Intrauterine L-NAME Exposure Weakens the Development of Sympathetic Innervation and Induces the Remodeling of Arterial Vessels in Two-Week-Old Rats
Abstract
1. Introduction
2. Results
2.1. Characteristics of L-NAME Treatment Model
2.1.1. Pregnant Females
2.1.2. Offspring
2.2. Studies of Two-Week-Old Offspring Arteries
2.2.1. The Density of Sympathetic Innervation in Saphenous Artery Wall
2.2.2. Functional Characteristics of Saphenous Artery
2.2.3. Expressed mRNA Levels
2.3. Systemic Cardiovascular Parameters of Two-Week-Old Offspring
3. Discussion
3.1. L-NAME Treatment Leads to NO Deficiency in Dams and Their Offspring
3.2. Intrauterine L-NAME Exposure Is Associated with a Reduced Density of Sympathetic Innervation in Peripheral Arteries
3.3. Intrauterine L-NAME Exposure Is Associated with the Delayed Maturation of Peripheral Arteries
3.4. Intrauterine L-NAME Exposure Is Associated with the Weakened Sympathetic Control of Systemic Blood Pressure in Two-Week-Old Rats
4. Materials and Methods
4.1. Animals
4.2. Rat Model of Intrauterine NO deficiency
4.3. Measurement of Blood Parameters
4.4. Visualization of Sympathetic Nerve Fibers
4.5. Functional Studies of Isolated Arteries
4.6. Measurement of mRNA Content in Arterial Tissue by qPCR
| Protein | Gene | Forward | Reverse |
|---|---|---|---|
| α-Actin | Acta2 | CCTGACCCTGAAGTATCCGA | CATCTCCAGAGTCCAGCACA |
| β-Actin | Actb | CAGGGTGTGATGGTGGGTATGG | AGTTGGTGACAATGCCGTGTTC |
| SM-MHC | Myh11 | TTTGCCATTGAGGCCTTAG | GTTCACACGGCTGAGAATCCA |
| NM-MHC | Myh10 | TGAGAAGCCGCCACACATC | CACCCGTGCAAAGAATCGA |
| α1a-adrenoceptor | Adra1a | GTAGCCAAGAGAGAAAGCCG | CAACCCACCACGATGCCCAG |
| RPLP0 | Rplp0 | AGGGTCCTGGCTTTGTCTGTGG | AGCTGCAGGAGCAGCAGTGG |
4.7. Blood Pressure Measurement
4.8. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Förstermann, U.; Sessa, W.C. Nitric oxide synthases: Regulation and function. Eur. Heart J. 2012, 33, 829–837. [Google Scholar] [CrossRef]
- Gaynullina, D.K.; Schubert, R.; Tarasova, O.S. Changes in endothelial nitric oxide production in systemic vessels during early ontogenesis—A key mechanism for the perinatal adaptation of the circulatory system. Int. J. Mol. Sci. 2019, 20, 1421. [Google Scholar] [CrossRef] [PubMed]
- Ally, A.; Powell, I.; Ally, M.M.; Chaitoff, K.; Nauli, S.M. Role of neuronal nitric oxide synthase on cardiovascular functions in physiological and pathophysiological states. Nitric Oxide 2020, 102, 52–73. [Google Scholar] [CrossRef] [PubMed]
- Gaynullina, D.; Lubomirov, L.T.; Sofronova, S.I.; Kalenchuk, V.U.; Gloe, T.; Pfitzer, G.; Tarasova, O.S.; Schubert, R. Functional remodelling of arterial endothelium during early postnatal development in rats. Cardiovasc. Res. 2013, 99, 612–621. [Google Scholar] [CrossRef] [PubMed]
- Sofronova, S.I.; Borzykh, A.A.; Gaynullina, D.K.; Kuzmin, I.V.; Shvetsova, A.A.; Lukoshkova, E.V.; Tarasova, O.S. Endothelial nitric oxide weakens arterial contractile responses and reduces blood pressure during early postnatal development in rats. Nitric Oxide 2016, 55–56, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Kent, A.L.; Kecskes, Z.; Shadbolt, B.; Falk, M.C. Blood pressure in the first year of life in healthy infants born at term. Pediatr. Nephrol. 2007, 22, 1743–1749. [Google Scholar] [CrossRef] [PubMed]
- Mills, E.; Smith, P.G. Mechanisms of adrenergic control of blood pressure in developing rats. Am. J. Physiol. Regul. Integr. Comp. Physiol. 1986, 250, R188–R192. [Google Scholar] [CrossRef] [PubMed]
- Mochalov, S.; Tarasova, N.V.; Kudryashova, T.V.; Gaynullina, D.K.; Kalenchuk, V.U.; Borovik, A.S.; Vorotnikov, A.V.; Tarasova, O.S.; Schubert, R. Higher Ca2+-sensitivity of arterial contraction in the 1-week-old rats is due to a greater Rho-kinase activity. Acta Physiol. 2018, 223, e13044. [Google Scholar] [CrossRef]
- Todd, M.E. Development of adrenergic innervation in rat peripheral vessels: A fluorescence microscopic study. J. Anat. 1980, 131, 121–133. [Google Scholar]
- Puzdrova, V.A.; Kudryashova, T.V.; Gaynullina, D.K.; Mochalov, S.V.; Aalkjaer, C.; Nilsson, H.; Vorotnikov, A.V.; Schubert, R.; Tarasova, O.S. Trophic action of sympathetic nerves reduces arterial smooth muscle Ca2+ sensitivity during early post-natal development in rats. Acta Physiol. 2014, 212, 128–141. [Google Scholar] [CrossRef]
- Bevan, R.D. Trophic effects of peripheral adrenergic nerves on vascular structure. Hypertension 1984, 6. [Google Scholar] [CrossRef] [PubMed]
- Damon, D.H. Sympathetic innervation promotes vascular smooth muscle differentiation. Am. J. Physiol. Circ. Physiol. 2005, 288, H2785–H2791. [Google Scholar] [CrossRef] [PubMed]
- Reho, J.J.; Zheng, X.; Benjamin, J.E.; Fisher, S.A. Neural programming of mesenteric and renal arteries. Am. J. Physiol. Circ. Physiol. 2014, 307, H563–H573. [Google Scholar] [CrossRef] [PubMed]
- Kostyunina, D.S.; Zhang, L.; Shvetsova, A.A.; Selivanova, E.K.; Tarasova, O.S.; Matchkov, V.V.; Gaynullina, D.K. Trophic sympathetic influence weakens pro-contractile role of Cl− channels in rat arteries during postnatal maturation. Sci. Rep. 2020, 10, 1–13. [Google Scholar] [CrossRef] [PubMed]
- Peunova, N.; Enikolopov, G. Nitric oxide triggers a switch to growth arrest during differentiation of neuronal cells. Nature 1995, 375, 68–73. [Google Scholar] [CrossRef] [PubMed]
- Farinelli, S.E.; Park, D.S.; Greene, L.A. Nitric oxide delays the death of trophic factor-deprived PC12 cells and sympathetic neurons by a cGMP-mediated mechanism. J. Neurosci. 1996, 16, 2325–2334. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Kim, Y.M.; Chung, H.T.; Kim, S.S.; Han, J.A.; Yoo, Y.M.; Kim, K.M.; Lee, G.H.; Yun, H.Y.; Green, A.; Li, J.; et al. Nitric oxide protects PC12 cells from serum deprivation-induced apoptosis by cGMP-dependent inhibition of caspase signaling. J. Neurosci. 1999, 19, 6740–6747. [Google Scholar] [CrossRef]
- Ciani, E.; Severi, S.; Contestabile, A.; Bartesaghi, R.; Contestabile, A. Nitric oxide negatively regulates proliferation and promotes neuronal differentiation through N-Myc downregulation. J. Cell Sci. 2004, 117, 4727–4737. [Google Scholar] [CrossRef] [PubMed]
- Moiseev, K.Y.; Romanova, I.V.; Masliukov, A.P.; Masliukov, P.M. Development of nNOS-positive preganglionic sympathetic neurons in the rat thoracic spinal cord. Cell Tissue Res. 2019, 375, 345–357. [Google Scholar] [CrossRef]
- Osol, G.; Ko, N.L.; Mandalà, M. Altered endothelial nitric oxide signaling as a paradigm for maternal vascular maladaptation in preeclampsia. Curr. Hypertens. Rep. 2017, 19, 1–12. [Google Scholar] [CrossRef]
- Deniz, R.; Baykus, Y.; Ustebay, S.; Ugur, K.; Yavuzkir, Ş.; Aydin, S. Evaluation of elabela, apelin and nitric oxide findings in maternal blood of normal pregnant women, pregnant women with pre-eclampsia, severe pre-eclampsia and umbilical arteries and venules of newborns. J. Obstet. Gynaecol. 2019, 39, 907–912. [Google Scholar] [CrossRef]
- Wojczakowski, W.; Kimber-Trojnar, Ż.; Dziwisz, F.; Słodzińska, M.; Słodziński, H.; Leszczyńska-Gorzelak, B. Preeclampsia and cardiovascular risk for offspring. J. Clin. Med. 2021, 10, 3154. [Google Scholar] [CrossRef] [PubMed]
- Turbeville, H.R.; Sasser, J.M. Preeclampsia beyond pregnancy: Long-term consequences for mother and child. Am. J. Physiol. Ren. Physiol. 2020, 318, F1315–F1326. [Google Scholar] [CrossRef] [PubMed]
- Teng, R.J.; Wu, T.J.; Sharma, R.; Garrison, R.D.; Hudak, M.L. Early neonatal hypotension in premature infants born to preeclamptic mothers. J. Perinatol. 2006, 26, 471–475. [Google Scholar] [CrossRef]
- Zheng, L.; Huang, J.; Su, Y.; Wang, F.; Kong, H.; Xin, H. Vitexin ameliorates preeclampsia phenotypes by inhibiting TFPI-2 and HIF-1α/VEGF in a l-NAME induced rat model. Drug Dev. Res. 2019, 80, 1120–1127. [Google Scholar] [CrossRef]
- Zuo, J.; Jiang, Z. Melatonin attenuates hypertension and oxidative stress in a rat model of L-NAME-induced gestational hypertension. Vasc. Med. 2020, 25, 295–301. [Google Scholar] [CrossRef]
- Shvetsova, A.A.; Borzykh, A.A.; Selivanova, E.K.; Kiryukhina, O.O.; Gaynullina, D.K.; Tarasova, O.S. Intrauterine nitric oxide deficiency weakens differentiation of vascular smooth muscle in newborn rats. Int. J. Mol. Sci. 2021, 22, 8003. [Google Scholar] [CrossRef] [PubMed]
- Boer, R.; Ulrich, W.R.; Klein, T.; Mirau, B.; Haas, S.; Baur, I. The inhibitory potency and selectivity of arginine substrate site nitric-oxide synthase inhibitors is solely determined by their affinity toward the different isoenzymes. Mol. Pharmacol. 2000, 58, 1026–1034. [Google Scholar] [CrossRef] [PubMed]
- Sandow, S.L.; Hill, C.E. Specialised sympathetic neuroeffector associations in immature rat iris arterioles. J. Anat. 1999, 195, 257–270. [Google Scholar] [CrossRef] [PubMed]
- Sathyanesan, A.; Ogura, T.; Lin, W. Automated measurement of nerve fiber density using line intensity scan analysis. J. Neurosci. Methods 2012, 206, 165–175. [Google Scholar] [CrossRef]
- Aalkjær, C.; Nilsson, H.; De Mey, J.G.R. Sympathetic and sensory-motor nerves in peripheral small arteries. Physiol. Rev. 2021, 101, 495–544. [Google Scholar] [CrossRef] [PubMed]
- Trendelenburg, U.; Maxwell, R.; Pluchino, S. Methoxamine as a tool to assess the importance of intraneuronal uptake of norepinephrine in the cat’s nictitating membrane. J. Pharmacol. Exp. Ther. 1970, 172, 91–99. [Google Scholar] [PubMed]
- Proudman, R.G.W.; Baker, J.G. The selectivity of α-adrenoceptor agonists for the human α1A, α1B, and α1D-adrenoceptors. Pharmacol. Res. Perspect. 2021, 9, 1–23. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Yang, N.; Wang, B.; Niu, X.; Cai, W.; Li, Y.; Li, Y.; Chen, S. Effect and mechanism of prophylactic use of tadalafil during pregnancy on L-NAME-induced preeclampsia-like rats. Placenta 2020, 99, 35–44. [Google Scholar] [CrossRef]
- Hamza, R.Z.; Diab, A.A.A.; Zahra, M.H.; Asalah, A.K.; Attia, M.S.; Moursi, S.M.M. Ameliorative effect of apelin-13 against renal complications in L-NAME-induced preeclampsia in rats. PeerJ 2021, 9, e11110. [Google Scholar] [CrossRef] [PubMed]
- Shu, W.; Li, H.; Gong, H.; Zhang, M.; Niu, X.; Ma, Y.; Zhang, X.; Cai, W.; Yang, G.; Wei, M.; et al. Evaluation of blood vessel injury, oxidative stress and circulating inflammatory factors in an L-NAME-induced preeclampsia-like rat model. Exp. Ther. Med. 2018, 16, 585–594. [Google Scholar] [CrossRef]
- Liu, X.; Zhao, W.; Liu, H.; Kang, Y.; Ye, C.; Gu, W.; Hu, R.; Li, X. Developmental and functional brain impairment in offspring from preeclampsia-like rats. Mol. Neurobiol. 2016, 53, 1009–1019. [Google Scholar] [CrossRef]
- Abuiessa, S.A.; Wedn, A.M.; El-Gowilly, S.M.; Helmy, M.M.; El-Mas, M.M. Pre-eclamptic fetal programming alters neuroinflammatory and cardiovascular consequences of endotoxemia in sex-specific manners. J. Pharmacol. Exp. Ther. 2020, 373, 325–336. [Google Scholar] [CrossRef]
- Huang, F.; Villafaña, S.; Hong, E. Role of central and sympathetic nervous systems in pressor effect of L-NAME. J. Cardiovasc. Pharmacol. 2003, 41, 68–72. [Google Scholar] [CrossRef]
- Herrera-Garcia, G.; Contag, S. Maternal preeclampsia and risk for cardiovascular disease in offspring. Curr. Hypertens. Rep. 2014, 16, 1–10. [Google Scholar] [CrossRef]
- Butruille, L.; Mayeur, S.; Moitrot, E.; Storme, L.; Knauf, C.; Lesage, J.; Deruelle, P. Maternal hypertension induced by NO blockade does not program adult metabolic diseases in growth-restricted rat fetuses. Metabolism 2013, 62, 442–445. [Google Scholar] [CrossRef] [PubMed]
- Li, B.; He, X.; Lei, S.S.; Zhou, F.C.; Zhang, N.Y.; Chen, Y.H.; Wang, Y.Z.; Su, J.; Yu, J.J.; Li, L.Z.; et al. Hypertensive rats treated chronically with Nω-Nitro-L-Arginine Methyl Ester (L-NAME) induced disorder of hepatic fatty acid metabolism and intestinal pathophysiology. Front. Pharmacol. 2020, 10, 1677. [Google Scholar] [CrossRef] [PubMed]
- Fantel, A.G.; Stamps, L.D.; Tran, T.T.; Mackler, B.; Person, R.E.; Nekahi, N. Role of free radicals in the limb teratogenicity of L-NAME (N(G)-nitro-(L)-arginine methyl ester): A new mechanistic model of vascular disruption. Teratology 1999, 60, 151–160. [Google Scholar] [CrossRef]
- Hindley, S.; Juurlink, B.H.J.; Gysbers, J.W.; Middlemiss, P.J.; Herman, M.A.R.; Rathbone, M.P. Nitric oxide donors enhance neurotrophin-induced neurite outgrowth through a cGMP-dependent mechanism. J. Neurosci. Res. 1997, 47, 427–439. [Google Scholar] [CrossRef]
- Tarasova, O.; Sjöblom-Widfeldt, N.; Nilsson, H. Transmitter characteristics of cutaneous, renal and skeletal muscle small arteries in the rat. Acta Physiol. Scand. 2003, 177, 157–166. [Google Scholar] [CrossRef] [PubMed]
- Bevan, R.D.; Tsuru, H. Functional and structural changes in the rabbit ear artery after sympathetic denervation. Circ. Res. 1981, 49, 478–485. [Google Scholar] [CrossRef] [PubMed]
- Mulvany, M.J.; Hansen, O.K.; Aalkjaer, C. Direct evidence that the greater contractility of resistance vessels in spontaneously hypertensive rats is associated with a narrowed lumen, a thickened media, and an increased number of smooth muscle cell layers. Circ. Res. 1978, 43, 854–864. [Google Scholar] [CrossRef]
- Bentzer, P.; Nielsen, N.; Arner, M.; Danielsen, N.; Ekblad, E.; Lundborg, G.; Arner, A. Supersensitivity in rat micro-arteries after short-term denervation. Acta Physiol. Scand. 1997, 161, 125–133. [Google Scholar] [CrossRef]
- Slovut, D.P.; Mehta, S.H.; Dorrance, A.M.; Brosius, F.C.; Watts, S.W.; Webb, R.C. Increased vascular sensitivity and connexin43 expression after sympathetic denervation. Cardiovasc. Res. 2004, 62, 388–396. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Heumann, P.; Koenen, A.; Zavaritskaya, O.; Schütze, K.; Ramm, A.; Schlüter, T.; Steinbach, A.; Rettig, R.; Schubert, R.; Grisk, O. Sympathetic denervation facilitates L-type Ca2+ channel activation in renal but not in mesenteric resistance arteries. J. Hypertens. 2016, 34, 692–703. [Google Scholar] [CrossRef]
- Dalessandri, K.M.; Giri, S.R.; Robison, T.W.; Hayashi, H.H.; Talken, L. No change in alpha1 adrenoceptors in canine femoral arteries after lumbar sympathectomy. J. Investig. Surg. 1991, 4, 137–140. [Google Scholar] [CrossRef] [PubMed]
- Taki, N.; Tanaka, T.; Zhang, L.; Suzuki, F.; Israilova, M.; Taniguchi, T.; Hiraizumi-Hiraoka, Y.; Shinozuka, K.; Kunitomo, M.; Muramatsu, I. Alpha-1D adrenoceptors are involved in reserpine-induced supersensitivity of rat tail artery. Br. J. Pharmacol. 2004, 142, 647–656. [Google Scholar] [CrossRef][Green Version]
- Tucker, D.C. Components of functional sympathetic control of heart rate in neonatal rats. Am. J. Physiol. Regul. Integr. Comp. Physiol. 1985, 17, R601–R610. [Google Scholar] [CrossRef]
- Molinoff, P.B. α- and β-adrenergic receptor subtypes: Properties, distribution and regulation. Drugs 1984, 28, 1–15. [Google Scholar] [CrossRef] [PubMed]
- Sofronova, S.I.; Gaynullina, D.K.; Martyanov, A.A.; Tarasova, O.S. Endogenous oestrogens do not regulate endothelial nitric oxide production in early postnatal rats. Eur. J. Pharmacol. 2015, 765, 598–605. [Google Scholar] [CrossRef]
- Furness, J.B.; Costa, M. The use of glycoxylic acid for the fluorescence histochemical demonstration of peripheral stores of noradrenaline and 5-hydroxytryptamine in whole mounts. Histochemistry 1975, 41, 335–352. [Google Scholar] [CrossRef] [PubMed]
- Puzdrova, V.A.; Kargina-Terent’eva, R.A.; Tarasova, O.S. Effect of chronic hypotension on the adrenergic nerve plexus of the rat a. saphena and on its regeneration after femoral nerve injury. Morfologiia 2008, 133, 15–19. [Google Scholar]
- Mulvany, M.J.; Halpern, W. Contractile properties of small arterial resistance vessels in spontaneously hypertensive and normotensive rats. Circ. Res. 1977, 41, 19–26. [Google Scholar] [CrossRef]






| Parameters | CON | L-NAME |
|---|---|---|
| NOx, µM (n = 6; 6) | 24.2 ± 2.0 | 16.3 ± 1.5 * |
| Triglycerides, mM (n = 6; 6) | 3.32 ± 0.46 | 3.23 ± 0.25 |
| Total cholesterol, mM (n = 6; 6) | 1.95 ± 0.19 | 2.01 ± 0.13 |
| Parameters | CON | L-NAME |
|---|---|---|
| Two-day-old offspring | ||
| NOx, µM (n = 6; 6) | 70.5 ± 5.4 | 17.3 ± 2.7 * |
| Triglycerides, mM (n = 6; 6) | 1.62 ± 0.34 | 1.32 ± 0.35 |
| Total cholesterol, mM (n = 6; 6) | 2.21 ± 0.28 | 1.61 ± 0.20 |
| 14-day-old offspring | ||
| NOx, µM (n = 6; 6) | 22.3 ± 2.1 | 23.0 ± 2.7 |
| Triglycerides, mM (n = 6; 6) | 1.73 ± 0.18 | 2.46 ± 0.42 |
| Total cholesterol, mM (n = 6; 6) | 3.83 ± 0.23 | 3.70 ± 0.15 |
| Parameters | CON | L-NAME |
|---|---|---|
| pD2 (n = 18;17) | 4.82 ± 0.06 | 5.11 ± 0.05 * |
| Emax, mN (n = 18;17) | 11.5 ± 0.4 | 9.1 ± 0.3 * |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Selivanova, E.K.; Shvetsova, A.A.; Borzykh, A.A.; Gaynullina, D.K.; Kiryukhina, O.O.; Lukoshkova, E.V.; Potekhina, V.M.; Kuzmin, V.S.; Tarasova, O.S. Intrauterine L-NAME Exposure Weakens the Development of Sympathetic Innervation and Induces the Remodeling of Arterial Vessels in Two-Week-Old Rats. Int. J. Mol. Sci. 2021, 22, 12327. https://doi.org/10.3390/ijms222212327
Selivanova EK, Shvetsova AA, Borzykh AA, Gaynullina DK, Kiryukhina OO, Lukoshkova EV, Potekhina VM, Kuzmin VS, Tarasova OS. Intrauterine L-NAME Exposure Weakens the Development of Sympathetic Innervation and Induces the Remodeling of Arterial Vessels in Two-Week-Old Rats. International Journal of Molecular Sciences. 2021; 22(22):12327. https://doi.org/10.3390/ijms222212327
Chicago/Turabian StyleSelivanova, Ekaterina K., Anastasia A. Shvetsova, Anna A. Borzykh, Dina K. Gaynullina, Oxana O. Kiryukhina, Elena V. Lukoshkova, Viktoria M. Potekhina, Vladislav S. Kuzmin, and Olga S. Tarasova. 2021. "Intrauterine L-NAME Exposure Weakens the Development of Sympathetic Innervation and Induces the Remodeling of Arterial Vessels in Two-Week-Old Rats" International Journal of Molecular Sciences 22, no. 22: 12327. https://doi.org/10.3390/ijms222212327
APA StyleSelivanova, E. K., Shvetsova, A. A., Borzykh, A. A., Gaynullina, D. K., Kiryukhina, O. O., Lukoshkova, E. V., Potekhina, V. M., Kuzmin, V. S., & Tarasova, O. S. (2021). Intrauterine L-NAME Exposure Weakens the Development of Sympathetic Innervation and Induces the Remodeling of Arterial Vessels in Two-Week-Old Rats. International Journal of Molecular Sciences, 22(22), 12327. https://doi.org/10.3390/ijms222212327

