Comprehensive Analysis of Methylome and Transcriptome to Identify Potential Genes Regulating Porcine Testis Development
Abstract
1. Introduction
2. Results
2.1. DNA Methylation Pattern in Porcine Testicular Tissue
2.2. Identification of DMRs
2.3. Functional Enrichment Analysis of DMGs
2.4. Association Analysis of DNA Methylation with Differentially Expressed Genes (DEGs)
2.5. Enrichment of Key Pathways of DMGs Negatively Associated with DEGs
2.6. Identification of Genes Involved in Testicular Development
3. Discussion
4. Materials and Methods
4.1. Experimental Animals and Sample Collection
4.2. Whole Genome Bisulfite Sequencing (WGBS)
4.3. Bisulfite Sequencing PCR (BSP)
4.4. RNA-Seq
4.5. Reverse Transcription qPCR (RT-qPCR)
4.6. Data Analysis
4.7. Identification of DMRs and Functional Analysis of DMR-Associated Genes
4.8. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Tirumalasetty, M.B.; Bhattacharya, I.; Mohiuddin, M.S.; Baki, V.B.; Choubey, M. Understanding testicular single cell transcriptional atlas: From developmental complications to male infertility. Front. Endocrinol. (Lausanne) 2024, 15, 1394812. [Google Scholar] [CrossRef]
- Si, L.; Meng, Y.; Tian, F.; Li, W.; Zou, P.; Wang, Q.; Xu, W.; Wang, Y.; Xia, M.; Hu, J.; et al. A Peptide-Based Virus Inactivator Protects Male Mice Against Zika Virus-Induced Damage of Testicular Tissue. Front. Microbiol. 2019, 10, 2250. [Google Scholar] [CrossRef]
- Song, H.; Zhu, L.; Li, Y.; Ma, C.; Guan, K.; Xia, X.; Li, F. Exploiting RNA-sequencing data from the porcine testes to identify the key genes involved in spermatogenesis in Large White pigs. Gene 2015, 573, 303–309. [Google Scholar] [CrossRef]
- Liu, M.; Xu, Q.; Zhao, J.; Guo, Y.; Zhang, C.; Chao, X.; Cheng, M.; Schinckel, A.P.; Zhou, B. Comprehensive Transcriptome Analysis of Follicles from Two Stages of the Estrus Cycle of Two Breeds Reveals the Roles of Long Intergenic Non-Coding RNAs in Gilts. Biology 2022, 11, 716. [Google Scholar] [CrossRef] [PubMed]
- Luo, L.; Ye, L.; Liu, G.; Shao, G.; Zheng, R.; Ren, Z.; Zuo, B.; Xu, D.; Lei, M.; Jiang, S.; et al. Microarray-based approach identifies differentially expressed microRNAs in porcine sexually immature and mature testes. PLoS ONE 2010, 5, e11744. [Google Scholar] [CrossRef] [PubMed]
- Zhou, H.; Ma, T.Y.; Zhang, R.; Xu, Q.Z.; Shen, F.; Qin, Y.J.; Xu, W.; Wang, Y.; Li, Y.J. Analysis of Different Ploidy and Parent-Offspring Genomic DNA Methylation in the Loach Misgurnus anguillicaudatus. Int. J. Mol. Sci. 2016, 17, 1299. [Google Scholar] [CrossRef]
- Li, Y.; Miyanari, Y.; Shirane, K.; Nitta, H.; Kubota, T.; Ohashi, H.; Okamoto, A.; Sasaki, H. Sequence-specific microscopic visualization of DNA methylation status at satellite repeats in individual cell nuclei and chromosomes. Nucleic Acids Res. 2013, 41, e186. [Google Scholar] [CrossRef]
- Butz, S.; Schmolka, N.; Karemaker, I.D.; Villaseñor, R.; Schwarz, I.; Domcke, S.; Uijttewaal, E.C.H.; Jude, J.; Lienert, F.; Krebs, A.R.; et al. DNA sequence and chromatin modifiers cooperate to confer epigenetic bistability at imprinting control regions. Nat. Genet. 2022, 54, 1702–1710. [Google Scholar] [CrossRef] [PubMed]
- Al Adhami, H.; Bardet, A.F.; Dumas, M.; Cleroux, E.; Guibert, S.; Fauque, P.; Acloque, H.; Weber, M. A comparative methylome analysis reveals conservation and divergence of DNA methylation patterns and functions in vertebrates. BMC Biol. 2022, 20, 70. [Google Scholar] [CrossRef]
- Park, H.; Shin, J.; Kim, Y.; Saito, T.; Saido, T.C.; Kim, J. CRISPR/dCas9-Dnmt3a-mediated targeted DNA methylation of APP rescues brain pathology in a mouse model of Alzheimer’s disease. Transl. Neurodegener. 2022, 11, 41. [Google Scholar] [CrossRef]
- Dvoriantchikova, G.; Seemungal, R.J.; Ivanov, D. DNA Methylation Dynamics During the Differentiation of Retinal Progenitor Cells Into Retinal Neurons Reveal a Role for the DNA Demethylation Pathway. Front. Mol. Neurosci. 2019, 12, 182. [Google Scholar] [CrossRef] [PubMed]
- Geng, X.; Chi, K.; Liu, C.; Fu, Z.; Wang, X.; Meng, L.; Wang, H.; Cai, G.; Chen, X.; Hong, Q. Interaction of RARRES1 with ICAM1 modulates macrophages to suppress the progression of kidney renal clear cell carcinoma. Front. Immunol. 2022, 13, 982045. [Google Scholar] [CrossRef]
- Harris, R.A.; Wang, T.; Coarfa, C.; Nagarajan, R.P.; Hong, C.; Downey, S.L.; Johnson, B.E.; Fouse, S.D.; Delaney, A.; Zhao, Y.; et al. Comparison of sequencing-based methods to profile DNA methylation and identification of monoallelic epigenetic modifications. Nat. Biotechnol. 2010, 28, 1097–1105. [Google Scholar] [CrossRef] [PubMed]
- Ben Maamar, M.; Beck, D.; Nilsson, E.; McCarrey, J.R.; Skinner, M.K. Developmental alterations in DNA methylation during gametogenesis from primordial germ cells to sperm. iScience 2022, 25, 103786. [Google Scholar] [CrossRef]
- Inoue, K.; Ichiyanagi, K.; Fukuda, K.; Glinka, M.; Sasaki, H. Switching of dominant retrotransposon silencing strategies from posttranscriptional to transcriptional mechanisms during male germ-cell development in mice. PLoS Genet. 2017, 13, e1006926. [Google Scholar] [CrossRef] [PubMed]
- Rwigemera, A.; Joao, F.; Delbes, G. Fetal testis organ culture reproduces the dynamics of epigenetic reprogramming in rat gonocytes. Epigenetics Chromatin 2017, 10, 19. [Google Scholar] [CrossRef]
- Jeong, P.S.; Yang, H.J.; Park, S.H.; Gwon, M.A.; Joo, Y.E.; Kim, M.J.; Kang, H.G.; Lee, S.; Park, Y.H.; Song, B.S.; et al. Combined Chaetocin/Trichostatin A Treatment Improves the Epigenetic Modification and Developmental Competence of Porcine Somatic Cell Nuclear Transfer Embryos. Front. Cell Dev. Biol. 2021, 9, 709574. [Google Scholar] [CrossRef]
- Saini, S.K.; Mangalhara, K.C.; Prakasam, G.; Bamezai, R.N.K. DNA Methyltransferase1 (DNMT1) Isoform3 methylates mitochondrial genome and modulates its biology. Sci. Rep. 2017, 7, 1525. [Google Scholar] [CrossRef] [PubMed]
- Zamudio, N.; Barau, J.; Teissandier, A.; Walter, M.; Borsos, M.; Servant, N.; Bourc’his, D. DNA methylation restrains transposons from adopting a chromatin signature permissive for meiotic recombination. Genes. Dev. 2015, 29, 1256–1270. [Google Scholar] [CrossRef]
- Lambrot, R.; Xu, C.; Saint-Phar, S.; Chountalos, G.; Cohen, T.; Paquet, M.; Suderman, M.; Hallett, M.; Kimmins, S. Low paternal dietary folate alters the mouse sperm epigenome and is associated with negative pregnancy outcomes. Nat. Commun. 2013, 4, 2889. [Google Scholar] [CrossRef]
- Zhang, Z.; Wang, J.; Shi, F.; Li, Y.; Zou, P.; Tang, Y.; Liu, C.; Wang, Y.; Ling, X.; Sun, L.; et al. Genome-wide alternation and effect of DNA methylation in the impairments of steroidogenesis and spermatogenesis after PM(2.5) exposure. Environ. Int. 2022, 169, 107544. [Google Scholar] [CrossRef]
- Wang, S.; Li, F.; Liu, J.; Zhang, Y.; Zheng, Y.; Ge, W.; Qu, L.; Wang, X. Integrative Analysis of Methylome and Transcriptome Reveals the Regulatory Mechanisms of Hair Follicle Morphogenesis in Cashmere Goat. Cells 2020, 9, 969. [Google Scholar] [CrossRef] [PubMed]
- Park, Y.; Figueroa, M.E.; Rozek, L.S.; Sartor, M.A. MethylSig: A whole genome DNA methylation analysis pipeline. Bioinformatics 2014, 30, 2414–2422. [Google Scholar] [CrossRef] [PubMed]
- Kubo, N.; Toh, H.; Shirane, K.; Shirakawa, T.; Kobayashi, H.; Sato, T.; Sone, H.; Sato, Y.; Tomizawa, S.; Tsurusaki, Y.; et al. DNA methylation and gene expression dynamics during spermatogonial stem cell differentiation in the early postnatal mouse testis. BMC Genom. 2015, 16, 624. [Google Scholar] [CrossRef] [PubMed]
- Dyson, M.T.; Roqueiro, D.; Monsivais, D.; Ercan, C.M.; Pavone, M.E.; Brooks, D.C.; Kakinuma, T.; Ono, M.; Jafari, N.; Dai, Y.; et al. Genome-wide DNA methylation analysis predicts an epigenetic switch for GATA factor expression in endometriosis. PLoS Genet. 2014, 10, e1004158. [Google Scholar] [CrossRef] [PubMed]
- Zhang, B.; Ban, D.; Gou, X.; Zhang, Y.; Yang, L.; Chamba, Y.; Zhang, H. Genome-wide DNA methylation profiles in Tibetan and Yorkshire pigs under high-altitude hypoxia. J. Anim. Sci. Biotechnol. 2019, 10, 25. [Google Scholar] [CrossRef]
- Laurent, L.; Wong, E.; Li, G.; Huynh, T.; Tsirigos, A.; Ong, C.T.; Low, H.M.; Kin Sung, K.W.; Rigoutsos, I.; Loring, J.; et al. Dynamic changes in the human methylome during differentiation. Genome Res. 2010, 20, 320–331. [Google Scholar] [CrossRef]
- Tadokoro, Y.; Ema, H.; Okano, M.; Li, E.; Nakauchi, H. De novo DNA methyltransferase is essential for self-renewal, but not for differentiation, in hematopoietic stem cells. J. Exp. Med. 2007, 204, 715–722. [Google Scholar] [CrossRef]
- Robertson, K.D. DNA methylation and human disease. Nat. Rev. Genet. 2005, 6, 597–610. [Google Scholar] [CrossRef]
- Kon, T.; Yoshikawa, N. Induction and maintenance of DNA methylation in plant promoter sequences by apple latent spherical virus-induced transcriptional gene silencing. Front. Microbiol. 2014, 5, 595. [Google Scholar] [CrossRef]
- Fang, X.; Zhao, Z.; Yu, H.; Li, G.; Jiang, P.; Yang, Y.; Yang, R.; Yu, X. Comparative genome-wide methylation analysis of longissimus dorsi muscles between Japanese black (Wagyu) and Chinese Red Steppes cattle. PLoS ONE 2017, 12, e0182492. [Google Scholar] [CrossRef]
- Fan, Y.; Liang, Y.; Deng, K.; Zhang, Z.; Zhang, G.; Zhang, Y.; Wang, F. Analysis of DNA methylation profiles during sheep skeletal muscle development using whole-genome bisulfite sequencing. BMC Genom. 2020, 21, 327. [Google Scholar] [CrossRef] [PubMed]
- Yuan, X.L.; Gao, N.; Xing, Y.; Zhang, H.B.; Zhang, A.L.; Liu, J.; He, J.L.; Xu, Y.; Lin, W.M.; Chen, Z.M.; et al. Profiling the genome-wide DNA methylation pattern of porcine ovaries using reduced representation bisulfite sequencing. Sci. Rep. 2016, 6, 22138. [Google Scholar] [CrossRef] [PubMed]
- Ikawa, M.; Inoue, N.; Benham, A.M.; Okabe, M. Fertilization: A sperm’s journey to and interaction with the oocyte. J. Clin. Investig. 2010, 120, 984–994. [Google Scholar] [CrossRef]
- Wang, Y.; Lui, W.Y. Opposite effects of interleukin-1alpha and transforming growth factor-beta2 induce stage-specific regulation of junctional adhesion molecule-B gene in Sertoli cells. Endocrinology 2009, 150, 2404–2412. [Google Scholar] [CrossRef][Green Version]
- Zhang, Y. SPATA33 affects the formation of cell adhesion complex by interacting with CTNNA3 in TM4 cells. Cell Tissue Res. 2022, 389, 145–157. [Google Scholar] [CrossRef] [PubMed]
- Goh, W.S.; Falciatori, I.; Tam, O.H.; Burgess, R.; Meikar, O.; Kotaja, N.; Hammell, M.; Hannon, G.J. piRNA-directed cleavage of meiotic transcripts regulates spermatogenesis. Genes Dev. 2015, 29, 1032–1044. [Google Scholar] [CrossRef] [PubMed]
- Dam, A.H.; Koscinski, I.; Kremer, J.A.; Moutou, C.; Jaeger, A.S.; Oudakker, A.R.; Tournaye, H.; Charlet, N.; Lagier-Tourenne, C.; van Bokhoven, H.; et al. Homozygous mutation in SPATA16 is associated with male infertility in human globozoospermia. Am. J. Hum. Genet. 2007, 81, 813–820. [Google Scholar] [CrossRef]
- Snyder, E.; Soundararajan, R.; Sharma, M.; Dearth, A.; Smith, B.; Braun, R.E. Compound Heterozygosity for Y Box Proteins Causes Sterility Due to Loss of Translational Repression. PLoS Genet. 2015, 11, e1005690. [Google Scholar] [CrossRef]
- Yuan, L.; Liu, J.G.; Zhao, J.; Brundell, E.; Daneholt, B.; Höög, C. The murine SCP3 gene is required for synaptonemal complex assembly, chromosome synapsis, and male fertility. Mol. Cell 2000, 5, 73–83. [Google Scholar] [CrossRef]
- Song, H.; Chen, D.; Bai, R.; Feng, Y.; Wu, S.; Wang, T.; Xia, X.; Li, J.; Miao, Y.L.; Zuo, B.; et al. BCL2-associated athanogene 6 exon24 contributes to testosterone synthesis and male fertility in mammals. Cell Prolif. 2022, 55, e13281. [Google Scholar] [CrossRef]
- Donkor, F.F.; Mönnich, M.; Czirr, E.; Hollemann, T.; Hoyer-Fender, S. Outer dense fibre protein 2 (ODF2) is a self-interacting centrosomal protein with affinity for microtubules. J. Cell Sci. 2004, 117 Pt 20, 4643–4651. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.; Xia, Y.; Ben, Y.; Lu, X.; Dou, K.; Ding, Y.; Han, X.; Yang, F.; Wang, J.; Li, D. Embryonic exposure to aluminum chloride blocks the onset of spermatogenesis through disturbing the dynamics of testicular tight junctions via upregulating Slc25a5 in offspring. Sci. Total Environ. 2024, 915, 170128. [Google Scholar] [CrossRef]
- Hu, C.; Zuo, Q.; Jin, K.; Zhao, Z.; Wu, Y.; Gao, J.; Wang, C.; Wang, Y.; Zhan, W.; Zhou, J.; et al. Retinoic acid promotes formation of chicken (Gallus gallus) spermatogonial stem cells by regulating the ECM-receptor interaction signaling pathway. Gene 2022, 820, 146227. [Google Scholar] [CrossRef] [PubMed]
- Chang, J.H.; Chou, C.H.; Wu, J.C.; Liao, K.M.; Luo, W.J.; Hsu, W.L.; Chen, X.R.; Yu, S.L.; Pan, S.H.; Yang, P.C.; et al. LCRMP-1 is required for spermatogenesis and stabilises spermatid F-actin organization via the PI3K-Akt pathway. Commun. Biol. 2023, 6, 389. [Google Scholar] [CrossRef]
- Xi, Y.; Li, W. BSMAP: Whole genome bisulfite sequence MAPping program. BMC Bioinform. 2009, 10, 232. [Google Scholar] [CrossRef] [PubMed]
- Chen, S.; Zhou, Y.; Chen, Y.; Gu, J. fastp: An ultra-fast all-in-one FASTQ preprocessor. Bioinformatics 2018, 34, i884–i890. [Google Scholar] [CrossRef] [PubMed]
- Kim, D.; Langmead, B.; Salzberg, S.L. HISAT: A fast spliced aligner with low memory requirements. Nat. Methods 2015, 12, 357–360. [Google Scholar] [CrossRef]
- Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef]
- Akalin, A.; Kormaksson, M.; Li, S.; Garrett-Bakelman, F.E.; Figueroa, M.E.; Melnick, A.; Mason, C.E. methylKit: A comprehensive R package for the analysis of genome-wide DNA methylation profiles. Genome Biol. 2012, 13, R87. [Google Scholar] [CrossRef]
- Jühling, F.; Kretzmer, H.; Bernhart, S.H.; Otto, C.; Stadler, P.F.; Hoffmann, S. metilene: Fast and sensitive calling of differentially methylated regions from bisulfite sequencing data. Genome Res. 2016, 26, 256–262. [Google Scholar] [CrossRef] [PubMed]
- Wu, T.; Hu, E.; Xu, S.; Chen, M.; Guo, P.; Dai, Z.; Feng, T.; Zhou, L.; Tang, W.; Zhan, L.; et al. clusterProfiler 4.0: A universal enrichment tool for interpreting omics data. Innovation 2021, 2, 100141. [Google Scholar] [CrossRef] [PubMed]
Gene Name | Log2 Fold Change | Diff. Methy | C Context | Region |
---|---|---|---|---|
ADAM30 | 11.5478768495596 | −0.533689 | CG | promoter |
ADAM3A | 10.1525323821239 | −0.423786 | CG | promoter |
RPL10L | 9.31946493147972 | −0.52811 | CG | promoter |
SPATA16 | 9.13952557495772 | −0.53494 | CG | promoter |
H2BC1 | 8.9679817878648 | −0.640505 | CG | promoter |
DPY19L2 | 8.31772645532461 | −0.502483 | CG | promoter |
YBX2 | 8.27754426747838 | −0.520806 | CG | promoter |
MAK | 7.80066048376145 | −0.612207 | CG | promoter |
CTNNB1 | −1.20022448264121 | 0.41598 | CG | promoter |
CADM1 | −1.21820498177358 | 0.415944 | CG | promoter |
PAFAH1B3 | −1.3516785322754 | 0.324475 | CG | promoter |
JAM2 | −2.0339454194098 | 0.280444 | CG | promoter |
CACNA1I | −2.16972157288754 | 0.234783 | CG | promoter |
Gene | Sequence of the Primers |
---|---|
ADAM30 | F: GYGATGTGGGTATAGTGGGT R: ACAAATACACRCCCTATCCAA |
ADAM3A | F: GGTGATTTAGGTTTTATAAGAGTAT R: TACATATATTCAAATATTTCTTTCC |
YBX2 | F: TTATGTAATTAATATTTTAATTAAGGG R: ATCTCAAACCTCRCTTAATAA |
JAM2 | F: TTTGATTGAAAATAATGTATTAAGTT R: CCTTTCCTTTCCTACTCTTTAA |
PAFAH1B3 | F: TTTATTGAGTATTTATTGTTTGTGTT R: AACTTTTTAAATTTAAACAAACAAC |
CTNNB1 | F: TAGGTGGAAGGGAAGTTAAA R: TTCCCATAATAATAACATTTTAAT |
Gene | Sequence of the Primers |
---|---|
ADAM30 | F: GCGATGGTACTTCCTGTGGT R: CTCGGTGGTTGCACTTCTCA |
ADAM3A | F: CACAGATCGTACCAAAGACGG R: GTCCATTATCACAAAACCTTCCG |
DPY19L2 | F: GCCTTCTGGTATCGCTCAGT R: GGGTCTCCCAATCCTTCACAG |
H2BC1 | F: CAGAAGAGGCCGGAAAGAGA R: GTGGAACGCTTGCTGTAGTG |
MAK | F: AGAGTCAACAGAAACAGCCCC R: AGTGCCGTTGGGCTTGATTG |
RPL10L | F: ATGGTTTCCTTGTGGGGAGATA R: GCAGAAGCGTGACTTTGGATA |
SPATA16 | F: GCTGTGGAGATAAAAAGGTAGAAAT |
R: CTTTGCCTCTTTCTTTCCAG | |
YBX2 | F: GTCTTTGTTCACCAGACAGCTA |
R: ACATCGAACTCCACGGTCTC | |
CACNA1I | F: TCACCGTGTTCCAGATCCTCAC |
R: TTCAGAGTAGGAGCGATTGGCG | |
CADM1 | F: CAGAATTTGTTTACTAAAGACGTGA |
R: GTCCCTGAAATAAATGGTCTGC | |
CTNNB1 | F: ATGGCTACCCAAGCTGATTTGAT |
R: GGTCGTGGCACCAGAATG | |
JAM2 | F: CCCTGGAAGTATTAGTGGCTCC |
R: GGGAGCTGGATTGCCTTCTT | |
PAFAH1B3 | F: AACACATCCGACCCAAGATTGT |
R: TTCTCACGGAGTGGATTGGG | |
β-actin | F: CCAGGTCATCACCATCGG R: CCGTGTTGGCGTAGAGGT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Feng, Y.; Zhang, Y.; Wu, J.; Qiao, M.; Zhou, J.; Xu, Z.; Li, Z.; Sun, H.; Peng, X.; Mei, S. Comprehensive Analysis of Methylome and Transcriptome to Identify Potential Genes Regulating Porcine Testis Development. Int. J. Mol. Sci. 2024, 25, 9105. https://doi.org/10.3390/ijms25169105
Feng Y, Zhang Y, Wu J, Qiao M, Zhou J, Xu Z, Li Z, Sun H, Peng X, Mei S. Comprehensive Analysis of Methylome and Transcriptome to Identify Potential Genes Regulating Porcine Testis Development. International Journal of Molecular Sciences. 2024; 25(16):9105. https://doi.org/10.3390/ijms25169105
Chicago/Turabian StyleFeng, Yue, Yu Zhang, Junjing Wu, Mu Qiao, Jiawei Zhou, Zhong Xu, Zipeng Li, Hua Sun, Xianwen Peng, and Shuqi Mei. 2024. "Comprehensive Analysis of Methylome and Transcriptome to Identify Potential Genes Regulating Porcine Testis Development" International Journal of Molecular Sciences 25, no. 16: 9105. https://doi.org/10.3390/ijms25169105
APA StyleFeng, Y., Zhang, Y., Wu, J., Qiao, M., Zhou, J., Xu, Z., Li, Z., Sun, H., Peng, X., & Mei, S. (2024). Comprehensive Analysis of Methylome and Transcriptome to Identify Potential Genes Regulating Porcine Testis Development. International Journal of Molecular Sciences, 25(16), 9105. https://doi.org/10.3390/ijms25169105