] [PubMed]
- Lallès, J.-P.; Bosi, P.; Smidt, H.; Stokes, C.R. Weaning—A challenge to gut physiologists. Livest. Sci. 2007, 108, 82–93. [Google Scholar] [CrossRef]
- Moeser, A.J.; Klok, C.V.; Ryan, K.A.; Wooten, J.G.; Little, D.; Cook, V.L.; Blikslager, A.T. Stress signaling pathways activated by weaning mediate intestinal dysfunction in the pig. Am. J. Physiol. Gastrointest. Liver Physiol. 2007, 292, G173–G181. [Google Scholar] [CrossRef]
- Sicard, J.F.; Le Bihan, G.; Vogeleer, P.; Jacques, M.; Harel, J. Interactions of Intestinal Bacteria with Components of the Intestinal Mucus. Front. Cell. Infect. Microbiol. 2017, 7, 387. [Google Scholar] [CrossRef]
- Etzold, S.; Juge, N. Structural insights into bacterial recognition of intestinal mucins. Curr. Opin. Struct. Biol. 2014, 28, 23–31. [Google Scholar] [CrossRef]
- Kesimer, M.; Kirkham, S.; Pickles, R.J.; Henderson, A.G.; Alexis, N.E.; Demaria, G.; Knight, D.; Thornton, D.J.; Sheehan, J.K. Tracheobronchial air-liquid interface cell culture: A model for innate mucosal defense of the upper airways? Am. J. Physiol. Lung Cell. Mol. Physiol. 2009, 296, L92–L100. [Google Scholar] [CrossRef]
- Ratan, C.; Cicily, K.D.D.; Nair, B.; Nath, L.R. MUC Glycoproteins: Potential Biomarkers and Molecular Targets for Cancer Therapy. Curr. Cancer Drug Targets 2021, 21, 132–152. [Google Scholar] [CrossRef]
- Liang, J.; Dai, W.; Liu, C.; Wen, Y.; Chen, C.; Xu, Y.; Huang, S.; Hou, S.; Li, C.; Chen, Y.; et al. Gingerenone A Attenuates Ulcerative Colitis via Targeting IL-17RA to Inhibit Inflammation and Restore Intestinal Barrier Function. Adv. Sci. 2024, 11, e2400206. [Google Scholar] [CrossRef]
- D’Antongiovanni, V.; Fornai, M.; Colucci, R.; Nericcio, A.; Benvenuti, L.; Di Salvo, C.; Segnani, C.; Pierucci, C.; Ippolito, C.; Nemeth, Z.H.; et al. Enteric glial NLRP3 inflammasome contributes to gut mucosal barrier alterations in a mouse model of diet-induced obesity. Acta Physiol. 2024, 241, e14232. [Google Scholar] [CrossRef] [PubMed]
- Pelaseyed, T.; Hansson, G.C. Membrane mucins of the intestine at a glance. J. Cell Sci. 2020, 133, jcs240929. [Google Scholar] [CrossRef] [PubMed]
- Johansson, M.E.; Hansson, G.C. Immunological aspects of intestinal mucus and mucins. Nat. Rev. Immunol. 2016, 16, 639–649. [Google Scholar] [CrossRef] [PubMed]
- Johansson, M.E.; Sjövall, H.; Hansson, G.C. The gastrointestinal mucus system in health and disease. Nat. Rev. Gastroenterol. Hepatol. 2013, 10, 352–361. [Google Scholar] [CrossRef]
- Boltin, D.; Perets, T.T.; Vilkin, A.; Niv, Y. Mucin function in inflammatory bowel disease: An update. J. Clin. Gastroenterol. 2013, 47, 106–111. [Google Scholar] [CrossRef]
- Liu, Y.; Yu, Z.; Zhu, L.; Ma, S.; Luo, Y.; Liang, H.; Liu, Q.; Chen, J.; Guli, S.; Chen, X. Orchestration of MUC2—The key regulatory target of gut barrier and homeostasis: A review. Int. J. Biol. Macromol. 2023, 236, 123862. [Google Scholar] [CrossRef]
- Liu, Y.; Yu, X.; Zhao, J.; Zhang, H.; Zhai, Q.; Chen, W. The role of MUC2 mucin in intestinal homeostasis and the impact of dietary components on MUC2 expression. Int. J. Biol. Macromol. 2020, 164, 884–891. [Google Scholar] [CrossRef]
- Andrianifahanana, M.; Moniaux, N.; Batra, S.K. Regulation of mucin expression: Mechanistic aspects and implications for cancer and inflammatory diseases. Biochim. Biophys. Acta 2006, 1765, 189–222. [Google Scholar] [CrossRef]
- Sutherland, M.A.; Rodriguez-Zas, S.L.; Ellis, M.; Salak-Johnson, J.L. Breed and age affect baseline immune traits, cortisol, and performance in growing pigs. J. Anim. Sci. 2005, 83, 2087–2095. [Google Scholar] [CrossRef]
- Winters, J.F.M.; Kobek-Kjeldager, C.; Foldager, L.; Tecles, F.; Pedersen, L.J. Stress responses in pigs postweaning: Effect of heavier hybrid and weaning intact litters. Appl. Anim. Behav. Sci. 2023, 269, 106106. [Google Scholar] [CrossRef]
- Farré, R.; Fiorani, M.; Abdu Rahiman, S.; Matteoli, G. Intestinal Permeability, Inflammation and the Role of Nutrients. Nutrients 2020, 12, 1185. [Google Scholar] [CrossRef] [PubMed]
- Aleman, R.S.; Moncada, M.; Aryana, K.J. Leaky Gut and the Ingredients That Help Treat It: A Review. Molecules 2023, 28, 619. [Google Scholar] [CrossRef] [PubMed]
- McCracken, B.A.; Spurlock, M.E.; Roos, M.A.; Zuckermann, F.A.; Gaskins, H.R. Weaning anorexia may contribute to local inflammation in the piglet small intestine. J. Nutr. 1999, 129, 613–619. [Google Scholar] [CrossRef] [PubMed]
- Boudry, G.; Péron, V.; Le Huërou-Luron, I.; Lallès, J.P.; Sève, B. Weaning induces both transient and long-lasting modifications of absorptive, secretory, and barrier properties of piglet intestine. J. Nutr. 2004, 134, 2256–2262. [Google Scholar] [CrossRef]
- Han, X.; Hu, X.; Jin, W.; Liu, G. Dietary nutrition, intestinal microbiota dysbiosis and post-weaning diarrhea in piglets. Anim. Nutr. 2024, 17, 188–207. [Google Scholar] [CrossRef]
- Zhu, L.H.; Zhao, K.L.; Chen, X.L.; Xu, J.X. Impact of weaning and an antioxidant blend on intestinal barrier function and antioxidant status in pigs. J. Anim. Sci. 2012, 90, 2581–2589. [Google Scholar] [CrossRef]
- Wu, J.; Wang, J.; Lin, Z.; Liu, C.; Zhang, Y.; Zhang, S.; Zhou, M.; Zhao, J.; Liu, H.; Ma, X. Clostridium butyricum alleviates weaned stress of piglets by improving intestinal immune function and gut microbiota. Food Chem. 2023, 405, 135014. [Google Scholar] [CrossRef]
- Huangfu, W.; Ma, J.; Zhang, Y.; Liu, M.; Liu, B.; Zhao, J.; Wang, Z.; Shi, Y. Dietary Fiber-Derived Butyrate Alleviates Piglet Weaning Stress by Modulating the TLR4/MyD88/NF-κB Pathway. Nutrients 2024, 16, 1714. [Google Scholar] [CrossRef]
- Tonetti, F.R.; Eguileor, A.; Llorente, C. Goblet cells: Guardians of gut immunity and their role in gastrointestinal diseases. Egastroenterology 2024, 2, e100098. [Google Scholar] [CrossRef]
- Jeurissen, S.H.; Lewis, F.; van der Klis, J.D.; Mroz, Z.; Rebel, J.M.; ter Huurne, A.A. Parameters and techniques to determine intestinal health of poultry as constituted by immunity, integrity, and functionality. Curr. Issues Intest. Microbiol. 2002, 3, 1–14. [Google Scholar]
- Ostaszewska, T.; Dabrowski, K.; Palacios, M.E.; Olejniczak, M.; Wieczorek, M. Growth and morphological changes in the digestive tract of rainbow trout (Oncorhynchus mykiss) and pacu (Piaractus mesopotamicus) due to casein replacement with soybean proteins. Aquaculture 2005, 245, 273–286. [Google Scholar] [CrossRef]
- Birchenough, G.M.; Johansson, M.E.; Gustafsson, J.K.; Bergström, J.H.; Hansson, G.C. New developments in goblet cell mucus secretion and function. Mucosal Immunol. 2015, 8, 712–719. [Google Scholar] [CrossRef] [PubMed]
- Piel, C.; Montagne, L.; Sève, B.; Lallès, J.P. Increasing digesta viscosity using carboxymethylcellulose in weaned piglets stimulates ileal goblet cell numbers and maturation. J. Nutr. 2005, 135, 86–91. [Google Scholar] [CrossRef] [PubMed]
- Heazlewood, C.K.; Cook, M.C.; Eri, R.; Price, G.R.; Tauro, S.B.; Taupin, D.; Thornton, D.J.; Png, C.W.; Crockford, T.L.; Cornall, R.J.; et al. Aberrant mucin assembly in mice causes endoplasmic reticulum stress and spontaneous inflammation resembling ulcerative colitis. PLoS Med. 2008, 5, e54. [Google Scholar] [CrossRef]
- Dietrich, O. Integrating Single-Cell Multi-Omics to Decipher Host-Pathogen Interactions; Bayerische Julius-Maximilians-Universitaet Wuerzburg: Würzburg, Germany, 2024. [Google Scholar]
- Martin, N.A.; Mount Patrick, S.K.; Estrada, T.E.; Frisk, H.A.; Rogan, D.T.; Dvorak, B.; Halpern, M.D. Active transport of bile acids decreases mucin 2 in neonatal ileum: Implications for development of necrotizing enterocolitis. PLoS ONE 2011, 6, e27191. [Google Scholar] [CrossRef]
- Cebra, J.J. Influences of microbiota on intestinal immune system development. Am. J. Clin. Nutr. 1999, 69, 1046s–1051s. [Google Scholar] [CrossRef]
- Stolfi, C.; Pacifico, T.; Monteleone, G.; Laudisi, F. Impact of Western Diet and Ultra-Processed Food on the Intestinal Mucus Barrier. Biomedicines 2023, 11, 2015. [Google Scholar] [CrossRef]
- Tawiah, A.; Cornick, S.; Moreau, F.; Gorman, H.; Kumar, M.; Tiwari, S.; Chadee, K. High MUC2 Mucin Expression and Misfolding Induce Cellular Stress, Reactive Oxygen Production, and Apoptosis in Goblet Cells. Am. J. Pathol. 2018, 188, 1354–1373. [Google Scholar] [CrossRef]
- Li, G.; Gao, M.; Zhang, S.; Dai, T.; Wang, F.; Geng, J.; Rao, J.; Qin, X.; Qian, J.; Zuo, L.; et al. Sleep Deprivation Impairs Intestinal Mucosal Barrier by Activating Endoplasmic Reticulum Stress in Goblet Cells. Am. J. Pathol. 2024, 194, 85–100. [Google Scholar] [CrossRef]
- Paone, P.; Cani, P.D. Mucus barrier, mucins and gut microbiota: The expected slimy partners? Gut 2020, 69, 2232–2243. [Google Scholar] [CrossRef]
- Grondin, J.A.; Kwon, Y.H.; Far, P.M.; Haq, S.; Khan, W.I. Mucins in Intestinal Mucosal Defense and Inflammation: Learning From Clinical and Experimental Studies. Front. Immunol. 2020, 11, 2054. [Google Scholar] [CrossRef] [PubMed]
- Gouyer, V.; Dubuquoy, L.; Robbe-Masselot, C.; Neut, C.; Singer, E.; Plet, S.; Geboes, K.; Desreumaux, P.; Gottrand, F.; Desseyn, J.L. Delivery of a mucin domain enriched in cysteine residues strengthens the intestinal mucous barrier. Sci. Rep. 2015, 5, 9577. [Google Scholar] [CrossRef] [PubMed]
- Yao, D.; Dai, W.; Dong, M.; Dai, C.; Wu, S. MUC2 and related bacterial factors: Therapeutic targets for ulcerative colitis. EBioMedicine 2021, 74, 103751. [Google Scholar] [CrossRef]
- Leon-Coria, A.; Kumar, M.; Workentine, M.; Moreau, F.; Surette, M.; Chadee, K. Muc2 Mucin and Nonmucin Microbiota Confer Distinct Innate Host Defense in Disease Susceptibility and Colonic Injury. Cell. Mol. Gastroenterol. Hepatol. 2021, 11, 77–98. [Google Scholar] [CrossRef]
- Krishn, S.R.; Kaur, S.; Smith, L.M.; Johansson, S.L.; Jain, M.; Patel, A.; Gautam, S.K.; Hollingsworth, M.A.; Mandel, U.; Clausen, H.; et al. Mucins and associated glycan signatures in colon adenoma-carcinoma sequence: Prospective pathological implication(s) for early diagnosis of colon cancer. Cancer Lett. 2016, 374, 304–314. [Google Scholar] [CrossRef]
- Engevik, M.A.; Yacyshyn, M.B.; Engevik, K.A.; Wang, J.; Darien, B.; Hassett, D.J.; Yacyshyn, B.R.; Worrell, R.T. Human Clostridium difficile infection: Altered mucus production and composition. Am. J. Physiol. Gastrointest. Liver Physiol. 2015, 308, G510–G524. [Google Scholar] [CrossRef]
- Rasmussen, S.O.; Martin, L.; Østergaard, M.V.; Rudloff, S.; Li, Y.; Roggenbuck, M.; Bering, S.B.; Sangild, P.T. Bovine colostrum improves neonatal growth, digestive function, and gut immunity relative to donor human milk and infant formula in preterm pigs. Am. J. Physiol. Gastrointest. Liver Physiol. 2016, 311, G480–G491. [Google Scholar] [CrossRef]
- Puiman, P.J.; Jensen, M.; Stoll, B.; Renes, I.B.; de Bruijn, A.C.; Dorst, K.; Schierbeek, H.; Schmidt, M.; Boehm, G.; Burrin, D.G.; et al. Intestinal threonine utilization for protein and mucin synthesis is decreased in formula-fed preterm pigs. J. Nutr. 2011, 141, 1306–1311. [Google Scholar] [CrossRef]
- Chen, J.; Tellez, G.; Richards, J.D.; Escobar, J. Identification of Potential Biomarkers for Gut Barrier Failure in Broiler Chickens. Front. Vet. Sci. 2015, 2, 14. [Google Scholar] [CrossRef]
- Cheng, Y.F.; Chen, Y.P.; Chen, R.; Su, Y.; Zhang, R.Q.; He, Q.F.; Wang, K.; Wen, C.; Zhou, Y.M. Dietary mannan oligosaccharide ameliorates cyclic heat stress-induced damages on intestinal oxidative status and barrier integrity of broilers. Poult. Sci. 2019, 98, 4767–4776. [Google Scholar] [CrossRef]
- Lian, P.; Braber, S.; Varasteh, S.; Wichers, H.J.; Folkerts, G. Hypoxia and heat stress affect epithelial integrity in a Caco-2/HT-29 co-culture. Sci. Rep. 2021, 11, 13186. [Google Scholar] [CrossRef] [PubMed]
- Song, J.; Lei, X.; Luo, J.; Everaert, N.; Zhao, G.; Wen, J.; Yang, Y. The effect of Epigallocatechin-3-gallate on small intestinal morphology, antioxidant capacity and anti-inflammatory effect in heat-stressed broilers. J. Anim. Physiol. Anim. Nutr. 2019, 103, 1030–1038. [Google Scholar] [CrossRef] [PubMed]
- Liu, D.; Xu, Y.; Feng, J.; Yu, J.; Huang, J.; Li, Z. Mucins and Tight Junctions are Severely Altered in Necrotizing Enterocolitis Neonates. Am. J. Perinatol. 2021, 38, 1174–1180. [Google Scholar] [CrossRef] [PubMed]
- Wu, R.Y.; Li, B.; Koike, Y.; Määttänen, P.; Miyake, H.; Cadete, M.; Johnson-Henry, K.C.; Botts, S.R.; Lee, C.; Abrahamsson, T.R.; et al. Human Milk Oligosaccharides Increase Mucin Expression in Experimental Necrotizing Enterocolitis. Mol. Nutr. Food Res. 2019, 63, e1800658. [Google Scholar] [CrossRef] [PubMed]
- Sang, X.; Wang, Q.; Ning, Y.; Wang, H.; Zhang, R.; Li, Y.; Fang, B.; Lv, C.; Zhang, Y.; Wang, X.; et al. Age-Related Mucus Barrier Dysfunction in Mice Is Related to the Changes in Muc2 Mucin in the Colon. Nutrients 2023, 15, 1830. [Google Scholar] [CrossRef]
- Zhong, Y.; Wang, S.; Di, H.; Deng, Z.; Liu, J.; Wang, H. Gut health benefit and application of postbiotics in animal production. J. Anim. Sci. Biotechnol. 2022, 13, 38. [Google Scholar] [CrossRef]
- Meldrum, O.W.; Yakubov, G.E. Journey of dietary fiber along the gastrointestinal tract: Role of physical interactions, mucus, and biochemical transformations. Crit. Rev. Food Sci. Nutr. 2024. [Google Scholar] [CrossRef]
- Wen, X.; Wang, L.; Zheng, C.; Yang, X.; Ma, X.; Wu, Y.; Chen, Z.; Jiang, Z. Fecal scores and microbial metabolites in weaned piglets fed different protein sources and levels. Anim. Nutr. 2018, 4, 31–36. [Google Scholar] [CrossRef]
- Chiu, C.J.; Scott, H.J.; Gurd, F.N. Intestinal mucosal lesion in low-flow states. II. The protective effect of intraluminal glucose as energy substrate. Arch. Surg. 1970, 101, 484–488. [Google Scholar] [CrossRef]
- Dieleman, L.A.; Palmen, M.J.; Akol, H.; Bloemena, E.; Peña, A.S.; Meuwissen, S.G.; Van Rees, E.P. Chronic experimental colitis induced by dextran sulphate sodium (DSS) is characterized by Th1 and Th2 cytokines. Clin. Exp. Immunol. 1998, 114, 385–391. [Google Scholar] [CrossRef]
- Desantis, S.; Mastrodonato, M.; Accogli, G.; Rossi, G.; Crovace, A.M. Effects of a probiotic on the morphology and mucin composition of pig intestine. Histol. Histopathol. 2019, 34, 1037–1050. [Google Scholar]
- Sjöström, L.; Björntorp, P.; Vrána, J. Microscopic fat cell size measurements on frozen-cut adipose tissue in comparison with automatic determinations of osmium-fixed fat cells. J. Lipid Res. 1971, 12, 521–530. [Google Scholar] [CrossRef]
Diarrhoea Rate (%) | Diarrhoea Frequency (%) | Diarrhoea Index (%) | |
---|---|---|---|
Min pig | 35.42 | 6.51 | 0.96 |
Landrace pig | 73.33 | 23.13 | 2.80 |
χ2 | 27.80 | 44.40 | |
p < 0.0001 | p < 0.0001 |
Weaned Diarrhoea Group | Weaned Healthy Group | Unweaned Group | |||
---|---|---|---|---|---|
Min pig | Landrace | Min pig | Landrace | Min pig | Landrace |
3 | 3 | 3 | 3 | 3 | 3 |
Diarrhoea Severity | Faecal Appearance | Score |
---|---|---|
Normal | Formed or pellet-like | 0 |
Mild | Soft but formable | 1 |
Moderate | Viscous, unformed, with no separation of faecal water | 2 |
Severe | Liquid, unformed, with separation of faecal water, mucus stools, or pus stools | 3 |
Gene | Primer Sequences (5′-3′) | Product Length | GenBank Accession |
---|---|---|---|
MUC2 | F: CACCACCACCAGCACCACTTG R: TCGGACCAGACGCAGCAGAG | 84 bp | XM_021082584.1 |
β-actin | F: ATGCTTCTAGGCGGACTGT R: CCATCCAACCG ACTGCT | 211 bp | AY550069 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, L.; Jin, L.; Zhang, L.; Huang, X.; Li, Z.; Li, Z.; Li, K.; Xu, Y.; Di, S.; Cui, S.; et al. Exploring the Link Between Mucin 2 and Weaning Stress-Related Diarrhoea in Piglets. Int. J. Mol. Sci. 2025, 26, 599. https://doi.org/10.3390/ijms26020599
Wang L, Jin L, Zhang L, Huang X, Li Z, Li Z, Li K, Xu Y, Di S, Cui S, et al. Exploring the Link Between Mucin 2 and Weaning Stress-Related Diarrhoea in Piglets. International Journal of Molecular Sciences. 2025; 26(2):599. https://doi.org/10.3390/ijms26020599
Chicago/Turabian StyleWang, Li, Long Jin, Liulian Zhang, Xuankai Huang, Ziyu Li, Zhimin Li, Ke Li, Yuan Xu, Shengwei Di, Shiquan Cui, and et al. 2025. "Exploring the Link Between Mucin 2 and Weaning Stress-Related Diarrhoea in Piglets" International Journal of Molecular Sciences 26, no. 2: 599. https://doi.org/10.3390/ijms26020599
APA StyleWang, L., Jin, L., Zhang, L., Huang, X., Li, Z., Li, Z., Li, K., Xu, Y., Di, S., Cui, S., & Wang, X. (2025). Exploring the Link Between Mucin 2 and Weaning Stress-Related Diarrhoea in Piglets. International Journal of Molecular Sciences, 26(2), 599. https://doi.org/10.3390/ijms26020599