Next Article in Journal
Formation and Surface Structures of Long-Range Ordered Self-Assembled Monolayers of 2-Mercaptopyrazine on Au(111)
Previous Article in Journal
Two Novel Mouse Models of Duchenne Muscular Dystrophy with Similar Dmd Exon 51 Frameshift Mutations and Varied Phenotype Severity
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 26
Issue 1
10.3390/ijms26010159
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Comprehensive Analysis of the GiTCP Gene Family and Its Expression Under UV-B Radiation in Glycyrrhiza inflata Bat

by
Ziliang Liu
1,
Jiaang Zhao
1,
Ying Xiao
1,
Caijuan Li
1,
Rong Miao
1,
Sijin Chen
1,
Dan Zhang
2,
Xiangyan Zhou
1,2,* and
Mengfei Li
2,3,*
1
College of Life Science and Technology, Gansu Agricultural University, Lanzhou 730070, China
2
State Key Laboratory of Aridland Crop Science, Gansu Agricultural University, Lanzhou 730070, China
3
Agronomy College, Gansu Agricultural University, Lanzhou 730070, China
*
Authors to whom correspondence should be addressed.
Int. J. Mol. Sci. 2025, 26(1), 159; https://doi.org/10.3390/ijms26010159
Submission received: 5 November 2024 / Revised: 22 December 2024 / Accepted: 24 December 2024 / Published: 27 December 2024
(This article belongs to the Section Molecular Plant Sciences)
Browse Figures
Versions Notes

Abstract

:
TCP is a plant-specific transcription factor that plays an important role in plant growth and development. In this study, we used bioinformatics to identify the entire genome of the TCP gene family in Glycyrrhiza inflata Bat, and we analyzed the expression characteristics of GiTCP genes under UV-B radiation using qRT-PCR. The results were as follows: (1) 24 members of the TCP gene family were identified in G. inflata, evenly distributed on its 24 chromosomes. (2) The GiTCP genes contained 0–4 introns and 0–5 exons. (3) The GiTCP genes were phylogenetically divided into three subfamilies—PCF, CIN, and CYC/TB1, with 14, 9, and 1 GiTCP proteins, respectively. (4) A covariance analysis showed that two pairs of GiTCP genes underwent a fragmentary duplication event. (5) A cis-element analysis showed that the cis-responsive elements of the GiTCP genes’ promoter regions were mainly comprised of light-responsive, stress-responsive, hormone-regulated, growth and development, and metabolic-regulated elements. (6) A protein network interaction analysis revealed a total of 14 functional molecules of TCPs and 8 potential interacting proteins directly related to GiTCP proteins. (7) GO annotation showed that the GiTCP genes were mainly enriched in BP, CC, and MF groups and had corresponding functions. (8) RNA-seq and qRT-PCR further indicated that GiTCP3, 6, 7, 8, 12, 14, 17, 23, and 24 were up- or down-regulated in G. inflata after UV-B radiation, demonstrating that these genes responded to UV-B radiation in G. inflata. (9) Subcellular localization analysis showed that the GiTCP8 protein was localized in the nucleus. The results of this study provide a basis for further exploration of the function of the GiTCP gene family in the growth and development of G. inflata.

1. Introduction

Transcription factors (TFs) are a class of proteins with specialized structures and regulatory functions that play important roles in plant development and response to the external environment by activating or repressing gene transcription [1]. The TCP (teosinte branched 1/cincinnata/proliferating cell factor) gene family is a unique class of plant TFs gene. It consists of the TB1 (teosinte branched 1) gene in maize (Zea mays L.), the CYC (Cycloidea) gene in Anthurium majus, and the PCF1 and PCF2 (PROLIFERATING CELL FACTORS 1 and 2) genes in rice (Oryza sativa) [2,3,4]. The N-terminus of the TCP protein, a transcription factor, has a highly conserved Helix–Loop-Helix (bHLH) domain, also known as the TCP structural domain, which has the function of binding DNA. The TCP gene family is divided into two subclasses, Class I and Class II: Class I is dominated by the PCF gene family, while Class II has a large diversity of members and is subdivided into two subfamilies, CIN and CYC/TB1 [5]. The former usually contains the glutamic acid–cysteine glutamic acid stretch (ECE) domain and an arginine-rich domain (R), while the latter usually has microRNA binding sites.
TCP proteins play important regulatory roles in plant growth, development, and response to biotic and abiotic stresses [6]. Research has shown that TCP transcription factors are involved in plant cell signaling and are associated with the biosynthesis of salicylic acid, ethylene, and abscisic acid [7], and they are also closely related to plant organogenesis, circadian rhythms, calcium homeostasis, and the regulation of sugar transport [8]. Additionally, GmTCP has been identified as a key candidate gene for the soybean nodule phenotype in response to nitrogen concentration [9].
Over the past few years, the TCP gene family has been identified and analyzed in many plants. A total of 40 MsTCP genes were identified in Medicago sativa L., of which MsTCP23, MsTCP27, MsTCP29, and MsTCP33 demonstrated up-regulated expression under 15% PEG-6000 treatment [10]. There are a total of 48 MaTCP genes identified in bananas, and MaPCF1, MaPCF5, and MaPCF21 were up-regulated under low-temperature stress, salt stress, and osmotic stresses [11]. A total of 60 TCP family members were identified in Panax ginseng. qRT-PCR analysis showed that PgTCP20, PgTCP21, PgTCP22, and PgTCP23 were expressed in ginseng primary roots, baleen roots, rhizomes, stems, and leaves, while PgTCP24 was not expressed in stems but was highly expressed in roots and rhizomes. The tissue-specific expression of these genes in ginseng showed their close relationship with growth and development [12]. Zhang et al. identified 23 TCP family members in Andrographis paniculata, and the expression levels of most TCP genes were higher in leaves and stems than in roots. Additionally, they found that under UV-B radiation, the expression levels of all ApTCP genes were down-regulated, except for those of ApTCP2, ApTCP5, ApTCP6, ApTCP15, ApTCP18, and ApTCP23, which were up-regulated. In addition, ApTCP8, ApTCP9, ApTCP13, and ApTCP17 were not expressed [13]. A total of 50 TCPs were identified in three Dendrobium species, and transcriptomic analyses and qRT-PCR results indicated that DchTCP2 and DchTCP13 had significant effects on organ development. In addition, changes in the expression level of DchTCP4 indicated its important role in the phenotypic variation in floral organs [14]. Although the TCP family has been extensively studied in various plant species, the TCP gene family in licorice has not been reported.
The Chinese medicinal herb licorice refers to the dried roots and rhizomes of the perennial herbaceous plants of the genus Glycyrrhiza, such as G. uralensis Fisch, G. glabra L., and G. inflata Bat. They are commonly used in clinical practice. Because of their ability to harmonize all medicines and detoxify all poisons, they are known as the “national old man” [15]. Secondary metabolites are the main medicinal components of licorice, and their contents are closely related to the environment. Studies have shown that moderate drought stress can promote the accumulation of active ingredients in licorice [16]. It was found that the relative content of glycyrrhizic acid and glycyrrhizin increased notably under salt stress by inhibiting primary metabolism and promoting secondary metabolism [17]. Appropriate concentrations of GA3 and MeJA can significantly promote the accumulation of active substances in licorice and the expression of genes related to their biosynthetic pathway [18,19]. At present, cultivated licorice is the main supply source of commercial licorice. The quality of cultivated licorice has become one of the main factors restricting its development, and improving its quality is currently a hot topic in licorice research. In recent years, functional genomics studies of licorice have also gained attention. The sequencing and assembly of the whole genome of licorice have been completed, providing a data basis for identifying gene families and studying gene functions at the whole-genome level [20]. Regarding transcription factor function studies, key genes involved in the synthesis of secondary metabolites have been unearthed through the identification of the bZIP and WRKY gene families in licorice [21,22]. Abiotic stresses due to environmental factors and cultivation conditions have become important factors affecting the variable quality of licorice.
Therefore, in this study, we comprehensively identified and analyzed the GiTCP gene family using bioinformatics, and we analyzed the expression levels of the GiTCP genes under UV-B radiation using transcriptomics and qRT-PCR, thereby laying the foundation for further research on the function of GiTCP genes.

2. Results

2.1. Identification and Physicochemical Properties of Members of the GiTCP Gene Family of G. inflata

Based on conserved structural domains, 24 members of the TCP family in G. inflata were identified from the transcriptomic data (PRJNA1086199), and they were sequentially named GiTCP1~24 based on their chromosomal locations (Table 1). The physicochemical properties of the licorice TCP genes varied widely, with amino acid lengths ranging from 209 to 524. The molecular weight (MW) ranged from 22.11 to 57.43 kD. The isoelectric point (pI) ranged from 6.15 to 9.72, and acidic and basic proteins were evenly distributed. The instability indices ranged from 41.64 to 70.02, and they were greater than 40 for all family members, indicating that the GiTCP family was unstable. The fat index ranged from 46.27 to 72.65, with GiTCP4 being the smallest and GiTCP23 being the largest one. As the predicted total mean hydrophobicity (GRAVY) of GiTCP proteins ranged from 1.098 to 0.266, all of which were negative, it could be inferred that they were hydrophilic proteins. Subcellular localization predictions showed that all GiTCP genes localized to the nucleus, except for GiTCP7~9, GiTCP11~17, and GiTCP20~24, which also localized to the cytoplasm. In addition, GiTCP2, GiTCP11, GiTCP12, GiTCP13, GiTCP16, GiTCP17, GiTCP18, GiTCP21, GiTCP22, and GiTCP24 localized to the chloroplast.

2.2. Phylogenetic Construction, Motif, Domain, and Gene Structure Analysis of the GiTCP Gene Family in G. inflata

Evolutionary trees were constructed individually for the members of the licorice GiTCP gene family (Figure 1A) and predicted using TBtools software (TBtools 2.007), https://tbtools.cowtransfer.com/s/0a9cbf41b47b4a (accessed on 11 January 2024). Ten conserved motifs were identified in the GiTCP gene family (Figure 1B). Analyzed in conjunction with the conserved structural domains, motif 1 had a complete sequence of TCP-conserved structural domains, and all 24 members of the GiTCP genes family were found to contain TCP structural domains (Figure 1C). The number of motifs in each member varied greatly: there was a minimum of two motifs, which appeared in the protein sequence of GiTCP19 as a combination of motifs 1 and 2 and in that of GiTCP21 as a combination of motifs 1 and 4, and there was a maximum of six motifs, with the number of motifs in GiTCP1 and GiTCP11 being the same, but GiTCP1 contained motif 7 and GiTCP11 contained motif 9. This study also found that some motifs appeared with certain regularity; for example, motif 2 was always associated with motif 9. The number of motifs in GiTCP1 and GiTCP11 was the same, while GiTCP1 contained motif 7, and GiTCP11 contained motif 9. In this study, we also found that motif 2 was always adjacent to and appeared after motif 1, and motif 3 was always adjacent to and appeared before motif 1. Thus, it was hypothesized that members containing the features of this sequence belong to the same subfamily. In order to further understand the evolutionary features of the TCP gene structure of licorice, we analyzed the distribution of the exons and introns of the GiTCP gene. The results showed that GiTCP3, GiTCP6, GiTCP7, GiTCP9, GiTCP10, GiTCP13, GiTCP14, GiTCP17, GiTCP18, GiTCP19, GiTCP21, GiTCP23, and GiTCP24 had no intron structure; GiTCP1, GiTCP4, GiTCP5, GiTCP8, GiTCP15, GiTCP16, and GiTCP22 contained one intron; GiTCP2 and GiTCP contained two introns; GiTCP20 contained three introns; and GiTCP11 contained four introns (Figure 1D).

2.3. Distribution of GiTCP Genes on Chromosomes and Predictive Analysis of Secondary Structure in G. inflata

A chromosomal localization analysis revealed that the 24 GiTCP genes were evenly distributed on 24 chromosome scaffolds (Figure 2). A covariance analysis of the GiTCP genes family using MCScanX showed that two pairs of genes were segmental duplicates, GiTCP2–GiTCP12 and GiTCP5–GiTCP10.
There are four main types of secondary structures of proteins, namely, α-helix, β-fold, β-rotor, and irregular curl. Usually, due to the relatively high molecular weight of proteins, different peptides of a protein molecule may have different secondary structures [23]. The prediction of the secondary structures of the 24 GiTCP proteins (Table 2) showed that they were mainly α-helical and irregularly coiled, with a smaller proportion of β-turned corner structures. Among them, GiTCP7 had the largest proportion of irregularly coiled structures, accounting for 71.02%. The proportion of its α-helical structures was 12.53%.

2.4. Phylogenetic Tree Analysis of TCP Genes

A phylogenetic tree was constructed using MEGA11 analysis software (MEGA 11.0.13) by performing 1000 repetitive searches for 24 GiTCP, 14 EuTCP [24], 24 AtTCP [25], and 40 MsTCP [10] proteins.
As shown in Figure 3, the 102 TCP proteins were categorized into two large subfamilies, Class I and Class II, of which Class I is also known as the PCF subfamily, and Class II is further divided into the CYC/TB1 and CIN subfamilies. The PCF subfamily contained the highest number of TCP members, with 48 TCP proteins, 14 GiTCPs, 5 EuTCPs, 13 AtTCPs, and 16 MsTCPs, followed by the CIN subfamily, which consisted of 43 TCP proteins, and the CYC/TB1 subfamily, which had the lowest number of proteins, containing only 11 TCP proteins, 1 GiTCP, 5 EuTCPs, 1 AtTCP, and 4 MsTCPs. Both licorice and alfalfa belong to the legume family and are closely related compared to the other two species.

2.5. Cis-Acting Element Analysis of GiTCP Genes in G. inflata

Cis-acting regulatory elements act as molecular switches and are closely associated with the regulation of gene expression under biotic and abiotic stresses [26]. To further understand the role of GiTCP genes in growth, development, and their response to environmental stresses, we utilized Plant CARE and TBtools to identify cis-regulatory elements within the 2000 bp promoter fragment located upstream of their start codons. The results showed that most of the promoters in the GiTCP genes had 24 original components related to light response, stress response, hormone regulation, growth and development, and metabolic regulation (Figure 4), with the largest number of regulatory elements being related to light response. They also had a considerable number of elements related to hormone response, such as growth hormone, gibberellin, jasmonic acid methyl ester, salicylic acid, and abscisic acid. In addition, there were a number of elements related to environmental stresses, such as low temperature, drought, defense, and stress response, as well as a small number of growth- and development-related elements, such as meristematic tissues, circadian rhythms, and endosperm expression. The largest number of light-responsive promoters was eight. Except for GiTCP4, light-responsive elements were found in all other GiTCP promoters, suggesting that GiTCP also has an important function in the response to light in G. inflata.

2.6. Protein Interaction Network Analysis of GiTCPs

Protein network interactions play multiple roles in plant growth and development. For example, in certain signaling pathways, different members of a gene family collaborate with each other to regulate the expression and activity of downstream target molecules, thereby affecting biological processes, such as cell growth, proliferation, and differentiation. In addition, protein network interactions can be involved in the regulation of important biological processes in plants, such as response to adversity, photosynthesis, plastid wall separation, and reproduction. To clarify the function of GiTCP proteins, this study used the model plant Arabidopsis to predict potential interacting proteins related to GiTCP protein function (Figure 5). NAC098 interacts with AtTCP4, suggesting that AtTCP4 (GiTCP2, GiTCP9, and GiTCP12) has a similar function. NAC098, a transcriptional activator of STM and KNAT6, is involved in the molecular mechanisms and regulates shoot apical meristem (SAM) formation during embryogenesis and organ segregation. It is also involved in the initiation of axillary meristems, the separation of meristems from the main stem, and the regulation of leaf sequencing throughout plant development and appears to be an inhibitor of cell division [27,28]. APRR1 controls the photoperiodic bloom response. The expression of several members of the APRR protein family, such as APRR9, APRR7, APRR5, APRR3, and APPR1, is controlled by circadian rhythms [29,30]. APRR1 interacts with AtTCP7 (GiTCP24), TCP14 (GiTCP3, GiTCP6, and GiTCP14), AtTCP15, and AtTCP21, suggesting that they have similar functions. The Dof3.2 transcription factor negatively affects seed germination and regulates a set of abscisic acid-related genes [31]. DAR1, together with DA1 and DAR2, regulates internal replication during leaf development. DA1, together with DAR2, regulates the protein stability of the transcription factors AtTCP14 and AtTCP15, which repress internal replication by directly regulating the expression of cell cycle genes [32]. AtTCP8 interacts with PNM1, an RNA-binding protein that functions in both the mitochondria and the nucleus. In the mitochondria, it is associated with multimerization and plays a role in translation, and it is involved in regulating the expression of its own genes in the nucleus [33]. SRFR1 interacts with AtTCP8, AtTCP14, AtTCP15, AtTCP20, and AtTCP21, localized proteins with which it interacts on the microsomal membrane [34].

2.7. GO Functional Annotation of GiTCP Genes in G. inflata

Gene Ontology (GO) annotation of GiTCP genes was performed, as shown in Figure 6 and Table 3. The GiTCP genes were annotated, and only GiTCP1, GiTCP14, GiTCP16, GiTCP19, GiTCP23, and GiTCP24 were found to be functional. They were categorized into 15 functional groups, such as “Biological Process (BP)”, “Cell Component (CC)”, and “Molecular Function (MF)”. In terms of the BP group, the main processes were reproduction (GO:0000003), metabolic process (GO:0008152), cellular process (GO:0009987), reproductive process (GO:0022414), multicellular organism process (GO:0032501), developmental process (GO:0032502), rhythmic process, (GO:0048511), negative regulation of biological process (GO:0048519), regulation of biological process (GO:0050789), response to stimulus (GO:0050896), and biological regulation (GO:0065007). In terms of the MF group, the main functions were binding (GO:0005488) and transcription regulator activity (GO:0140110).

2.8. Effect of UV-B Radiation on G. inflata

In order to investigate the effect of UV-B radiation on G. inflata, an experiment was conducted to observe the phenotypic changes in potted licorice seedlings treated for different durations (0 d, 7 d, and 15 d). The results showed that licorice leaves exhibited no significant wilting or drying after 7 d of UV-B radiation. However, after 15 d, they began to curl and wilt (Figure 7).

2.9. Subcellular Localization Analysis

To further investigate the role of GiTCP in response to UV-B radiation in G. inflata, a highly expressed GiTCP8 protein was selected for in-depth functional studies. The pBWA(V)HS-GiTCP8-GLosgfp fusion protein was transiently expressed in tobacco leaves, and its subcellular localization revealed a strong fluorescent signal in the nucleus (Figure 8), suggesting that the GiTCP8 protein was localized in the nucleus. This observation was consistent with the results predicted by bioinformatics methods.

2.10. Expression Pattern Analysis of GiTCP Genes in Licorice Under UV-B Radiation

To investigate the expression patterns of the licorice TCP genes under UV-B radiation, an expression profile heatmap was plotted based on the FPKM values of raw RNA-seq data (Table S1). The results showed that GiTCP8, GiTCP22, and GiTCP24 were highly expressed in the roots of licorice; GiTCP1, GiTCP2, GiTCP4, GiTCP5, GiTCP10, GiTCP13, GiTCP18, GiTCP20, and GiTCP21 were barely expressed in the roots; and the other GiTCP genes showed a low expression. The expression of GiTCP3 and GiTCP8 increased with increasing radiation time in licorice. GiTCP11, GiTCP12, GiTCP16, GiTCP17, and GiTCP24 were down-regulated in licorice with the increase in radiation time, and the expression of GiTCP6, GiTCP7, GiTCP22, and GiTCP23 increased and then decreased with the increase in stress time in licorice. GiTCP14 showed a decrease and then an increase in expression with increasing radiation time (Figure 9).
Nine GiTCP genes were selected for a qRT-PCR analysis to validate the results (Figure 10, Table S2), which showed that, under UV-B radiation, GiTCP3, GiTCP8, and GiTCP24 were significantly up-regulated in licorice compared to the control (0 d). The relative expression of GiTCP6 and GiTCP23 peaked at 7 d of treatment. GiTCP7, GiTCP12, GiTCP14, and GiTCP17 showed the lowest expression under 7 d of treatment compared to those under 0 d and 15 d radiation. Thus, the transcriptomic results and qRT-PCR results were almost identical, which indicates that the transcriptomic results of this study are reliable.

3. Discussion

The TCP gene family is a class of plant-specific transcription factors that play key roles in plant growth, development, and stress response. Licorice is a traditional medicinal herb in China; however, abiotic stress has become a critical bottleneck affecting its yield and geographical distribution. In recent years, as the genomes of many plant species have been sequenced, genome-wide characterization of the TCP gene family has been carried out in many plant species, including Gramineae [35], Leguminosae [36], and Cruciferae [37]. Studies on the relationship between the TCP gene family and abiotic stresses in plants have been reported. TCP transcription factors have been found to interact with a variety of proteins involved in phytohormone signaling pathways, such as MYB and SAP11, during plant development [38,39]. This suggests that TCP transcription factors might play an important role in plant resistance to biotic and abiotic stresses.
In some plants, specific transcription factor families, such as the TCP factor family, may possess redundant genes, or their functions may be supplemented by other transcription factor families, resulting in a smaller number of TCP gene family members [40]. During the evolutionary process of plant genomes, events such as gene loss and duplication may occur. Over a long period of evolution, the genome of licorice has undergone a relatively small-scale expansion of TCP genes. Compared to some model plants, such as Arabidopsis, licorice may not have experienced large-scale genomic variations like gene expansion, duplication, or inter-species genome-level changes [41]. Licorice is a plant with strong adaptability, typically growing in arid or saline–alkali environments. Members of the TCP gene family play an important role in plant morphogenesis, including branching and leaf development [42]. However, licorice may differ from other plants in these developmental mechanisms. Its adaptability mechanisms may rely more on other types of transcription factors or regulatory mechanisms, and the number and function of the TCP gene family have not been expanded to the scale seen in other plant species.
In this study, the TCP gene family in licorice was analyzed and identified at the whole-genome level, and a total of 24 TCP genes were obtained, which were evenly distributed on 24 chromosome scaffolds. By analyzing the physicochemical properties of GiTCP proteins, it was found that all the proteins of this family had good hydrophilicity. Additionally, there were significant differences in the molecular weight and isoelectric point of the proteins (Table 1), which were similar to those of other plant TCP proteins. It is hypothesized that the variability of GiTCP proteins may be related to the involvement of different GiTCP genes in different organ development signaling processes [43]. Subcellular localization predictions showed that all 24 GiTCP family members were localized to the nucleus, and some were also localized to the cytoplasm, similar to the results reported in Brassica juncea [37], Medicago truncatula [44], and other species. The secondary structures were mainly α-helical and irregularly coiled.
A phylogenetic analysis showed that the licorice TCP gene family is mainly divided into three subfamilies: PCF, CIN, and CYC/TB1. In the evolutionary tree, we found that three pairs, GiTCP14 and AtTCP2, GiTCP3 and AtTCP11, and GiTCP8 and AtTCP15, were on the same branch, among which GiTCP14 may be similar to AtTCP2 and plays an important role in the regulation of plant leaf morphology and size [45]. GiTCP3 and AtTCP11 have similar functions and play an important role in the regulation of vascular bundle development [46]. GiTCP8 is functionally similar to AtTCP15, which can affect cell differentiation and proliferation and the development of organs [47]. The high homology between the GiTCP genes and the MsTCP gene indicates that they are closely related [10].
Conserved motif and structural domain analyses revealed that all 24 GiTCP genes contained motif 1, indicating that this motif was highly conserved throughout the evolution of the TCP gene family in licorice. The results of a gene structure analysis showed that the gene structure of GiTCPs was relatively simple, with a small number of introns ranging from 0 to 4, similar to the results of studies on species such as Solanum Muricatum [48] and Elaeis gineensis Jacq [49].
In addition, the prediction of cis-acting elements in the promoter of the licorice TCP gene revealed that the light-responsive element was the most abundant, as well as elements responsive to phytohormones, stress, etc., suggesting that the TCP family of genes in plants is involved in many biological processes, such as photosynthesis, growth and developmental regulation, and stress response [50,51,52]. It is hypothesized that the GiTCP gene family also plays an important role in growth and development, as well as in the regulation of various stresses.
The results of GO annotation suggest that GiTCP genes are involved in a transcriptional regulatory network that plays a role in cell development, differentiation, and response to environmental changes. The present study combined transcriptome and qRT-PCR analyses to illustrate that the GiTCP genes were differentially expressed at different times under UV-B radiation. For example, GiTCP8, GiTCP22, and GiTCP24 were highly expressed in the roots of licorice; GiTCP1, GiTCP2, GiTCP4, GiTCP5, GiTCP10, GiTCP13, GiTCP18, GiTCP20, and GiTCP21 were barely expressed in the roots; and the other GiTCP genes showed a low expression. GiTCP6 and GiTCP23 peaked after 7 d of UV-B radiation in licorice. Hao et al. reported that many CrTCP genes, such as CrTCP2, CrTCP4, CrTCP5, CrTCP8, CrTCP9, CrTCP10, CrTCP12, CrTCP13, and CrTCP15, were significantly reduced at different time points in periwinkle under UV-B radiation. However, CrTCP14 expression was significantly induced by radiation with an intensity of 10 μmol (m2s)−1 after 3 h and significantly decreased after 24 h. The expression of CrTCP6 was significantly down-regulated at 6 h and up-regulated at 24 h [53]. In Andrographis paniculata, the expression levels of all TCP genes were down-regulated under UV-B radiation, except for those of ApTCP2, ApTCP5, ApTCP6, ApTCP15, ApTCP18, and ApTCP23, which were up-regulated. In addition, the expression of ApTCP8, ApTCP9, ApTCP13, and ApTCP17 was not detected [12], further confirming that TCP transcription factors play an important role in response to UV-B radiation. Licorice showed a certain resistance to abiotic stress, which promoted the production of secondary metabolites to a certain extent. Li found that a total of six GiHDMT genes (GiHDMT8, 11, 15, 13, 21, and 26) were down-regulated and that GiHDMT23 was up-regulated after NaCl (200 mM) stress [54]. After Na2CO3 (100 mM) stress, the expression levels of GiHDMT18, GiHDMT13, GiHDMT20, GiHDMT19, and GiHDMT15 were down-regulated, and GiHDMT 23 was up-regulated. After ABA (100 μM) treatment, it was found that only one gene (GiHDMT1) was induced, and the expression of three genes (GiHDMT8, GiHDMT13, and GiHDMT20) was significantly inhibited. After treatment with MeJA (100 μM), the expression levels of all GiHDMTs were decreased, but the expression levels of GiHDMT1, GiHDMT11, and GiHDMT23 varied non-significantly.
In summary, this study systematically analyzed 24 GiTCP gene family members based on bioinformatics and transcriptome data of two varieties of licorice under UV-B radiation, and it preliminarily investigated the biological functions of GiTCP genes, thereby providing a theoretical foundation for future in-depth studies on the molecular functions and regulatory roles of GiTCP genes in licorice development.

4. Materials and Methods

4.1. Plant Materials, Growth Conditions, and Treatments

Seeds of Glycyrrhiza inflata were obtained from Gansu Provincial Economic Crops Technology Popularization Station (No.282 East Xijin Road, Anning District, Lanzhou City, Gansu Province, China). The species was identified by Professor Pingshun Song of Gansu University of Chinese Medicine. Licorice seeds were selected and soaked in 98% H2SO4 for 30 min to break seed dormancy, stirred every 10 min, and rinsed with distilled water to remove residual sulfuric acid. They were then sterilized using 3% NaClO (Gansu Elvey Scientific Instrument, Lanzhou, China) for 12 min and submerged in 75% ethanol for 2 min before being rinsed clean using distilled water. The treated seeds were germinated on Petri dishes for 5 d, and uniformly grown seedlings were transplanted to pots containing nutrient soil and vermiculite in a ratio of 5:3, during which time they were watered at 7 d intervals using Hoagland nutrient solution. All seedlings were grown at a temperature of 25 °C in a greenhouse with a light intensity of 500 μmol (m2s)−1 and a light/darkness cycle of 12/12 h. The seedlings were allowed to grow until they were 90 d old. Licorice plants were selected and then irradiated with UV-B (214 μW·m−2) for durations of 0, 7, and 15 d. Their roots were subsequently taken, rinsed with sterilized water, and snap-frozen in liquid nitrogen. The samples were stored in a refrigerator at −80 °C. Three biological replicates were prepared for each treatment group.

4.2. Identification of TCP Gene Family Members in Licorice

The GiTCP gene family was screened and identified based on the genome sequence database of licorice (http://ngs-data-archive.psc.riken.jp/Gur-genome/download.pl, accessed on 10 January 2024) combined with unpublished transcriptomic data of G. inflata obtained from our group [20]. The protein sequences of the AtTCP gene family were downloaded from TAIR (https://www.arabidopsis.org/, accessed on 10 January 2024). TBtools (Version number: 2.007) was utilized to BLAST the AtTCP protein sequences with the transcriptome data. Preliminary candidate sequences for the GiTCP family members were obtained. The obtained sequences were further screened and confirmed using Pfamscan (https://www.ebi.ac.uk/Tools/pfa/pfamscan/, accessed on 10 January 2024) to eliminate candidate sequences without TCP structural domains (PF03634). Finally, all the TCP family members in licorice were obtained. An analysis of the physicochemical properties of the GiTCP proteins was performed on the website ExPASy (https://web.expasy.org/protparam/, accessed on 11 January 2024). Subcellular localization prediction of the GiTCP genes was performed on the website WOLF PSORT (https://wolfpsort.hgc.jp/, accessed on 11 January 2024) [55].

4.3. Domain, Gene Structure, and Conserved Motifs of TCP Proteins in Licorice

The GiTCP protein sequences were uploaded to the website MEME (https://meme-suite.org/meme/, accessed on 11 January 2024) to analyze conserved motifs, with the parameter of the corresponding number of motifs set to 10 and the rest of the parameters set to default, and the MAST.XML file was downloaded. The conserved structural domains of the TCP proteins were analyzed using the NCBI CDD tool (https://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi, accessed on 11 January 2024). Finally, they were visualized and analyzed using TBtools [56].

4.4. Chromosomal Mapping and Secondary Structure Analysis of TCP Genes in Licorice

The physical locations of the GiTCP genes were determined on the chromosomes using the gff file of the licorice genome. A physical map of the genes on the chromosomes was constructed using TBtools, as well as an intraspecific collinearity analysis conducted using MCScanX (an add-on of TBtools 2.007) [57]. The secondary structure of the GiTCP proteins was predicted using the online website SOPMA (https://npsa-prabi.ibcp.fr/cgi-bin/npsa_automat.pl?page=npsa_SOPMA.html, accessed on 11 January 2024).

4.5. Phylogenetic Tree Analysis of TCP Genes in Licorice

The homostructural domain protein sequences of G. inflata, Arabidopsis thaliana, Eucommia ulmoides, and Medicago sativa were used for a phylogenetic analysis. MEGA11 software was used for a sequence comparison analysis, and Neighbor-Joining (NJ) was used to construct a phylogenetic tree of the above four species, with the BootStrap calibration parameter set to 1000, all other parameters set to default, and iTOL (https://itol.embl.de/, accessed on 12 January 2024) used for beautification [58].

4.6. Analysis of Cis-Acting Elements of TCP Gene Family in G. inflata

TBtools software was utilized to perform a search for promoter cis-acting elements by extracting a 2000 bp sequence upstream of the start codon of the GiTCP gene from the transcriptome data of G. inflata and submitting it to the online website PlantCARE (http://bioinformatics.psb.ugent.be/webtools/PlantCARE/html, accessed on 12 January 2024) for a predictive analysis [59].

4.7. Construction of TCP Protein Interaction Network in G. inflata

The model plant Arabidopsis thaliana was used to predict the interactions of the TCP protein network structures of the homologous genes of licorice and Arabidopsis. Protein network interaction maps were constructed using the online website STRING (https://cn.string-db.org/, accessed on 13 January 2024) [60].

4.8. Subcellular Localization Assays

The constructed vector plasmid was transferred into Agrobacterium tumefaciens (GV3101) by electrotransformation method and incubated at 30 °C for 2 d. Then, Agrobacterium tumefaciens was scraped off a solid Petri dish with an inoculation ring, connected to 10 mL of the corresponding resistant YEB liquid medium, and then incubated at 170 rpm one min for 1 h to collect the bacterial body (4000 rpm one min, centrifuged for 4 min). Then, the supernatant was removed, and the bacteria were resuspended in 10 mM MgCl2 (containing 120 μM AS) suspension, with the OD600 adjusted to approximately 0.6. Tobacco plants in good growth conditions were selected and injected into the lower epidermis of the leaves using a 1 mL syringe with the tip removed and labeled well. The injected tobacco plants were cultured in low light for 2 d. The labeled Agrobacterium-injected tobacco leaves were taken, made into slides, observed under a laser confocal microscope, and photographed.

4.9. Transcriptome Sequencing Analysis

The total RNA was extracted from the collected licorice root samples using the Trizol reagent kit (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol. The quality of the RNA was assessed on an Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA, USA) and checked using Rnase-free agarose gel electrophoresis (Invitrogen, Carlsbad, CA, USA). After extraction of the total RNA, eukaryotic mRNA was enriched by Oligo (dT) beads. Then, the enriched mRNA was fragmented into short fragments using fragmentation buffer and reverse-transcribed into cDNA by using NEBNext Ultra RNA Library Prep Kit for Illumina (NEB#7530, New England Biolabs, Ipswich, MA, USA). The purified double-stranded cDNA fragments were end-repaired, had a base added, and were ligated to Illumina sequencing adapters. The ligation reaction was purified with the AMPure XP Beads (Invitrogen, Carlsbad, CA, USA) and amplified by polymerase chain reaction (PCR). The cDNA library was sequenced using Illumina Novaseq6000 by Gene Denovo Biotechnology Co. (Guangzhou, China). The transcriptome data of the roots of G. inflata under UV-B radiation have been deposited in the National Center of Biotechnology Information Gene Expression Omnibus (NCBI GEO) repository (http://www.ncbi.nlm.nih.gov/geo) under accession number PRJNA1086199.

4.10. GO Analysis of TCP Genes in Licorice

Gene functional classification and annotation were conducted using the online software of Gene Denovo Biotechnology Co., Ltd. (https://www.omicshare.com/tools/, accessed on 10 October 2023).

4.11. RNA Isolation and qRT-PCR

The CDS sequences of the GiTCP genes were identified from the transcriptome data, and primers (Table 4) were designed through NCBI (National Center for Biotechnology Information (nih.gov)). The gene β-actin was selected as the internal reference gene. Total RNA was extracted using TIANGEN’s Plant Tissue Rapid RNA Extraction Kit (Tiangen Biotech, Beijing, China) and then reverse-transcribed into cDNA with a cDNA Synthesis Kit (Tiangen Biotech, Beijing, China) for a qRT-PCR assay, which was repeated three times for each sample. Finally, the relative expression of the GiTCP genes was calculated and analyzed using the 2−ΔΔCt algorithm and plotted using Excel 2019, SPSS 23, and Origin 2021 [61,62].

5. Conclusions

In this study, 24 GiTCP genes were identified in licorice at the genome level, and their structure and function were analyzed using bioinformatics. The GiTCPs were divided into Class I and Class II, and they were further divided into three subfamilies (namely, PCF, CYC/TB1, and CIN). In addition, a promoter analysis showed that the GiTCP promoter region usually contained cis-acting elements that respond to abiotic stresses, such as light-responsive, defense-responsive, and stress-responsive elements. A collinearity analysis showed that two pairs of genes had fragment duplication, which played a key role in the expansion of the GiTCP gene family. On this basis, the genes with a certain potential resistance to UV-B radiation were identified as candidate genes by comparing them with the transcriptome data of licorice. The expression patterns of the candidate genes were analyzed using qRT-PCR. GiTCP3, GiTCP6, GiTCP7, GiTCP8, GiTCP11, GiTCP12, GiTCP14, GiTCP17, GiTCP22, GiTCP23, and GiTCP24 were found to respond to UV-B radiation. This study lays an important foundation for further research on the function of the GiTCP gene family, especially under UV-B radiation. It also provides an important potential application value for the breeding of stress tolerance in licorice.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms26010159/s1.

Author Contributions

X.Z. and M.L. provided the study idea. Z.L. wrote the original draft. J.Z., Y.X., C.L., R.M., D.Z. and S.C. collected the data and constructed the graphs. X.Z. and M.L. made the final revisions to the paper. All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported by the National Key Research and Development Program of China (2022YFC3501500), the earmarked fund for CARS (CARS-21) and the State Key Laboratory of Aridland Crop Science, Gansu Agricultural University (GSCS-2018-4; GSCS-2023-08).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data are available in the National Center of Biotechnology Information Gene Expression Omnibus (NCBI GEO) repository (http://www.ncbi.nlm.nih.gov/geo) under accession number of PRJNA1086199.

Acknowledgments

We are grateful to Senior Agronomist Zhanfeng Cao at the Gansu Provincial Economic Crops Technology Popularization Station for providing the G. inflata Bat seeds.

Conflicts of Interest

The authors declare no conflicts of interest.

Abbreviations

TCPteosinte branched 1/cincinnata/proliferating cell factor
TB1teosinte branched 1
PCFproliferating cell factor
CYCcycloidea
MsMedicago sativa L
MaMusa acuminata
PgPanax ginseng
ApAndrographis paniculata
DchDendrobium
GiG. inflata Bat
GA3gibberellic acid 3
MeJAmethyl jasmonate
bZIPbasic region/leucine zipper
AAamino acid sequence length
MWmolecular weight
pIisoelectric point
GRAVYgrand average of hydropathicity
IIinstability index
AIaliphatic index
SLsubcellular localization
Nnucleus
Ccytoplasm
CPchloroplast
Eextracellular matrix
Mmitochondria
Pmplasma membrane
AtArabidopsis thaliana
EuEucommia ulmoides
GOgene ontology
qRT-PCRquantitative real-time PCR
UV-Bultraviolet B
CrCatharanthus roseus

References

  1. Almeida, D.M.; Gregorio, G.B.; Oliveira, M.M.; Saibo, N.J. Five novel transcription factors as potential regulators of OsNHX1 gene expression in a salt tolerant rice genotype. Plant Mol. Biol. 2017, 93, 61–77. [Google Scholar] [CrossRef] [PubMed]
  2. Cubas, P.; Coen, E.; Zapater, J.M. Ancient asymmetries in the evolution of flowers. Curr. Biol. 2001, 11, 1050–1052. [Google Scholar] [CrossRef] [PubMed]
  3. Doebley, J.; Stec, A.; Hubbard, L. The evolution of apical dominance in maize. Nature 1997, 386, 485–488. [Google Scholar] [CrossRef] [PubMed]
  4. Kosugi, S.; Ohashi, Y. PCF1 and PCF2 specifically bind to cis elements in the rice proliferating cell nuclear antigen gene. Plant Cell. 1997, 9, 1607–1619. [Google Scholar] [PubMed]
  5. Martín-Trillo, M.; Cubas, P. TCP genes: A family snapshot ten years later. Trends Plant Sci. 2010, 15, 31–39. [Google Scholar] [CrossRef]
  6. Nicolas, M.; Cubas, P. TCP factors: New kids on the signaling block. Curr. Opin. Plant Biol. 2016, 33, 33–41. [Google Scholar] [CrossRef]
  7. An, J.X.; Guo, Z.X.; Gou, X.P.; Li, J. TCP1 positively regulates the expression of DWF4 in Arabidopsis thaliana. Plant Signal. Behav. 2011, 6, 1117–1118. [Google Scholar] [CrossRef]
  8. Luo, M.; Zhang, Z.M.; Gao, J.; Zeng, X.; Pan, G.T. The role of miR319 in plant development regulation. Hereditas 2011, 33, 1203–1211. [Google Scholar] [CrossRef]
  9. Kim, Y.; Wang, J.; Ma, C.; Jong, C.; Jin, M.; Cha, J.; Wang, J.; Peng, Y.; Ni, H.; Li, H.; et al. GmTCP and GmNLP Underlying Nodulation Character in Soybean Depending on Nitrogen. Int. J. Mol. Sci. 2023, 24, 7750. [Google Scholar] [CrossRef]
  10. Wei, N.; Li, Y. Genome-wide identification of the alfalfa TCP gene family and analysis of gene transcription patterns in alfalfa (Medicago sativa) under drought stress. Acta Prataculturae Sin. 2021, 31, 118. [Google Scholar]
  11. Wang, J.Y.; Wang, Z.; Jia, C.H.; Miao, H.X.; Zhang, J.B.; Liu, J.H.; Xu, B.Y.; Jin, Z.Q. Genome-wide identification and transcript analysis of TCP gene family in Banana (Musa acuminata L.). Biochem. Genet. 2022, 60, 204–222. [Google Scholar] [CrossRef] [PubMed]
  12. Lv, Q.; Jiao, H.H.; Yu, Q.R.; Hua, Z.Y.; Zhao, Y.Y.; Zhou, J.H.; Yuan, Y.; Huang, L.Q. Bioinformatics analysis and function prediction of ginseng TCP transcription factor family. China J. Chin. Mater. Medica. 2021, 46, 3838–3845. [Google Scholar]
  13. Zhang, L.; Xu, S.Q.; Li, J.Y.; Hu, X.B.; Gu, Y.; Wang, J.H. Genome-wide identification and expression analysis of the TCP gene family of Andrographis paniculata under abiotic stress. China J. Chin. Mater. Medica. 2024, 49, 379–388. [Google Scholar]
  14. Huang, Y.; Zhao, X.; Zheng, Q.; He, X.; Zhang, M.M.; Ke, S.; Li, Y.; Zhang, C.; Ahmad, S.; Lan, S.; et al. Genome-wide identification of TCP gene family in dendrobium and their expression patterns in Dendrobium chrysotoxum. Int. J. Mol. Sci. 2023, 24, 14320. [Google Scholar] [CrossRef]
  15. Li, J.; Li, X.; Cao, M.M.; Dong, W.R.; Jiang, J.Q. Research progress in pharmacological actions of liquorice and proportion of couplet medicines in combination. Shanghai J. Tradit. Chin. Med. 2019, 53, 83–87. [Google Scholar]
  16. Zhang, D.; Liu, Y.; Yang, Z.R.; Song, X.Q.; Ma, Y.L.; Zhao, J.Y.; Wang, X.Y.; Liu, H.; Fan, L. Widely target metabolomics analysis of the differences in metabolites of licorice under drought stress. Ind. Crops Prod. 2023, 202, 117071. [Google Scholar] [CrossRef]
  17. Wang, C.C.; Chen, L.H.; Cai, Z.C.; Chen, C.H.; Liu, Z.X.; Liu, S.J.; Zhou, L.S.; Tan, M.X.; Chen, J.L.; Liu, X.H.; et al. Metabolite profiling and transcriptome analysis explains difference in accumulation of bioactive constituents in licorice (Glycyrrhiza uralensis) under salt stress. Front. Plant Sci. 2021, 12, 727882. [Google Scholar] [CrossRef]
  18. Yao, H.; Wang, F.; Bi, Q.; Liu, H.L.; Liu, L.; Xiao, G.H.; Zhu, J.B.; Shen, H.T.; Li, H.B. Combined analysis of pharmaceutical active ingredients and transcriptomes of Glycyrrhiza uralensis under PEG6000-induced drought stress revealed glycyrrhizic acid and flavonoids accumulation via ja-mediated signaling. Front. Plant Sci. 2022, 13, 920172. [Google Scholar] [CrossRef]
  19. Liang, X.W.; Yang, Q.; Li, D.; Chen, X.X.; Tang, X.M.; Pan, L.M.; Zhang, C.R. Regulation of methyl jasmonate on secondary metabolism of Glycyrrhiza uralensis. Guangdong Agric. Sci. 2017, 44, 57–62. [Google Scholar]
  20. Mochida, K.; Sakurai, T.; Seki, H.; Yoshida, T.; Takahagi, K.; Sawai, S.; Uchiyama, H.; Muranaka, T.; Saito, K. Draft genome assembly and annotation of Glycyrrhiza uralensis, a medicinal legume. Plant J. 2017, 89, 181–194. [Google Scholar] [CrossRef]
  21. Wang, Q.; Wu, L.Q.; Fan, F.H.; Xu, Z.C.; Luo, H.M.; Sun, W.; Wang, Y.; Zheng, S.H.; Song, J.Y.; Yao, H. Systematic screening and analysis of bZIP transcription factors in Glycyrrhiza uralensis and their response to ABA stress. Acta Pharm. Sin. 2023, 25, 1207–1217. [Google Scholar]
  22. Goyal, P.; Manzoor, M.M.; Vishwakarma, R.A.; Sharma, D.; Dhar, M.K.; Gupta, K. A comprehensive transcriptome-wide identification and screening of WRKY gene family engaged in abiotic stress in Glycyrrhiza glabra. Sci. Rep. 2020, 10, 373. [Google Scholar] [CrossRef] [PubMed]
  23. Ren, C.; Zhang, Z.; Wang, Y.; Li, S.H.; Liang, Z.C. Genome-wide identification and characterization of the NF-Y gene family in grape (Vitis vinifera L.). BMC Genom. 2016, 17, 1–16. [Google Scholar] [CrossRef] [PubMed]
  24. Liu, J.; Li, L.; Wu, Y.S.; Liu, Y.; Ren, S.S.; Chen, Y.L. Identification and bioinformatics analysis of TCP family genes in Eucommia ulmoides. Chin. Tradit. Herb. Drugs. 2022, 53, 5813–5824. [Google Scholar]
  25. Abel, S.; Savchenko, T.; Levy, M. Genome-wide comparative analysis of the IQD gene families in Arabidopsis thaliana and Oryza sativa. Bmc Evol. Biol. 2005, 5, 1–25. [Google Scholar] [CrossRef]
  26. Nakashima, K.; Ito, Y.; Yama Gichi-Shinozaki, K. Transcriptional regulatory networks in response to abiotic stresses in Arabidopsis and grasses. Plant Physiol. 2009, 149, 88–95. [Google Scholar] [CrossRef]
  27. Ooka, H.; Satoh, K.; Doi, K.; Nagata, T.; Otomo, Y.; Murakami, K.; Matsubara, K.; Osato, N.; Kawai, J.; Carninci, P.; et al. Comprehensive analysis of NAC family genes in Oryza sativa and Arabidopsis thaliana. DNA Res. 2003, 10, 39–47. [Google Scholar] [CrossRef]
  28. Taoka, K.; Yanagimoto, Y.; Daimon, Y.; Hibara, K.; Aida, M.; Tasaka, M. The NAC domain mediates functional specificity of CUP-SHAPED COTYLEDON proteins. Plant J. 2004, 40, 462–473. [Google Scholar] [CrossRef]
  29. Matsushika, A.; Makino, S.; Kojima, M.; Mizuno, T. Circadian waves of expression of the APRR1/TOC1 family of pseudo-response regulators in Arabidopsis thaliana: Insight into the plant circadian clock. Plant Cell Physiol. 2000, 41, 1002–1012. [Google Scholar] [CrossRef]
  30. Pruneda-Paz, J.L.; Breton, G.; Para, A.; Kay, S.A. A functional genomics approach reveals CHE as a component of the Arabidopsis circadian clock. Science 2009, 323, 1481–1485. [Google Scholar] [CrossRef]
  31. Rueda-Romero, P.; Barrero-Sicilia, C.; Gomez-Cadenas, A.; Carbonero, P.; Oñate-Sánchez, L. Arabidopsis thaliana DOF6 negatively affects germination in non-after-ripened seeds and interacts with TCP14. J. Exp. Bot. 2012, 63, 1937–1949. [Google Scholar] [CrossRef] [PubMed]
  32. Peng, Y.C.; Chen, L.L.; Lu, Y.; Wu, Y.B.; Dumenil, J.; Zhu, Z.G.; Bevan, M.W.; Li, Y.H. The ubiquitin receptors DA1, DAR1, and DAR2 redundantly regulate endoreduplication by modulating the stability of TCP14/15 in Arabidopsis. Plant Cell. 2015, 27, 649–662. [Google Scholar] [CrossRef] [PubMed]
  33. Hammani, K.; Gobert, A.; Hleibieh, K.; Choulier, L.; Small, I.; Giegé, P. An Arabidopsis dual-localized pentatricopeptide repeat protein interacts with nuclear proteins involved in gene expression regulation. Plant Cell. 2011, 23, 730–740. [Google Scholar] [CrossRef] [PubMed]
  34. Bhattacharjee, S.; Halane, M.K.; Kim, S.H.; Gassmann, W. Pathogen effectors target Arabidopsis EDS1 and alter its interactions with immune regulators. Science 2011, 334, 1405–1408. [Google Scholar] [CrossRef]
  35. Zheng, L.; Bai, X.T.; Li, H.Y. Genome-wide identification and expression analysis of Sorghum bicolor TCP gene family. Henan Agric. Sci. 2019, 537, 36–42. [Google Scholar]
  36. Liu, Y.; Zhang, H.; Xin, D.W.; Wang, L.L.; Zhang, L.W.; Liu, C.Y.; Chen, Q.S.; Hu, G.H. Analysis and function prediction of Glycine max TCP transcription factor domains. Soybean Sci. 2012, 31, 707–713. [Google Scholar]
  37. Li, K.J.; Tan, S.S.; Sun, B.; Rao, D.; He, Q.; Min, A.L.; Li, M.Y. Genome-wide identification and expression analysis of Brassica juncea TCP transcription factor. J. Sichuan Agric. Univ. 2019, 37, 459–468. [Google Scholar]
  38. Lei, D.; Wu, Y.; Su, Z. Research progress on the interaction between TCP transcription factors and hormone signals. Mol. Plant Breed. 2019, 17, 2868–2875. [Google Scholar]
  39. Zhang, M.; Agassin, R.H.; Huang, Z.; Wang, D.; Yao, S.; Ji, K. Transcriptome-wide identification of TCP transcription factor family members in Pinus massoniana and their expression in regulation of development and in response to stress. Int. J. Mol. Sci. 2023, 24, 15938. [Google Scholar] [CrossRef]
  40. Lei, Q.D.; Sun, X.D.; Xu, H.N. Research progress in transcription factor TCP4 participating in plant growth, development and stress resistance regulation. Acta Agric. Boreali-Sin. 2021, 36, 210–214. [Google Scholar]
  41. Wang, J.L.; Wang, H.W.; Cao, Y.N.; Kan, S.L.; Liu, Y.Y. Comprehensive evolutionary analysis of the TCP gene family: Further insights for its origin, expansion, and diversification. Front. Plant Sci. 2021, 13, 994567. [Google Scholar] [CrossRef] [PubMed]
  42. Liu, M.M.; Wang, M.M.; Yang, J.; Wen, J.; Guo, P.C.; Wu, Y.W.; Ke, Y.Z.; Li, P.F.; Li, J.N.; Du, H. Evolutionary and comparative expression analyses of TCP transcription factor gene family in land plants. Int. J. Mol. Sci. 2019, 20, 3591. [Google Scholar] [CrossRef] [PubMed]
  43. Perez, M.; Gierringue, Y.; Ranty, B.; Pouzet, C.; Jauneau, A.; Robe, E.; Mazars, C.; Galaud, J.P.; Aldon, D. Specific TCP transcription factors interact with and stabilize PRR2 within different nuclear sub-domains. Plant Sci. 2019, 287, 110197. [Google Scholar] [CrossRef] [PubMed]
  44. Wang, H.F.; Wang, H.W.; Liu, R.; Xu, Y.T.; Lu, Z.C.; Zhou, C.E. Genome-wide identification of TCP family transcription factors in Medicago truncatula reveals significant roles of miR319-Targeted TCPs in nodule development. Front. Plant Sci. 2018, 9, 774. [Google Scholar] [CrossRef]
  45. He, Z.M.; Zhao, X.Y.; Kong, F.N.; Zuo, Z.C.; Liu, X.M. TCP2 positively regulates HY5/HYH and photomorphogenesis in Arabidopsis. J. Exp. Bot. 2016, 67, 775–785. [Google Scholar] [CrossRef]
  46. Viola, I.L.; Uberti Manassero, N.G.; Ripoll, R.; Gonzalez, D.H. The Arabidopsis class I TCP transcription factor AtTCP11 is a developmental regulator with distinct DNA-binding properties due to the presence of a threonine residue at position 15 of the TCP domain. Biochem. J. 2011, 435, 143–155. [Google Scholar] [CrossRef]
  47. Li, Z.; Li, B.; Dong, A. The Arabidopsis transcription factor AtTCP15 regulates endoreduplication by modulating expression of key cell-cycle genes. Mol. Plant. 2012, 5, 270–280. [Google Scholar] [CrossRef]
  48. Si, C.; Zhan, D.; Wang, L.; Sun, X.; Zhong, Q.; Yang, S. Systematic investigation of TCP gene family: Genome-wide identification and light-regulated gene expression analysis in pepino (Solanum Muricatum). Cells. 2023, 12, 1015. [Google Scholar] [CrossRef]
  49. Zhou, L.X.; Zhao, Z.H.; Yang, M.D.; Cao, H.X.; Yang, Y.D. Bioinformatics identification and gene expression analysis of TCP transcription factor family in oil palm. Mol. Plant Breed. 2022, 20, 5637–5648. [Google Scholar]
  50. Ling, L.; Zhang, W.R.; An, Y.M.; Du, B.H.; Wang, D.; Guo, C.H. Genome-wide analysis of the TCP transcription factor genes in five legume genomes and their response to salt and drought stresses. Funct. Integr. Genom. 2020, 20, 537–550. [Google Scholar] [CrossRef]
  51. Ren, L.; Wu, H.X.; Zhang, T.T.; Ge, X.Y.; Wang, T.L.; Zhou, W.Y.; Zhang, L.; Ma, D.F.; Wang, A.M. Genome-wide identification of TCP transcription factors family in sweet potato reveals significant roles of miR319-targeted TCPs in leaf anatomical morphology. Front. Plant Sci. 2021, 12, 686698. [Google Scholar] [CrossRef] [PubMed]
  52. Xiong, W.D.; Zhao, Y.R.; Gao, H.C.; Li, Y.H.; Tang, W.; Ma, L.C.; Yang, G.F.; Sun, J. Genomic characterization and expression analysis of TCP transcription factors in Setaria italica and Setaria viridis. Plant Signal. Behav. 2022, 17, 2075158. [Google Scholar] [CrossRef] [PubMed]
  53. Han, Y.X.; Hou, Z.N.; He, Q.L.; Zhang, X.M.; Yan, K.J.; Han, R.L.; Liang, Z.S. Genome-wide identification and expression analysis of TCP family genes in Catharanthus roseus. Front. Plant Sci. 2023, 14, 1161534. [Google Scholar]
  54. Li, Y.; Zhuang, F.; Zeng, J.; Yang, Z.; Li, Y.Q.; Luo, M.; Wang, Y. Identification of the histone demethylases gene family in Glycyrrhiza inflata reveals genes responding to abiotic stresses. J. Cell. Biochem. 2022, 123, 1780–1792. [Google Scholar] [CrossRef]
  55. Horton, P.; Park, K.J.; Obayashi, T.; Fujita, N.; Harada, H.; Adams-Collier, C.J.; Nakai, K. WoLF PSORT: Protein localization predictor. Nucleic Acids Res. 2007, 35, W585–W587. [Google Scholar] [CrossRef]
  56. Bailey, T.L.; Boden, M.; Buske, F.A.; Frith, M.; Grant, C.E.; Clementi, L.; Ren, J.Y.; Li, W.W.; Noble, W.S. MEME SUITE: Tools for motif discovery and searching. Nucleic Acids Res. 2009, 37, W202–W208. [Google Scholar] [CrossRef]
  57. Wang, Y.P.; Tang, H.B.; DeBarry, J.D.; Tan, X.; Li, J.P.; Wang, X.Y.; Lee, T.H.; Jin, H.Z.; Marler, B.; Guo, H.; et al. MCScanX: A toolkit for detection and evolutionary analysis of gene synteny and collinearity. Nucleic Acids Res. 2012, 40, e49. [Google Scholar] [CrossRef]
  58. Hall, B.G. Building phylogenetic trees from molecular data with MEGA. Mol. Biol. Evol. 2013, 30, 1229–1235. [Google Scholar] [CrossRef]
  59. Lescot, M.; Déhais, P.; Thijs, G.; Marchal, K.; Moreau, Y.; Peer, Y.V.; Rouzé, P.; Rombauts, S. Plant CARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences. Nucleic Acids Res. 2002, 30, 325–327. [Google Scholar] [CrossRef]
  60. Franceschini, A.; Szklarczyk, D.; Frankild, S.; Kuhn, M.; Simonovic, M.; Roth, A.; Lin, J.Y.; Minguez, P.; Bork, P.; Mering, C.V.; et al. STRING v9.1: Protein-protein interaction networks, with increased coverage and integration. Nucleic Acids Res. 2013, 41, D808–D815. [Google Scholar] [CrossRef]
  61. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C (T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  62. Zhang, G.Y.; Ding, Q.; Wei, B.Q. Identification of the PIP5K gene family in watermelon (Citrullus lanatus) and its expression analysis in male sterile floral buds. Acta Agric. Boreali-Occident. Sin. 2021, 30, 883–893. [Google Scholar]
Ijms 26 00159 g001
Figure 1. Phylogenetic relationship (A), conserved motifs (B), domains (C), and structures (D) of GiTCP genes.
Figure 1. Phylogenetic relationship (A), conserved motifs (B), domains (C), and structures (D) of GiTCP genes.
Ijms 26 00159 g001
Ijms 26 00159 g002
Figure 2. Chromosomal mapping analysis of the GiTCP gene family in G. inflata. Red lines represent the syntenic relationships of the GiTCP genes.
Figure 2. Chromosomal mapping analysis of the GiTCP gene family in G. inflata. Red lines represent the syntenic relationships of the GiTCP genes.
Ijms 26 00159 g002
Ijms 26 00159 g003
Figure 3. Phylogenetic tree analysis of the TCP gene family in G. inflata Bat, Eucommia ulmoides Oliver, Medicago sativa L., and Arabidopsis thaliana.
Figure 3. Phylogenetic tree analysis of the TCP gene family in G. inflata Bat, Eucommia ulmoides Oliver, Medicago sativa L., and Arabidopsis thaliana.
Ijms 26 00159 g003
Ijms 26 00159 g004
Figure 4. Analysis of cis-elements in the promoter region of GiTCP genes.
Figure 4. Analysis of cis-elements in the promoter region of GiTCP genes.
Ijms 26 00159 g004
Ijms 26 00159 g005
Figure 5. GiTCP protein–protein clustering interaction network diagram. (The red circles and spheres indicate licorice TCP proteins and Arabidopsis TCP proteins with which it interacts, respectively.)
Figure 5. GiTCP protein–protein clustering interaction network diagram. (The red circles and spheres indicate licorice TCP proteins and Arabidopsis TCP proteins with which it interacts, respectively.)
Ijms 26 00159 g005
Ijms 26 00159 g006
Figure 6. GO annotation of GiTCP genes in G. inflata.
Figure 6. GO annotation of GiTCP genes in G. inflata.
Ijms 26 00159 g006
Ijms 26 00159 g007
Figure 7. Changes in potted G. inflata seedlings cultured for 90 d with different time treatments (7 d, 15 d) under UV-B radiation (214 μw·m−2) and control (0 d) conditions.
Figure 7. Changes in potted G. inflata seedlings cultured for 90 d with different time treatments (7 d, 15 d) under UV-B radiation (214 μw·m−2) and control (0 d) conditions.
Ijms 26 00159 g007
Ijms 26 00159 g008
Figure 8. Subcellular localization of GiTCP8.
Figure 8. Subcellular localization of GiTCP8.
Ijms 26 00159 g008
Ijms 26 00159 g009
Figure 9. Expression of GiTCP genes based on transcriptomic analyses.
Figure 9. Expression of GiTCP genes based on transcriptomic analyses.
Ijms 26 00159 g009
Ijms 26 00159 g010
Figure 10. Expression patterns of the GiTCP gene family in response to UV-B radiation The character at the top of the error bar represents standard errors among three replicates, and different letters indicate significant differences among treatments (p < 0.05).
Figure 10. Expression patterns of the GiTCP gene family in response to UV-B radiation The character at the top of the error bar represents standard errors among three replicates, and different letters indicate significant differences among treatments (p < 0.05).
Ijms 26 00159 g010
Table 1. Analysis of physical and chemical properties of the GiTCP gene family in G. inflata.
Table 1. Analysis of physical and chemical properties of the GiTCP gene family in G. inflata.
Gene NameSequence IDAAMWpIIIAIGRAVYSL
GiTCP1Glyur000008s00001296.143348,419.66.3556.2258−0.688N,C
GiTCP2Glyur000014s00002559.142446,637.736.5655.1460−0.806N,C,CP
GiTCP3Glyur000020s00001802.142646,357.616.3957.1253−0.877N,C
GiTCP4Glyur000039s00004191.137842,805.576.4655.2346−1.098N,C
GiTCP5Glyur000050s00005694.136940,912.518.9759.1962−0.729N,C,E
GiTCP6Glyur000073s00007830.142145,416.087.4170.0258−0.769N,C
GiTCP7Glyur000175s00012061.137539,457.066.2647.7562−0.461N
GiTCP8Glyur000192s00009341.150754,268.627.2660.8258−0.736N
GiTCP9Glyur000208s00014261.135739,483.736.1766.2959−0.815N
GiTCP10Glyur000275s00017056.140644,812.159.3254.3867−0.623N,C,E
GiTCP11Glyur000278s00017293.152457,436.667.4252.2261−0.736N,CP
GiTCP12Glyur000329s00019843.142946,829.396.3341.6464−0.559N,CP,M
GiTCP13Glyur000418s00021337.137241,089.667.1353.3369−0.617N,CP
GiTCP14Glyur000513s00025388.142043,972.186.4255.3857−0.606N
GiTCP15Glyur000523s00021974.142948,570.057.3151.6157−0.943N,Pm
GiTCP16Glyur000529s00019352.138040,865.726.1553.7761−0.611N,CP,M
GiTCP17Glyur000594s00025967.149054,254.936.6858.9151−1.027N,CP
GiTCP18Glyur000643s00026942.139243,118.887.9152.4967−0.754N,C,CP
GiTCP19Glyur000658s00024843.120922,115.548.4663.3870−0.266N,C,M
GiTCP20Glyur000815s00035011.151257,147.719.4255.9257−0.972N
GiTCP21Glyur001815s00041763.137842,273.699.256.3872−0.598N,CP
GiTCP22Glyur002854s00044943.132934,959.79.0151.4766−0.751N,CP,E
GiTCP23Glyur002883s00039141.134336,224.269.7262.6173−0.334N,Pm
GiTCP24Glyur007388s00045515.125627,486.889.3854.1368−0.627N,CP,M
Note: AA, amino acid sequence length; MW, molecular weight; pI, isoelectric point; GRAVY, grand average of hydropathicity; II, instability index; AI, aliphatic index; SL, subcellular localization; N, nucleus; C, cytoplasm; CP, chloroplast; E, extracellular matrix; M, mitochondria; Pm, plasma membrane.
Table 2. Secondary structure prediction of GiTCP proteins.
Table 2. Secondary structure prediction of GiTCP proteins.
Gene NameSequence IDAlpha HelixExtended StrandBeta TurnRandom Coil
GiTCP1Glyur000008s00001296.127.25%12.24%1.85%58.66%
GiTCP2Glyur000014s00002559.119.81%11.56%3.77%64.86%
GiTCP3Glyur000020s00001802.115.49%12.44%3.99%68.08%
GiTCP4Glyur000039s00004191.133.07%8.73%2.38%55.82%
GiTCP5Glyur000050s00005694.115.18%13.28%3.25%68.29%
GiTCP6Glyur000073s00007830.120.67%11.88%4.75%62.71%
GiTCP7Glyur000175s00012061.112.53%12.80%3.47%71.02%
GiTCP8Glyur000192s00009341.119.13%10.65%3.35%66.86%
GiTCP9Glyur000208s00014261.114.85%12.32%3.08%69.75%
GiTCP10Glyur000275s00017056.118.72%13.05%5.42%62.81%
GiTCP11Glyur000278s00017293.128.05%11.64%3.63%56.68%
GiTCP12Glyur000329s00019843.122.38%14.22%3.03%60.37%
GiTCP13Glyur000418s00021337.118.82%7.80%3.49%69.89%
GiTCP14Glyur000513s00025388.122.14%11.90%3.57%62.71%
GiTCP15Glyur000523s00021974.136.60%6.76%2.33%54.31%
GiTCP16Glyur000529s00019352.114.47%11.84%3.42%70.28%
GiTCP17Glyur000594s00025967.125.21%14.17%7.5%53.12%
GiTCP18Glyur000643s00026942.113.27%13.52%4.59%68.62%
GiTCP19Glyur000658s00024843.119.62%20.57%2.87%56.94%
GiTCP20Glyur000815s00035011.120.70%15.23%4.10%59.96%
GiTCP21Glyur001815s00041763.138.89%12.70%5.29%43.12%
GiTCP22Glyur002854s00044943.123.40%8.81%6.08%61.70%
GiTCP23Glyur002883s00039141.120.41%16.62%4.66%58.31%
GiTCP24Glyur007388s00045515.125.0%16.80%3.12%55.08%
Table 3. GO classification of the annotated GiTCP genes in G. inflata.
Table 3. GO classification of the annotated GiTCP genes in G. inflata.
ClassGO TermAnnotationGiTCP Genes
MFGO:0005488BindingGiTCP1, GiTCP14, GiTCP16, GiTCP19, GiTCP23
GO:0140110Transcription regulator activityGiTCP14, GiTCP16, GiTCP19, GiTCP23, GiTCP24
CCGO:0032991Protein-containing complexGiTCP24
GO:0110165Cellular anatomical entityGiTCP14, GiTCP16, GiTCP19, GiTCP23, GiTCP24
BPGO:0000003ReproductionGiTCP14
GO:0008152Metabolic processGiTCP1, GiTCP14, GiTCP16, GiTCP19, GiTCP23, GiTCP24
GO:0009987Cellular processGiTCP1, GiTCP14, GiTCP16, GiTCP19, GiTCP23, GiTCP24
GO:0022414Reproductive processGiTCP14
GO:0032501Multicellular organismal processGiTCP14, GiTCP19, GiTCP23
GO:0032502Developmental processGiTCP14, GiTCP19, GiTCP23
GO:0048511Rhythmic processGiTCP14, GiTCP19
GO:0048519Negative regulation of biological processGiTCP23
GO:0050789Regulation of biological processGiTCP14, GiTCP16, GiTCP19, GiTCP23
GO:0050896Response to stimulusGiTCP14, GiTCP16
GO:0065007Biological regulationGiTCP14, GiTCP16, GiTCP19, GiTCP23
Table 4. qRT-PCR primer sequences.
Table 4. qRT-PCR primer sequences.
Gene NameForward Primer (5′-3′)Reverse Primer (5′-3′)
GiTCP3CAAACTCCTCGTCAACCCGACTTTGTGTGCCGGTCCTTTG
GiTCP6CCGAATTAGCCGCGAACAAGGAGCTCACGTGTCAGTTGGA
GiTCP7GCAGCGACGAGTATTCCAGACGCTGGAACTAACACTGGGT
GiTCP8TCTACCAGCCCTCTCAGCATGATCGGAATTGTCGGTGGGT
GiTCP11CGTGTCTGGCCTTTTCCGATCCCAAATGGTCTTTCCTTGCG
GiTCP12GCTCCTGTTGGGTTTGATGCAGGGTCCCCCTATGGGAAAA
GiTCP14GCGAGACGATAGAGTGGCTCCGGAGAAGGTGCTAGGGTTG
GiTCP17GGCACCACCACTCATCAAGAGCTGTTGTCACTGAGAGCCT
GiTCP22CCTGGTTTGGAACTGGGGTTGGCCATGCAATTCCACCTTG
GiTCP23TGTTCAGCTCCAACCAGCAATGGAAGAAGAGCGCGACAAT
GiTCP24TACCCTCGCGGTGAAGAAACGCGGCGATAATTGACGGTTC
β-actinCCTCATGCCATCCTTCGTCTCTTTGCAGTCTCGAGTTCTTG
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Liu, Z.; Zhao, J.; Xiao, Y.; Li, C.; Miao, R.; Chen, S.; Zhang, D.; Zhou, X.; Li, M. Comprehensive Analysis of the GiTCP Gene Family and Its Expression Under UV-B Radiation in Glycyrrhiza inflata Bat. Int. J. Mol. Sci. 2025, 26, 159. https://doi.org/10.3390/ijms26010159

AMA Style

Liu Z, Zhao J, Xiao Y, Li C, Miao R, Chen S, Zhang D, Zhou X, Li M. Comprehensive Analysis of the GiTCP Gene Family and Its Expression Under UV-B Radiation in Glycyrrhiza inflata Bat. International Journal of Molecular Sciences. 2025; 26(1):159. https://doi.org/10.3390/ijms26010159

Chicago/Turabian Style

Liu, Ziliang, Jiaang Zhao, Ying Xiao, Caijuan Li, Rong Miao, Sijin Chen, Dan Zhang, Xiangyan Zhou, and Mengfei Li. 2025. "Comprehensive Analysis of the GiTCP Gene Family and Its Expression Under UV-B Radiation in Glycyrrhiza inflata Bat" International Journal of Molecular Sciences 26, no. 1: 159. https://doi.org/10.3390/ijms26010159

APA Style

Liu, Z., Zhao, J., Xiao, Y., Li, C., Miao, R., Chen, S., Zhang, D., Zhou, X., & Li, M. (2025). Comprehensive Analysis of the GiTCP Gene Family and Its Expression Under UV-B Radiation in Glycyrrhiza inflata Bat. International Journal of Molecular Sciences, 26(1), 159. https://doi.org/10.3390/ijms26010159

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop