Delayed Tooth Development and the Impaired Differentiation of Stem/Progenitor Cells in Incisors from Type 2 Diabetes Mice
Abstract
:1. Introduction
2. Results
2.1. Delayed Development of Dentin and Enamel in T2DM Mouse Incisors
2.2. The Incisor Development Delay in db/db T2DM Mice Is Independent of the Mutation in Leptin Receptor
2.3. Transcriptomic Alteration in T2DM Mouse Incisors and the Alveoli
2.4. Downregulated Odontoblast- and Ameloblast–Progenitor Specific Genes in T2DM Mouse Incisors
2.5. Cultured DPCs from T2DM Mice Inherit Impaired Characteristics Observed In Vivo
3. Discussion
3.1. Delay of Incisor Development
The Dental Defects Cited in This Study | Authors | Causal Factors |
---|---|---|
Delayed development | Millan et al., 2008 [33] | Hypophosphatasia |
Foster et al., 2013 [35] | Hypophosphatasia | |
Khavandgar et al., 2013 [29] | Smpd3 knockout | |
Jheon et al., 2016 [31] | NOTCH1/2 signaling inhibition | |
Ye et al., 2016 [38] | Hyperlipidemia | |
Yin et al., 2017 [28] | Slc26a1 and Slc26a7 deletion | |
Zhang et al., 2018 [32] | Stat3 knockout | |
Kurotaki et al., 2020 [37] | Dyslipidemia caused by LDL receptor deficiency | |
Malik et al., 2020 [30] | Bmp7 knockout in neural crest | |
More wear | Atar et al., 2007 [39] | T2DM |
Dentin/enamel hypoplasia | Abbassy et al., 2015 [9] | T1DM |
Reduced dentin/enamel microhardness | Saghiri et al., 2022 [40] | T1DM |
Suppressed enamel formation | Chen et al., 2017 [4] | T1DM GDM |
Suppressed dentin formation | Lyu et al., 2020 [18] | T1DM GDM |
3.2. Differentially Expressed Genes (DEGs) in T2DM Incisor
3.3. Stem Cell Abnormality and Differentiation Defect of Progenitor Cells in T2DM
3.4. Tooth Development in Diabetic Patients
4. Materials and Methods
4.1. Animals
4.2. Micro-CT Analysis
4.3. RNA Isolation and qPCR
4.4. Cells and Culture Conditions
4.5. Western Blot Analysis
4.6. RNA-Sequencing (RNA-Seq) and Data Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Appendix A
Gene/Primers | Sequences | Gene/Primers | Sequences |
---|---|---|---|
mALPL-F | CCAGAAAGACACCTTGACTGTGG | mOsx-F | TTCTGCGGCAAGAGGTTCACTC |
mALPL-R | TCTTGTCCGTGTCGCTCACCAT [50] | mOsx-R | GTGTTTGCTCAGGTGGTCGCTT [51] |
mBmp2-F | AACACCGTGCGCAGCTTCCATC | mRunx2-F | CCTGAACTCTGCACCAAGTCCT |
mBmp2-R | CGGAAGATCTGGAGTTCTGCAG [52] | mRunx2-R | TCATCTGGCTCAGATAGGAGGG [53] |
mBmp4-F | GCCGAGCCAACACTGTGAGGA | mSix1-F | AGGTCAGCAACTGGTTTAAGAACC |
mBmp4-R | GATGCTGCTGAGGTTGAAGAGG [54] | mSix1-R | GAGTTGATTCTGCTTGTTGGAGG [55] |
mBmp7-F | GGAGCGATTTGACAACGAGACC | mSlc26a1-F | GATCATTGGGCTACAGGACTGC |
mBmp7-R | AGTGGTTGCTGGTGGCTGTGAT [54] | mSlc26a1-R | GAGAGATAGGTAGACACGAAGCC [56] |
mCol1a1-F | CCTCAGGGTATTGCTGGACAAC | mSlc26a7-F | CTCTCGCACAAGGATCTGCCAA |
mCol1a1-R | CAGAAGGACCTTGTTTGCCAGG [50] | mSlc26a7-R | ACAAACCAGCCGTCCTTCCCAT [56] |
mDmp1-F | AGTGAGTCATCAGAAGAAAGTCAAGC | mSmpd3-F | TCAACAGCGGTCTCTTCTTCGC |
mDmp1-R | CTATACTGGCCTCTGTCGTAGCC [57] | mSmpd3-R | CTTTGGTCCTGAGGTGTGCTTC [58] |
mKlf4-F | CTATGCAGGCTGTGGCAAAACC | mSox2-F | AACGGCAGCTACAGCATGATGC |
mKlf4-R | TTGCGGTAGTGCCTGGTCAGTT [59] | mSox2-R | CGAGCTGGTCATGGAGTTGTAC [60] |
mKlf5-F | AGCTCACCTGAGGACTCATACG | mStat3-F | AGGAGTCTAACAACGGCAGCCT |
mKlf5-R | AGAAGCTGCGTTGGCACACCAT [59] | mStat3-R | GTGGTACACCTCAGTCTCGAAG [61] |
mMafb-F | TACTGGATGGCGAGCAACTACC | mTgfb1-F | TGATACGCCTGAGTGGCTGTCT |
mMafb-R | ACTACGGAAGCCGTCGAAGCTC [62] | mTgfb1-R | CACAAGAGCAGTGAGCGCTGAA [63] |
mMsx2-F | AAGACGGAGCACCGTGGATACA | mTwist1-F | GATTCAGACCCTCAAACTGGCG |
mMsx2-R | CGGTTGGTCTTGTGTTTCCTCAG [53] | mTwist1-R | AGACGGAGAAGGCGTAGCTGAG [64] |
mNanog-F | GAACGCCTCATCAATGCCTGCA | mWnt3a-F | AACTGCACCACCGTCAGCAACA |
mNanog-R | GAATCAGGGCTGCCTTGAAGAG [60] | mWnt3a-R | AGCGTGTCACTGCGAAAGCTAC [65] |
mNes-F | AGGAGAAGCAGGGTCTACAGAG | mWnt5a-F | GGAACGAATCCACGCTAAGGGT |
mNes-R | AGTTCTCAGCCTCCAGCAGAGT [66] | mWnt5a-R | AGCACGTCTTGAGGCTACAGGA [67] |
mNotch1-F | GCTGCCTCTTTGATGGCTTCGA | mWnt6-F | TTTCCGACGCTGGAACTGCTCC |
mNotch1-R | CACATTCGGCACTGTTACAGCC [68] | mWnt6-R | CCTGACAACCACACTGTAGGAG [69] |
mNotch2-F | CCACCTGCAATGACTTCATCGG | mWnt10a-F | GCTCCTGTTCTTCCTACTGCTG |
mNotch2-R | TCGATGCAGGTGCCTCCATTCT [68] | mWnt10a-R | ATGTCAGGCACACTGTGTTGGC [69] |
mOct3/4-F | CAGCAGATCACTCACATCGCCA | mGAPDH-F | GCACAGTCAAGGCCGAGAAT |
mOct3/4-R | GCCTCATACTCTTCTCGTTGGG [70] | mGAPDH-R | GCCTTCTCCATGGTGGTGAA [71] |
References
- Federation, I.D. IDF Diabetes Atlas, 9th ed.; International Diabetes Federation: Brussels, Belgium, 2019; pp. 1–176. [Google Scholar]
- Mauri-Obradors, E.; Estrugo-Devesa, A.; Jane-Salas, E.; Vinas, M.; Lopez-Lopez, J. Oral manifestations of Diabetes Mellitus. A systematic review. Med. Oral Patol. Oral Cir. Bucal 2017, 22, e586–e594. [Google Scholar] [CrossRef] [PubMed]
- Pascon, T.; Barbosa, A.M.P.; Cordeiro, R.C.L.; Bussaneli, D.G.; Prudencio, C.B.; Nunes, S.K.; Pinheiro, F.A.; Bossolan, G.; Oliveira, L.G.; Calderon, I.M.P.; et al. Prenatal exposure to gestational diabetes mellitus increases developmental defects in the enamel of offspring. PLoS ONE 2019, 14, e0211771. [Google Scholar] [CrossRef] [PubMed]
- Chen, G.; Chen, J.; Yan, Z.; Li, Z.; Yu, M.; Guo, W.; Tian, W. Maternal diabetes modulates dental epithelial stem cells proliferation and self-renewal in offspring through apurinic/apyrimidinicendonuclease 1-mediated DNA methylation. Sci. Rep. 2017, 7, 40762. [Google Scholar] [CrossRef] [PubMed]
- Perez-Gonzalez, A.; Suarez-Quintanilla, J.A.; Otero-Rey, E.; Blanco-Carrion, A.; Gomez-Garcia, F.J.; Gandara-Vila, P.; Martin-Biedma, B.; Perez-Sayans, M. Association between xerostomia, oral and general health, and obesity in adults. A cross-sectional pilot study. Med. Oral Patol. Oral Cir. Bucal 2021, 26, e762–e769. [Google Scholar] [CrossRef] [PubMed]
- Yeh, C.K.; Harris, S.E.; Mohan, S.; Horn, D.; Fajardo, R.; Chun, Y.H.; Jorgensen, J.; Macdougall, M.; Abboud-Werner, S. Hyperglycemia and xerostomia are key determinants of tooth decay in type 1 diabetic mice. Lab. Investig. 2012, 92, 868–882. [Google Scholar] [CrossRef] [PubMed]
- Molania, T.; Alimohammadi, M.; Akha, O.; Mousavi, J.; Razvini, R.; Salehi, M. The effect of xerostomia and hyposalivation on the quality of life of patients with type II diabetes mellitus. Electron. Physician 2017, 9, 5814–5819. [Google Scholar] [CrossRef] [PubMed]
- Lima, S.M.; Grisi, D.C.; Kogawa, E.M.; Franco, O.L.; Peixoto, V.C.; Goncalves-Junior, J.F.; Arruda, M.P.; Rezende, T.M. Diabetes mellitus and inflammatory pulpal and periapical disease: A review. Int. Endod. J. 2013, 46, 700–709. [Google Scholar] [CrossRef] [PubMed]
- Abbassy, M.A.; Watari, I.; Bakry, A.S.; Hamba, H.; Hassan, A.H.; Tagami, J.; Ono, T. Diabetes detrimental effects on enamel and dentine formation. J. Dent. 2015, 43, 589–596. [Google Scholar] [CrossRef]
- Garber, S.E.; Shabahang, S.; Escher, A.P.; Torabinejad, M. The effect of hyperglycemia on pulpal healing in rats. J. Endod. 2009, 35, 60–62. [Google Scholar] [CrossRef] [PubMed]
- Horsophonphong, S.; Sritanaudomchai, H.; Nakornchai, S.; Kitkumthorn, N.; Surarit, R. Odontogenic gene expression profile of human dental pulp-derived cells under high glucose influence: A microarray analysis. J. Appl. Oral. Sci. 2021, 29, e20201074. [Google Scholar] [CrossRef]
- McIntyre, H.D.; Catalano, P.; Zhang, C.; Desoye, G.; Mathiesen, E.R.; Damm, P. Gestational diabetes mellitus. Nat. Rev. Dis. Primers 2019, 5, 47. [Google Scholar] [CrossRef] [PubMed]
- Gregory, E.C.; Ely, D.M. Trends and Characteristics in Gestational Diabetes: United States, 2016–2020. Natl. Vital Stat. Rep. 2022, 71, 1–15. [Google Scholar] [CrossRef]
- Gregory, E.C.W.; Ely, D.M. Trends and Characteristics in Prepregnancy Diabetes: United States, 2016–2021. Natl. Vital Stat. Rep. 2023, 72, 1–13. [Google Scholar] [CrossRef] [PubMed]
- Tolomeu, J.S.O.; Soares, M.E.C.; Mourao, P.S.; Ramos-Jorge, M.L. Is gestational diabetes mellitus associated with developmental defects of enamel in children? A systematic review with meta-analysis. Arch. Oral Biol. 2022, 141, 105488. [Google Scholar] [CrossRef] [PubMed]
- Gutowska, I.; Baranowska-Bosiacka, I.; Rybicka, M.; Nocen, I.; Dudzinska, W.; Marchlewicz, M.; Wiszniewska, B.; Chlubek, D. Changes in the concentration of microelements in the teeth of rats in the final stage of type 1 diabetes, with an absolute lack of insulin. Biol. Trace Elem. Res. 2011, 139, 332–340. [Google Scholar] [CrossRef] [PubMed]
- Chen, G.; Sun, W.; Liang, Y.; Chen, T.; Guo, W.; Tian, W. Maternal diabetes modulates offspring cell proliferation and apoptosis during odontogenesis via the TLR4/NF-kappaB signalling pathway. Cell Prolif. 2017, 50, e12324. [Google Scholar] [CrossRef]
- Lyu, Y.; Jia, S.; Wang, S.; Wang, T.; Tian, W.; Chen, G. Gestational diabetes mellitus affects odontoblastic differentiation of dental papilla cells via Toll-like receptor 4 signaling in offspring. J. Cell. Physiol. 2020, 235, 3519–3528. [Google Scholar] [CrossRef]
- Coleman, D.L. Obese and diabetes: Two mutant genes causing diabetes-obesity syndromes in mice. Diabetologia 1978, 14, 141–148. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Lai, F.; Hou, Y.; Zheng, R. Leptin signaling and leptin resistance. Med. Rev. 2022, 2, 363–384. [Google Scholar] [CrossRef]
- Ahima, R.S.; Osei, S.Y. Leptin signaling. Physiol. Behav. 2004, 81, 223–241. [Google Scholar] [CrossRef]
- Obradovic, M.; Sudar-Milovanovic, E.; Soskic, S.; Essack, M.; Arya, S.; Stewart, A.J.; Gojobori, T.; Isenovic, E.R. Leptin and Obesity: Role and Clinical Implication. Front. Endocrinol. 2021, 12, 585887. [Google Scholar] [CrossRef] [PubMed]
- Oh, J.; Kim, J.Y.; Kim, H.S.; Oh, J.C.; Cheon, Y.H.; Park, J.; Yoon, K.H.; Lee, M.S.; Youn, B.S. Progranulin and a five transmembrane domain-containing receptor-like gene are the key components in receptor activator of nuclear factor kappaB (RANK)-dependent formation of multinucleated osteoclasts. J. Biol. Chem. 2015, 290, 2042–2052. [Google Scholar] [CrossRef] [PubMed]
- Perry, B.D.; Caldow, M.K.; Brennan-Speranza, T.C.; Sbaraglia, M.; Jerums, G.; Garnham, A.; Wong, C.; Levinger, P.; Asrar Ul Haq, M.; Hare, D.L.; et al. Muscle atrophy in patients with Type 2 Diabetes Mellitus: Roles of inflammatory pathways, physical activity and exercise. Exerc. Immunol. Rev. 2016, 22, 94–109. [Google Scholar]
- Shen, Y.; Li, M.; Wang, K.; Qi, G.; Liu, H.; Wang, W.; Ji, Y.; Chang, M.; Deng, C.; Xu, F.; et al. Diabetic Muscular Atrophy: Molecular Mechanisms and Promising Therapies. Front. Endocrinol. 2022, 13, 917113. [Google Scholar] [CrossRef]
- Krivanek, J.; Soldatov, R.A.; Kastriti, M.E.; Chontorotzea, T.; Herdina, A.N.; Petersen, J.; Szarowska, B.; Landova, M.; Matejova, V.K.; Holla, L.I.; et al. Dental cell type atlas reveals stem and differentiated cell types in mouse and human teeth. Nat. Commun. 2020, 11, 4816. [Google Scholar] [CrossRef] [PubMed]
- Hermans, F.; Bueds, C.; Hemeryck, L.; Lambrichts, I.; Bronckaers, A.; Vankelecom, H. Establishment of inclusive single-cell transcriptome atlases from mouse and human tooth as powerful resource for dental research. Front. Cell Dev. Biol. 2022, 10, 1021459. [Google Scholar] [CrossRef] [PubMed]
- Yin, K.; Guo, J.; Lin, W.; Robertson, S.Y.T.; Soleimani, M.; Paine, M.L. Deletion of Slc26a1 and Slc26a7 Delays Enamel Mineralization in Mice. Front. Physiol. 2017, 8, 307. [Google Scholar] [CrossRef] [PubMed]
- Khavandgar, Z.; Alebrahim, S.; Eimar, H.; Tamimi, F.; McKee, M.D.; Murshed, M. Local regulation of tooth mineralization by sphingomyelin phosphodiesterase 3. J. Dent. Res. 2013, 92, 358–364. [Google Scholar] [CrossRef]
- Malik, Z.; Roth, D.M.; Eaton, F.; Theodor, J.M.; Graf, D. Mesenchymal Bmp7 Controls Onset of Tooth Mineralization: A Novel Way to Regulate Molar Cusp Shape. Front. Physiol. 2020, 11, 698. [Google Scholar] [CrossRef] [PubMed]
- Jheon, A.H.; Prochazkova, M.; Meng, B.; Wen, T.; Lim, Y.J.; Naveau, A.; Espinoza, R.; Cox, T.C.; Sone, E.D.; Ganss, B.; et al. Inhibition of Notch Signaling During Mouse Incisor Renewal Leads to Enamel Defects. J. Bone Miner. Res. 2016, 31, 152–162. [Google Scholar] [CrossRef] [PubMed]
- Zhang, B.; Meng, B.; Viloria, E.; Naveau, A.; Ganss, B.; Jheon, A.H. The Role of Epithelial Stat3 in Amelogenesis during Mouse Incisor Renewal. Cells Tissues Organs 2018, 205, 63–71. [Google Scholar] [CrossRef]
- Millan, J.L.; Narisawa, S.; Lemire, I.; Loisel, T.P.; Boileau, G.; Leonard, P.; Gramatikova, S.; Terkeltaub, R.; Camacho, N.P.; McKee, M.D.; et al. Enzyme replacement therapy for murine hypophosphatasia. J. Bone Miner. Res. 2008, 23, 777–787. [Google Scholar] [CrossRef]
- McKee, M.D.; Nakano, Y.; Masica, D.L.; Gray, J.J.; Lemire, I.; Heft, R.; Whyte, M.P.; Crine, P.; Millan, J.L. Enzyme replacement therapy prevents dental defects in a model of hypophosphatasia. J. Dent. Res. 2011, 90, 470–476. [Google Scholar] [CrossRef]
- Foster, B.L.; Nagatomo, K.J.; Tso, H.W.; Tran, A.B.; Nociti, F.H., Jr.; Narisawa, S.; Yadav, M.C.; McKee, M.D.; Millan, J.I.; Somerman, M.J. Tooth root dentin mineralization defects in a mouse model of hypophosphatasia. J. Bone Miner. Res. 2013, 28, 271–282. [Google Scholar] [CrossRef] [PubMed]
- Foster, B.L.; Kuss, P.; Yadav, M.C.; Kolli, T.N.; Narisawa, S.; Lukashova, L.; Cory, E.; Sah, R.L.; Somerman, M.J.; Millan, J.L. Conditional Alpl Ablation Phenocopies Dental Defects of Hypophosphatasia. J. Dent. Res. 2017, 96, 81–91. [Google Scholar] [CrossRef] [PubMed]
- Kurotaki, Y.; Sakai, N.; Miyazaki, T.; Hosonuma, M.; Sato, Y.; Karakawa, A.; Chatani, M.; Myers, M.; Suzawa, T.; Negishi-Koga, T.; et al. Effects of lipid metabolism on mouse incisor dentinogenesis. Sci. Rep. 2020, 10, 5102. [Google Scholar] [CrossRef]
- Ye, X.; Zhang, J.; Yang, P. Hyperlipidemia induced by high-fat diet enhances dentin formation and delays dentin mineralization in mouse incisor. J. Mol. Histol. 2016, 47, 467–474. [Google Scholar] [CrossRef] [PubMed]
- Atar, M.; Davis, G.R.; Verry, P.; Wong, F.S. Enamel mineral concentration in diabetic rodents. Eur. Arch. Paediatr. Dent. 2007, 8, 195–200. [Google Scholar] [CrossRef]
- Saghiri, M.A.; Sheibani, N.; Kawai, T.; Nath, D.; Dadvand, S.; Amini, S.B.; Vakhnovetsky, J.; Morgano, S.M. Diabetes negatively affects tooth enamel and dentine microhardness: An in-vivo study. Arch. Oral Biol. 2022, 139, 105434. [Google Scholar] [CrossRef] [PubMed]
- Merz, M.P.; Seal, S.V.; Grova, N.; Meriaux, S.; Guebels, P.; Kanli, G.; Mommaerts, E.; Nicot, N.; Kaoma, T.; Keunen, O.; et al. Early-life influenza A (H1N1) infection independently programs brain connectivity, HPA AXIS and tissue-specific gene expression profiles. Sci. Rep. 2024, 14, 5898. [Google Scholar] [CrossRef] [PubMed]
- Xiao, Y.; Wang, W.; Chen, L.; Chen, J.; Jiang, P.; Fu, X.; Nie, X.; Kwan, H.; Liu, Y.; Zhao, X. The effects of short-term high-fat feeding on exercise capacity: Multi-tissue transcriptome changes by RNA sequencing analysis. Lipids Health Dis. 2017, 16, 28. [Google Scholar] [CrossRef] [PubMed]
- Garcia, T.M.; van Roest, M.; Vermeulen, J.L.M.; Meisner, S.; Smit, W.L.; Silva, J.; Koelink, P.J.; Koster, J.; Faller, W.J.; Wildenberg, M.E.; et al. Early Life Antibiotics Influence In Vivo and In Vitro Mouse Intestinal Epithelium Maturation and Functioning. Cell. Mol. Gastroenterol. Hepatol. 2021, 12, 943–981. [Google Scholar] [CrossRef]
- Ateeq, H.; Zia, A.; Husain, Q.; Khan, M.S.; Ahmad, M. Effect of inflammation on bones in diabetic patients with periodontitis via RANKL/OPG system-A review. J. Diabetes Metab. Disord. 2022, 21, 1003–1009. [Google Scholar] [CrossRef]
- Xu, J.; Zuo, C. The Fate Status of Stem Cells in Diabetes and its Role in the Occurrence of Diabetic Complications. Front. Mol. Biosci. 2021, 8, 745035. [Google Scholar] [CrossRef]
- Deng, X.; Xu, M.; Shen, M.; Cheng, J. Effects of Type 2 Diabetic Serum on Proliferation and Osteogenic Differentiation of Mesenchymal Stem Cells. J. Diabetes Res. 2018, 2018, 5765478. [Google Scholar] [CrossRef] [PubMed]
- Bhate, K.; Kharat, A.; Kheur, S.; Sanap, A.; Bhonde, R.; Gopalakrishnan, D. Compromised Differentiation Potential of Diabetic Dental Pulp Stem Cells. J. Health Allied Sci. NU 2024. [Google Scholar] [CrossRef]
- Matsumura, S.; Quispe-Salcedo, A.; Schiller, C.M.; Shin, J.S.; Locke, B.M.; Yakar, S.; Shimizu, E. IGF-1 Mediates EphrinB1 Activation in Regulating Tertiary Dentin Formation. J. Dent. Res. 2017, 96, 1153–1161. [Google Scholar] [CrossRef]
- Lorthongpanich, C.; Charoenwongpaiboon, T.; Supakun, P.; Klaewkla, M.; Kheolamai, P.; Issaragrisil, S. Fisetin Inhibits Osteogenic Differentiation of Mesenchymal Stem Cells via the Inhibition of YAP. Antioxidants 2021, 10, 879. [Google Scholar] [CrossRef] [PubMed]
- Sterner, R.M.; Kremer, K.N.; Dudakovic, A.; Westendorf, J.J.; van Wijnen, A.J.; Hedin, K.E. Tissue-Nonspecific Alkaline Phosphatase Is Required for MC3T3 Osteoblast-Mediated Protection of Acute Myeloid Leukemia Cells from Apoptosis. J. Immunol. 2018, 201, 1086–1096. [Google Scholar] [CrossRef] [PubMed]
- Yang, S.; Guo, S.; Tong, S.; Sun, X. Exosomal miR-130a-3p regulates osteogenic differentiation of Human Adipose-Derived stem cells through mediating SIRT7/Wnt/beta-catenin axis. Cell Prolif. 2020, 53, e12890. [Google Scholar] [CrossRef]
- Liu, C.; Ma, N.; Sun, C.; Shen, X.; Li, J.; Wang, C. The effect of magnesium ions synergistic with mineralized collagen on osteogenesis/angiogenesis properties by modulating macrophage polarizationin vitroandin vivo. Biomed. Mater. 2024, 19, 035028. [Google Scholar] [CrossRef]
- Pan, J.X.; Sun, D.; Lee, D.; Xiong, L.; Ren, X.; Guo, H.H.; Yao, L.L.; Lu, Y.; Jung, C.; Xiong, W.C. Osteoblastic Swedish mutant APP expedites brain deficits by inducing endoplasmic reticulum stress-driven senescence. Commun. Biol. 2021, 4, 1326. [Google Scholar] [CrossRef] [PubMed]
- Karagiannis, G.S.; Afaloniati, H.; Karamanavi, E.; Poutahidis, T.; Angelopoulou, K. BMP pathway suppression is an early event in inflammation-driven colon neoplasmatogenesis of uPA-deficient mice. Tumour Biol. 2016, 37, 2243–2255. [Google Scholar] [CrossRef] [PubMed]
- Chang, F.; Li, J.; Sun, Q.; Wei, S.; Song, Y. Hsa_circ_0017639 regulates cisplatin resistance and tumor growth via acting as a miR-1296-5p molecular sponge and modulating sine oculis homeobox 1 expression in non-small cell lung cancer. Bioengineered 2022, 13, 8806–8822. [Google Scholar] [CrossRef] [PubMed]
- Ma, Q.; Grigorescu, M.; Schreiber, A.; Kettritz, R.; Lindenmeyer, M.; Anders, H.J.; Steiger, S. Genetic Background but Not Intestinal Microbiota After Co-Housing Determines Hyperoxaluria-Related Nephrocalcinosis in Common Inbred Mouse Strains. Front. Immunol. 2021, 12, 673423. [Google Scholar] [CrossRef]
- Chen, K.; Li, X.; Li, N.; Dong, H.; Zhang, Y.; Yoshizawa, M.; Kagami, H. Spontaneously Formed Spheroids from Mouse Compact Bone-Derived Cells Retain Highly Potent Stem Cells with Enhanced Differentiation Capability. Stem Cells Int. 2019, 2019, 8469012. [Google Scholar] [CrossRef]
- Lee, S.J.; Jung, D.K.; Im, S.; You, C.; Kim, J.E.; Bae, J.S.; Kim, M.S.; Yea, K.; Park, E.K. Ank-mediated pyrophosphate regulates shear stress-induced small extracellular vesicle production in 3D-cultured osteocytes. Anim. Cells Syst. 2024, 28, 495–505. [Google Scholar] [CrossRef] [PubMed]
- Edupuganti, R.R.; Harikumar, A.; Aaronson, Y.; Biran, A.; Sailaja, B.S.; Nissim-Rafinia, M.; Azad, G.K.; Cohen, M.A.; Park, J.E.; Shivalila, C.S.; et al. Alternative SET/TAFI Promoters Regulate Embryonic Stem Cell Differentiation. Stem Cell Rep. 2017, 9, 1291–1303. [Google Scholar] [CrossRef] [PubMed]
- Hu, H.; Luo, S.J.; Cao, Z.R.; Wu, Y.; Mo, Z.; Wang, Y.; Yu, L.; Chen, Y.; Xu, L.; Zhang, S.J. Depressive Disorder promotes Hepatocellular Carcinoma metastasis via upregulation of ABCG2 gene expression and maintenance of self-renewal. J. Cancer 2020, 11, 5309–5317. [Google Scholar] [CrossRef]
- Lin, H.H.; Wu, Y.S.; Jian, T.Y.; Liao, J.Y.; Chang, M.T.; Shyur, L.F.; Lin, Y.L. Phytogalactolipids activate humoral immunity against colorectal cancer. J. Exp. Clin. Cancer Res. 2023, 42, 95. [Google Scholar] [CrossRef] [PubMed]
- Roche, V.; Sandoval, V.; Wolford, C.; Senders, Z.; Kim, J.A.; Ribeiro, S.P.; Huang, A.Y.; Sekaly, R.P.; Lyons, J.; Zhang, M. Carbohydrate ligand engagement with CD11b enhances differentiation of tumor-associated myeloid cells for immunotherapy of solid cancers. J. Immunother. Cancer 2023, 11, e006205. [Google Scholar] [CrossRef] [PubMed]
- Nguyen, H.P.; Lin, F.; Yi, D.; Xie, Y.; Dinh, J.; Xue, P.; Sul, H.S. Aging-dependent regulatory cells emerge in subcutaneous fat to inhibit adipogenesis. Dev. Cell 2021, 56, 1437–1451.e3. [Google Scholar] [CrossRef]
- Kremer, K.N.; Dudakovic, A.; Hess, A.D.; Smith, B.D.; Karp, J.E.; Kaufmann, S.H.; Westendorf, J.J.; van Wijnen, A.J.; Hedin, K.E. Histone Deacetylase Inhibitors Target the Leukemic Microenvironment by Enhancing a Nherf1-Protein Phosphatase 1alpha-TAZ Signaling Pathway in Osteoblasts. J. Biol. Chem. 2015, 290, 29478–29492. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Feng, W.; Peng, C.; Chen, S.; Ji, H.; Zhong, H.; Ge, W.; Zhang, Y. Targeting RNA helicase DHX33 blocks Ras-driven lung tumorigenesis in vivo. Cancer Sci. 2020, 111, 3564–3575. [Google Scholar] [CrossRef]
- Cao, L.; Huang, M.Z.; Zhang, Q.; Luo, Z.R.; Zhang, Y.; An, P.J.; Yang, L.L.; Tan, W.; Wang, C.Q.; Dou, X.W.; et al. The neural stem cell properties of Pkd2l1(+) cerebrospinal fluid-contacting neurons in vivo. Front. Cell. Neurosci. 2022, 16, 992520. [Google Scholar] [CrossRef] [PubMed]
- Fan, H.; Wang, Y.; Han, M.; Wang, L.; Li, X.; Kuang, X.; Du, J.; Peng, F. Multi-omics-based investigation of Bifidobacterium’s inhibitory effect on glioma: Regulation of tumor and gut microbiota, and MEK/ERK cascade. Front. Microbiol. 2024, 15, 1344284. [Google Scholar] [CrossRef]
- Yin, H.; Frontini, M.J.; Arpino, J.M.; Nong, Z.; O’Neil, C.; Xu, Y.; Balint, B.; Ward, A.D.; Chakrabarti, S.; Ellis, C.G.; et al. Fibroblast Growth Factor 9 Imparts Hierarchy and Vasoreactivity to the Microcirculation of Renal Tumors and Suppresses Metastases. J. Biol. Chem. 2015, 290, 22127–22142. [Google Scholar] [CrossRef] [PubMed]
- Duan, R.S.; Liu, P.P.; Xi, F.; Wang, W.H.; Tang, G.B.; Wang, R.Y.; Saijilafu; Liu, C.M. Wnt3 and Gata4 regulate axon regeneration in adult mouse DRG neurons. Biochem. Biophys. Res. Commun. 2018, 499, 246–252. [Google Scholar] [CrossRef]
- Najjar, F.; Milbauer, L.; Wei, C.W.; Lerdall, T.; Wei, L.N. Modelling Functional Thyroid Follicular Structures Using P19 Embryonal Carcinoma Cells. Cells 2024, 13, 1844. [Google Scholar] [CrossRef] [PubMed]
- Verschoor, C.P.; Dorrington, M.G.; Novakowski, K.E.; Kaiser, J.; Radford, K.; Nair, P.; Anipindi, V.; Kaushic, C.; Surette, M.G.; Bowdish, D.M. MicroRNA-155 is required for clearance of Streptococcus pneumoniae from the nasopharynx. Infect. Immun. 2014, 82, 4824–4833. [Google Scholar] [CrossRef] [PubMed]
Control a | T2DM a | p-Value b | % Change | |
---|---|---|---|---|
Apical side | ||||
Dentin volume | 0.8285 (0.0694) | 0.5858 (0.0146) | 0.0131 | −29.3 |
Dentin density | 1.4582 (0.0267) | 1.4536 (0.0342) | 0.9172 | −0.3 |
Enamel volume | 0.2729 (0.0119) | 0.1208 (0.0207) | <0.0001 | −55.7 |
Enamel density | 2.0432 (0.1115) | 1.6294 (0.0979) | 0.0138 | −20.3 |
Pulp volume | 0.5517 (0.0331) | 0.5523 (0.0437) | 0.7311 | 0.1 |
Tip side | ||||
Dentin volume | 1.4266 (0.2062) | 1.4964 (0.1351) | 0.3920 | 4.8 |
Dentin density | 1.4544 (0.0554) | 1.4064 (0.0907) | 0.1797 | −3.3 |
Enamel volume | 0.2929 (0.0364) | 0.2826 (0.0212) | 0.4501 | −3.5 |
Enamel density | 2.7739 (0.1144) | 2.5938 (0.1215) | 0.0003 | −6.5 |
Pulp volume | 0.0943 (0.0567) | 0.1041 (0.0614) | 0.7301 | 10.3 |
Control a | DIO a | p-Value b | % Change | |
---|---|---|---|---|
Total c | ||||
Dentin volume | 1.2434 (0.1745) | 0.9024 (0.1098) | 0.0082 | −27.6 |
Dentin density | 1.4771 (0.0445) | 1.3644 (0.0253) | 0.0023 | −7.6 |
Enamel volume | 0.2460 (0.0462) | 0.1577 (0.0201) | 0.0094 | −35.9 |
Enamel density | 2.0830 (0.0485) | 1.9131 (0.0361) | 0.0003 | −8.1 |
Apical region d | ||||
Dentin density | 1.3264 (0.0706) | 1.1555 (0.0347) | 0.0031 | −12.9 |
Enamel density | 1.8814 (0.1039) | 1.5038 (0.1055) | 0.0005 | −20.1 |
Gene ID | Base Mean | Log2 FoldChange | Adjusted p-Value | Description |
---|---|---|---|---|
Gm10715 | 1260.3 | 11.8 | 2.72 × 10−40 | predicted to encode protein with 5 TM domains |
Gm10720 | 1146.9 | 11.3 | 3.69 × 10−48 | predicted to encode protein with 5 TM domains |
Gm17535 | 756.6 | 11.1 | 8.11 × 10−36 | predicted to encode protein with 5 TM domains |
Gm11168 | 8573.9 | 10.8 | <1.00 × 10−100 | predicted to encode protein with 5 TM domains |
Gm37985 | 215.0 | 10.8 | 6.22 × 10−18 | lncRNA predicted to target Hif3a, a protein reguling adaptive responses to hypoxia |
Gm10800 | 1,357,771.3 | 10.7 | <1.00 × 10−100 | predicted to encode protein with 5 TM domains |
Gm21738 | 153,254.1 | 10.6 | <1.00 × 10−100 | predicted to encode protein with 5 TM domains |
Gm26870 | 223,896.6 | 10.6 | <1.00 × 10−100 | lncRNA related to osteoclast function |
Gm10801 | 149,821.0 | 10.6 | <1.00 × 10−100 | predicted to encode protein with 5 TM domains |
Gm10717 | 16,702.3 | 10.6 | <1.00 × 10−100 | predicted to encode protein with 5 TM domains |
AW822073 | 90.7 | 10.5 | 1.23 × 10−16 | predicted DNA-binding transcription factor |
Gm10722 | 27,085.4 | 10.5 | <1.00 × 10−100 | predicted to encode protein with 5 TM domains |
Gm10718 | 15,183.5 | 10.4 | <1.00 × 10−100 | predicted to encode protein with 5 TM domains |
Gm10721 | 721.8 | 10.3 | 1.61 × 10−49 | predicted to encode protein with 5 TM domains |
Gm10719 | 5665.1 | 10.3 | <1.00 × 10−100 | predicted to encode protein with 5 TM domains |
H2-Ea-ps | 72.4 | 10.2 | 1.46 × 10−15 | pseudogene of an MHC class II antigen |
Apob | 58.3 | 9.8 | 9.74 × 10−15 | apolipoprotein B |
Scn10a | 55.3 | 9.8 | 1.22 × 10−14 | voltage-gated sodium channel subunit (NaV1.8) |
Slc6a5 | 52.8 | 9.7 | 2.22 × 10−14 | sodium- and chloride-dependent glycine transporter |
Scn9a | 52.5 | 9.7 | 2.19 × 10−14 | voltage-gated sodium channel subunit (NaV1.7) |
Duxf3 | 99.3 | 9.7 | 1.83 × 10−14 | double homeobox family member 3 |
Muc5ac | 92.7 | 9.6 | 9.41 × 10−14 | mucin 5AC |
BC048546 | 47.4 | 9.6 | 1.02 × 10−13 | ovostatin homolog |
Gm29154 | 47.1 | 9.5 | 1.12 × 10−13 | ncRNA |
Abca17 | 45.2 | 9.5 | 1.22 × 10−13 | ATP-binding cassette, subfamily A (ABC1), member 17 |
Mroh2b | 45.2 | 9.5 | 1.48 × 10−13 | maestro heat-like repeat-containing protein, may relate to sperm capacitation |
Spag17 | 44.1 | 9.5 | 1.14 × 10−13 | sperm associated antigen 17 |
Gm4981 | 42.6 | 9.4 | 1.79 × 10−13 | predicted DNA-binding transcription factor |
Dcdc2a | 42.1 | 9.4 | 1.99 × 10−13 | doublecortin domain-containing protein involved in neuronal migration |
Slc7a14 | 39.7 | 9.3 | 5.23 × 10−13 | solute carrier family involved in amino acid transport |
Gene ID | Base Mean | Log2 FoldChange | Adjusted p-Value | Description |
---|---|---|---|---|
Nlrp1c-ps | 30.57 | −7.85 | 2.26 × 10−9 | pseudogene related to the nod-like receptor (NLR) family |
mt-Tg | 15.74 | −6.90 | 2.3 × 10−7 | mitochondrial tRNA for glycine |
6820402A03Rik | 10.93 | −6.37 | 3.81 × 10−6 | RIKEN cDNA |
RP24-286J14.3 | 10.35 | −6.29 | 4.27 × 10−6 | predicted gene |
RP24-286J14.2 | 7.97 | −5.91 | 2.61 × 10−5 | predicted gene |
AI506816 | 177.06 | −4.40 | 1.30 × 10−40 | lncRNA related to wounding. Also expressed in embryo |
Mybpc2 | 9455.72 | −4.11 | <1.00 × 10−100 | myosin Binding Protein C2 * |
9930111J21Rik2 | 35.86 | −3.98 | 6.37 × 10−11 | Interferon-gamma-inducible GTPase |
Actn3 | 5074.53 | −3.97 | <1.00 × 10−100 | alpha-actinin-3 * |
Myh4 | 39,961.13 | −3.77 | 6.64 × 10−9 | myosin Heavy Chain 4 * |
RP23-33N12.2 | 18.04 | −3.57 | 2.83 × 10−6 | predicted gene |
Gm22513 | 42.81 | −3.55 | 2.23 × 10−12 | snRNA |
Nat8l | 950.59 | −3.32 | 4.38 × 10−37 | N-acetyltransferases, involved in cell adhesion |
5830417I10Rik | 95.85 | −3.32 | 7.80 × 10−23 | gon-4-like pseudogene, predicted to be a transcription factor |
Dupd1 | 184.54 | −3.12 | 4.34 × 10−27 | phosphatase involved in protein dephosphorylation and MAPK inhibition |
Scn1b | 1723.75 | −3.11 | 4.27 × 10−75 | voltage-gated sodium channel * |
Ankrd23 | 1137.36 | −3.07 | 1.79 × 10−51 | transcriptional regulator * |
Hfe2 | 1437.16 | −3.05 | 2.85 × 10−78 | hemojuvelin, involved in iron metabolism and regulation of hepcidin expression |
Mir6236 | 387.09 | −3.02 | 6.56 × 10−31 | microRNA, potentiates adipocyte insulin signaling |
Jph2 | 1343.26 | −3.00 | 8.79 × 10−82 | junctophilin-2, a membrane protein essential for cardiac myocytes * |
Tmem267 | 8.61 | −2.98 | 3.17 × 10−3 | possible oncogene encoding a transmembrane protein |
Smtnl2 | 1171.51 | −2.98 | 3.58 × 10−61 | smoothelin-like 2, a protein involved in actin cytoskeleton organization |
Mylk2 | 1573.04 | −2.98 | 6.04 × 10−85 | myosin Light Chain Kinase 2 * |
Mir1247 | 8.56 | −2.96 | 5.12 × 10−3 | microRNA involved in post-transcriptional regulation of SOX93 in cartilage |
Pygm | 9862.36 | −2.84 | 4.20 × 10−73 | myophosphorylase, an enzyme that breaks down glycogen * |
Aldoa | 26,984.31 | −2.76 | 5.82 × 10−59 | aldolase A, a glycolytic enzyme that convert F1,6BP to G3P and DHAP |
Kcna7 | 345.70 | −2.75 | 2.90 × 10−45 | voltage-gated potassium channel subunit * |
Gm12953 | 17.46 | −2.75 | 5.15 × 10−5 | predicted gene |
Jsrp1 | 519.53 | −2.72 | 2.09 × 10−45 | Junctional Sarcoplasmic Reticulum Protein 1 * |
Ky | 861.07 | −2.68 | 2.24 × 10−45 | kyphoscoliosis peptidase * |
Gene ID | Base Mean | Log2 Fold Change | Adjusted p-Value | Gene ID | Base Mean | Log2 Fold Change | Adjusted p-Value |
---|---|---|---|---|---|---|---|
Bex1 | 24.7 | −0.5 | 2.77 × 10−1 | Syt6 | 140.0 | −0.2 | 4.91 × 10−1 |
Sox2 | 39.7 | −0.8 | 8.90 × 10−2 | Igfbp5 | 8221.2 | −0.8 | 1.14 × 10−6 |
Six1 | 466.7 | −1.7 | 5.17 × 10−24 | Tnc | 6862.4 | −0.7 | 3.72 × 10−5 |
Lrig1 | 476.3 | −1.3 | 3.60 × 10−16 | Postn | 15,375.8 | 2.2 | 3.35 × 10−39 |
Etv4 | 55.2 | 0.4 | 2.60 × 10−1 | Twist2 | 48.4 | −1.0 | 4.86 × 10−3 |
Moxd1 | 189.7 | −0.3 | 1.53 × 10−1 | Moxd1 | 189.7 | −0.3 | 1.53 × 10−1 |
Ell2 | 320.1 | −0.2 | 3.18 × 10−1 | Wisp1 | 1364.8 | 0.3 | 9.93 × 10−2 |
Satb2 | 1471.5 | −0.6 | 1.22 × 10−3 | Ifitm5 | 46.3 | 0.3 | 4.70 × 10−1 |
Sox21 | 120.9 | −1.1 | 6.37 × 10−4 | Etv4 | 55.2 | 0.4 | 2.60 × 10−1 |
Mafb | 1045.6 | −1.8 | 3.08 × 10−13 | Wif1 | 1095.4 | 0.3 | 6.31 × 10−2 |
Foxq1 | 259.8 | −2.5 | 1.48 × 10−23 | Gsc | 23.4 | −0.6 | 1.77 × 10−1 |
Foxo1 | 562.4 | −0.8 | 5.59 × 10−5 | Alx3 | 194.0 | −1.1 | 3.40 × 10−6 |
Cdkn2b | 134.4 | −0.9 | 8.14 × 10−5 | Tgfbr2 | 1386.9 | −0.9 | 8.39 × 10−9 |
Runx2 | 1355.1 | −0.6 | 5.75 × 10−4 | Klf4 | 449.3 | −1.0 | 3.35 × 10−5 |
Klf5 | 268.6 | −1.7 | 1.94 × 10−3 | Bmp4 | 227.1 | −1.0 | 2.63 × 10−7 |
Prdm1 | 201.7 | −0.6 | 5.28 × 10−3 | Msx2 | 269.8 | −1.1 | 2.02 × 10−8 |
Gm17660 | 345.4 | −1.3 | 5.28 × 10−11 | Fam20a | 549.4 | −1.3 | 3.60 × 10−12 |
Enam | 2062.8 | 0.8 | 4.22 × 10−1 | Wnt10a | 272.4 | −1.5 | 8.96 × 10−14 |
Klk4 | 194.0 | 0.4 | 7.64 × 10−1 | Dkk1 | 71.2 | 0.9 | 4.41 × 10−3 |
Odam | 4713.5 | 0.8 | 5.76 × 10−7 | Fgf10 | 27.7 | 1.6 | 6.79 × 10−4 |
Amelx | 6204.2 | 0.1 | 7.56 × 10−1 | Wnt6 | 146.8 | −1.1 | 1.40 × 10−5 |
Ambn | 13,259.4 | 0.1 | 5.33 × 10−1 | Col1a1 | 256,336.4 | −1.6 | 3.94 × 10−21 |
Mmp20 | 595.9 | 0.8 | 2.50 × 10−1 | Sall1 | 58.6 | 0.7 | 2.58 × 10−2 |
Dmp1 | 1683.6 | −0.1 | 4.74 × 10−1 | ||||
Dspp | 12,986.9 | 0.3 | 9.59 × 10−2 | ||||
Notum | 46.8 | 0.6 | 1.74 × 10−1 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kobayashi, Y.; Huang, J.; Barnett, B.K.; Falcon, C.Y.; Falcon, P.A.; Hirschberg, C.S.; Fine, D.H.; Ye, Y.; Shimizu, E. Delayed Tooth Development and the Impaired Differentiation of Stem/Progenitor Cells in Incisors from Type 2 Diabetes Mice. Int. J. Mol. Sci. 2024, 25, 13619. https://doi.org/10.3390/ijms252413619
Kobayashi Y, Huang J, Barnett BK, Falcon CY, Falcon PA, Hirschberg CS, Fine DH, Ye Y, Shimizu E. Delayed Tooth Development and the Impaired Differentiation of Stem/Progenitor Cells in Incisors from Type 2 Diabetes Mice. International Journal of Molecular Sciences. 2024; 25(24):13619. https://doi.org/10.3390/ijms252413619
Chicago/Turabian StyleKobayashi, Yoshifumi, Jia Huang, Brandon K. Barnett, Carla Y. Falcon, Paul A. Falcon, Craig S. Hirschberg, Daniel H. Fine, Yi Ye, and Emi Shimizu. 2024. "Delayed Tooth Development and the Impaired Differentiation of Stem/Progenitor Cells in Incisors from Type 2 Diabetes Mice" International Journal of Molecular Sciences 25, no. 24: 13619. https://doi.org/10.3390/ijms252413619
APA StyleKobayashi, Y., Huang, J., Barnett, B. K., Falcon, C. Y., Falcon, P. A., Hirschberg, C. S., Fine, D. H., Ye, Y., & Shimizu, E. (2024). Delayed Tooth Development and the Impaired Differentiation of Stem/Progenitor Cells in Incisors from Type 2 Diabetes Mice. International Journal of Molecular Sciences, 25(24), 13619. https://doi.org/10.3390/ijms252413619