Population Genetics of Haliotis discus hannai in China Inferred Through EST-SSR Markers
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals and Sample Collection
2.2. Mining and Primer Design of EST-SSRs
2.3. Screening EST-SSRs for Polymorphism
2.4. Application of EST-SSRs
2.5. Data Analysis
3. Results
3.1. Mining for EST-SSRs from Pacific Abalone Hemolymph Tissue Transcriptome Data
3.2. Validation and Development of Polymorphic EST-SSR Markers
3.3. Genetic Variability of Different Populations
3.4. Population Genetic Structure
4. Discussion
4.1. Population Genetic Variation Analysis
4.2. Population Genetic Structure Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Guo, X.; Ford, S.E.; Zhang, F.S. Molluscan aquaculture in China. J. Shellfish Res. 1999, 18, 19–31. [Google Scholar]
- Wu, F.C.; Que, H.Y.; Zhang, G.F. History, current status, and future development of the Pacific abalone seed release and sea ranching in China. Mar. Sci. 2020, 44, 56–68. [Google Scholar]
- Wu, F.C.; Zhang, G.F. Preliminary study on over-summering of juvenile hybrid Pacific abalone in east Fhjian inner bay. Mar. Sci. 2009, 33, 9–14. [Google Scholar]
- Li, Q.; Shu, J.; Yu, R.H.; Tian, C.Y. Genetic variability of cultured populations of the Pacific abalone (Haliotis discus hannai Ino) in China based on microsatellites. Aquac. Res. 2007, 38, 981–990. [Google Scholar] [CrossRef]
- Primmer, C.R.; Aho, T.; Piironen, J.; Estoup, A.; Cornuet, J.M.; Ranta, E. Microsatellite analysis of hatchery stocks and natural populations of Arctic charr, Salvelinus alpinus, from the Nordic region: Implications for conservation. Hereditas 1999, 130, 277–289. [Google Scholar] [CrossRef]
- Abdul-Muneer, P.M. Application of microsatellite markers in conservation genetics and fisheries management: Recent advances in population structure analysis and conservation strategies. Genet. Res. Int. 2014, 2014, 691759. [Google Scholar] [CrossRef]
- Tautz, D.; Schlötterer, C. Simple sequences. Curr. Opin. Genet. Dev. 1994, 4, 832–837. [Google Scholar] [CrossRef]
- Maia, L.C.D.; Palmieri, D.A.; Souza, V.Q.D.; Kopp, M.M.; Carvalho, F.I.F.D.; Costa de Oliveira, A. SSR locator: Tool for simple sequence repeat discovery integrated with primer design and PCR simulation. Int. J. Plant Genom. 2008, 2008, 412696. [Google Scholar] [CrossRef]
- Yi, T.L.; Guo, W.J.; Liang, X.F.; Yang, M.; Lv, L.Y.; Tian, C.X.; Song, Y.; Zhao, C.; Sun, J. Microsatellite analysis of genetic diversity and genetic structure in five consecutive breeding generations of mandarin fish Siniperca chuatsi (Basilewsky). Genet. Mol. Res. 2015, 14, 2600–2607. [Google Scholar] [CrossRef] [PubMed]
- Cao, Y.Y.; Shangguan, J.B.; Li, Z.B. Population genetic analysis and conservation strategies for redtail shrimp Fenneropenaeus penicillatus using ten microsatellite markers. Genet. Mol. Res. 2017, 16, 108–112. [Google Scholar] [CrossRef]
- Reece, K.S.; Ribeiro, W.L.; Gaffney, P.M.; Carnegie, R.B.; Allen, S.K. Microsatellite marker development and analysis in the eastern oyster (Crassostrea virginica): Confirmation of null alleles and Non-Mendelian segregation ratios. J. Hered. 2004, 95, 346–352. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.M.; Li, J.K.; Xiao, S.J.; Liu, X.D. De novo assembly and characterization of foot transcriptome and microsatellite marker development for Paphia textile. Gene 2016, 576, 537–543. [Google Scholar] [CrossRef]
- Nie, H.T.; Huo, Z.M.; Li, J.; Guo, W.; Yan, X.W. Genetic variation and differentiation in wild and selected manila clam inferred from microsatellite loci. J. Shellfish Res. 2017, 36, 559–565. [Google Scholar] [CrossRef]
- Senan, S.; Kizhakayil, D.; Sasikumar, B.; Sheeja, T.E. Methods for development of microsatellite markers: An overview. Not. Sci. Biol. 2014, 6, 1–13. [Google Scholar] [CrossRef]
- Parthiban, S.; Govindaraj, P.; Senthilkumar, S. Comparison of relative efficiency of genomic SSR and EST-SSR markers in estimating genetic diversity in sugarcane. 3 Biotech 2018, 8, 144. [Google Scholar] [CrossRef]
- Ng, S.H.S.; Chang, A.; Brown, G.D.; Koop, B.F.; Davidson, W.S. Type I microsatellite markers from Atlantic salmon (Salmo salar) expressed sequence tags. Mol. Ecol. Notes 2005, 5, 762–766. [Google Scholar] [CrossRef]
- Varshney, R.K.; Graner, A.; Sorrells, M.E. Genic microsatellite markers in plants: Features and applications. Trends Biotechnol. 2005, 23, 48–55. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.P.; Guo, X.M. Development and characterization of EST-SSR markers in the eastern oyster Crassostrea virginica. Mar. Biotechnol. 2007, 9, 500–511. [Google Scholar] [CrossRef] [PubMed]
- Gupta, P.K.; Rustgi, S. Molecular markers from the transcribed/expressed region of the genome in higher plants. Funct. Integr. Genomic. 2004, 4, 139–162. [Google Scholar] [CrossRef] [PubMed]
- Kucuktas, H.; Wang, S.; Li, P.; He, C.; Xu, P.; Sha, Z.; Liu, H.; Jiang, Y.; Baoprasertkul, P.; Somridhivej, B.; et al. Construction of genetic linkage maps and comparative genome analysis of catfish using Gene-Associated markers. Genetics 2009, 181, 1649–1660. [Google Scholar] [CrossRef]
- Nie, Q.; Yue, X.; Chai, X.L.; Wang, H.X.; Liu, B.Z. Three vibrio-resistance related EST-SSR markers revealed by selective genotyping in the clam Meretrix meretrix. Fish Shellfish Immun. 2013, 35, 421–428. [Google Scholar] [CrossRef] [PubMed]
- Grada, A.; Weinbrecht, K. Next-Generation sequencing: Methodology and application. J. Investig. Dermatol. 2013, 133, 1–4. [Google Scholar] [CrossRef] [PubMed]
- Qin, J.; Huang, Z.X.; Chen, J.; Zou, Q.; You, W.W.; Ke, C.H. Sequencing and de novo analysis of Crassostrea angulata (Fujian oyster) from 8 different developing phases using 454 GSFlx. PLoS ONE 2012, 7, e43653. [Google Scholar] [CrossRef]
- Li, C.J.; Ling, Q.F.; Ge, C.; Ye, Z.Q.; Han, X.F. Transcriptome characterization and SSR discovery in large-scale loach Paramisgurnus dabryanus (Cobitidae, Cypriniformes). Gene 2015, 557, 201–208. [Google Scholar] [CrossRef] [PubMed]
- Ge, J.L.; Chen, S.Q.; Liu, C.L.; Bian, L.; Sun, H.L.; Tan, J. Characterization of the global transcriptome and microsatellite marker information for spotted halibut Verasper variegatus. Genes Genom. 2017, 39, 307–316. [Google Scholar] [CrossRef]
- Wang, W.J.; Wu, B.; Liu, Z.H.; Zhou, L.Q.; Sun, X.J.; Tian, J.T.; Yang, A.G. Development of EST-SSRs from the ark shell (Scapharca broughtonii) transcriptome and their application in genetic analysis of four populations. Genes Genom. 2021, 43, 669–677. [Google Scholar] [CrossRef]
- Schander, C.; Kenneth, H.M. DNA, PCR and formalinized animal tissue–a short review and protocols. Org. Divers. Evol. 2003, 3, 195–205. [Google Scholar] [CrossRef]
- Evanno, G.; Regnaut, S.; Goudet, J. Detecting the number of clusters of individuals using the software structure: A simulation study. Mol. Ecol. 2005, 14, 2611–2620. [Google Scholar] [CrossRef] [PubMed]
- Oksanen, J.; Blanchet, F.G.; Friendly, M.; Kindt, R.; Legendre, P.; McGlinn, D.; Minchin, P.R.; O’Hara, R.B.; Simpson, G.L.; Solymos, P.; et al. Vegan Community Ecology Package Version 2.5-7 November 2020; R Project for Statistical Computing: Vienna, Austria, 2020. [Google Scholar]
- Shen, X.Y.; Kwan, H.Y.; Thevasagayam, N.M.; Prakki, S.R.S.; Kuznetsova, I.S.; Ngoh, S.Y.; Lim, Z.; Feng, F.; Chang, A.; Orbán, L. The first transcriptome and genetic linkage map for Asian arowana. Mol. Ecol. Resour. 2014, 14, 622–635. [Google Scholar] [CrossRef]
- Keong, B.P.; Siraj, S.S.; Daud, S.K.; Panandam, J.M.; Rahman, A.N.A. Identification of quantitative trait locus (QTL) linked to dorsal fin length from preliminary linkage map of molly fish, Poecilia sp. Gene 2014, 536, 114–117. [Google Scholar] [CrossRef] [PubMed]
- Kessuwan, K.; Kubota, S.; Liu, Q.; Sano, M.; Okamoto, N.; Sakamoto, T.; Yamashita, H.; Nakamura, Y.; Ozaki, A. Detection of Growth-Related quantitative trait loci and High-Resolution genetic linkage maps using simple sequence repeat markers in the kelp grouper (Epinephelus bruneus). Mar. Biotechnol. 2016, 18, 57–84. [Google Scholar] [CrossRef] [PubMed]
- Lin, G.; Wang, L.; Ngoh, S.T.; Ji, L.; Orbán, L.; Yue, G.H. Mapping QTL for omega-3 content in hybrid saline tilapia. Mar. Biotechnol. 2018, 20, 10–19. [Google Scholar] [CrossRef] [PubMed]
- Ma, A.; Huang, Z.; Wang, X.A.; Xu, Y.; Guo, X. Identification of quantitative trait loci associated with upper temperature tolerance in turbot, Scophthalmus maximus. Sci. Rep. 2021, 11, 21920. [Google Scholar] [CrossRef] [PubMed]
- Ariede, R.B.; Freitas, M.V.; Hata, M.E.; Mastrochirico-Filho, V.A.; Pilarski, F.; Batlouni, S.R.; Porto-Foresti, F.; Hashimoto, D.T. Microsatellites associated with growth performance and analysis of resistance to Aeromonas hydrophila in tambaqui Colossoma macropomum. Front. Genet. 2018, 9, 3. [Google Scholar] [CrossRef] [PubMed]
- Chen, C.H.; Li, B.J.; Gu, X.H.; Lin, H.R.; Xia, J.H. Marker-assisted selection of YY supermales from a genetically improved farmed tilapia-derived strain. Zool. Res. 2019, 40, 108–112. [Google Scholar] [PubMed]
- Li, L.; Guo, X.M.; Zhang, G.F. Inheritance of 15 microsatellites in the Pacific oyster Crassostrea gigas: Segregation and null allele identification for linkage analysis. Chin. J. Oceanol. Limnol. 2009, 27, 74–79. [Google Scholar] [CrossRef]
- Pan, T.; Zhang, Y.; Gao, T.X.; Li, F.H. Genetic diversity of Pleuronectes yokohamae population revealed by fluorescence microsatellite labeled. Biochem. Syst. Ecol. 2014, 55, 118–124. [Google Scholar] [CrossRef]
- Sekino, M.; Hamaguchi, M.; Aranishi, F.; Okoshi, K. Development of Novel Microsatellite DNA Markers from the Pacific Oyster Crassostrea gigas. Mar. Biotechnol. 2003, 5, 227–233. [Google Scholar] [CrossRef]
- Gu, X.F.; Dong, Y.H.; Yao, H.H.; Zhou, X.L.; Qi, X.Y.; Lin, Z.H. Microsatellite marker analysis reveals the distinction between the north and south groups of hard clam (Meretrix meretrix) in China. Genet. Mol. Res. 2015, 14, 1210–1219. [Google Scholar] [CrossRef]
- Li, Q.; Shu, J.; Zhao, C.; Liu, S.K.; Kong, L.F.; Zheng, X.D. Characterization of genic microsatellite markers derived from expressed sequence tags in Pacific abalone (Haliotis discus hannai). Chin. J. Oceanol. Limn. 2010, 28, 46–54. [Google Scholar] [CrossRef]
- Du, F.K.; Xu, F.; Qu, H.; Feng, S.S.; Tang, J.J.; Wu, R.L. Exploiting the transcriptome of Euphrates Poplar, Populus euphratica (Salicaceae) to develop and characterize new EST-SSR markers and construct an EST-SSR database. PLoS ONE 2013, 8, e61337. [Google Scholar] [CrossRef] [PubMed]
- Xu, F.; Feng, S.S.; Wu, R.L.; Du, F.K. Two highly validated SSR multiplexes (8-plex) for Euphrates’ poplar, Populus euphratica (Salicaceae). Mol. Ecol. Resour. 2013, 13, 144–153. [Google Scholar] [CrossRef] [PubMed]
- Chen, N.; Luo, X.; Wu, F.C.; Mi, C.Z.; You, W.W.; Huang, M.Q.; Ke, C.H. Genetic Structure of Different Cultured Populations of the Pacific Abalone Haliotis discus hannai Ino Inferred from Microsatellite Markers. J. Shellfish Res. 2016, 35, 661–667. [Google Scholar] [CrossRef]
- Park, C.J.; Hara, M.; Lee, J.H.; Noh, J.K.; Kim, H.C.; Park, J.W.; Kim, S.Y. Genetic population structure of the wild Pacific abalone (Haliotis discus) in Korea and Japan based on microsatellite DNA markers. Biochem. Syst. Ecol. 2012, 44, 86–95. [Google Scholar] [CrossRef]
- Zhou, Y.; Tong, J.; Wang, J.; Yu, X. Development of microsatellite markers and genetic diversity in wild and cultured populations of black carp (Mylopharyngodon piceus) along the Yangtze River. Aquac. Int. 2020, 28, 1867–1882. [Google Scholar] [CrossRef]
- Wang, Q.; Wang, X.; Xie, Z.Z.; Li, Y.Q.; Xiao, L.; Peng, C.; Zhang, H.F.; Li, S.S.; Zhang, Y.; Lin, H.R. Microsatellite analysis of the genetic relationships between wild and cultivated giant grouper in the South China Sea. J. Genet. 2016, 95, 369–376. [Google Scholar] [CrossRef]
- Eknath, A.E.; Doyle, R.W. Indirect selection for growth and life-history traits in Indian carp aquaculture. Aquaculture 1985, 49, 73–84. [Google Scholar] [CrossRef]
- Mjoelneroed, I.B.; Refseth, U.H.; Karlsen, E.; Balstad, T.; Jakobsen, K.S.; Hindar, K. Genetic differences between two wild and one farmed population of Atlantic salmon (Salmo salar) revealed by three classes of genetic markers. Hereditas 1997, 127, 239–248. [Google Scholar] [CrossRef]
- Allendorf, F.W.; Phelps, S.R. Loss of genetic variation in a hatchery stock of cutthroat trout. Trans. Am. Fish. Soc. 1980, 109, 537–543. [Google Scholar] [CrossRef]
- Hedgecock, D.; Sly, F. Genetic drift and effective population sizes of hatchery-propagated stocks of the Pacific oyster Crassostrea gigas. Aquaculture 1990, 88, 21–38. [Google Scholar] [CrossRef]
- An, H.S.; Lee, J.W.; Kim, H.C.; Myeong, J. Genetic Characterization of Five Hatchery Populations of the Pacific Abalone (Haliotis discus hannai) Using Microsatellite Markers. Int. J. Mol. Sci. 2011, 12, 4836–4849. [Google Scholar] [CrossRef] [PubMed]
Population | Longitude | Latitude | Sampling Date | Sample Size |
---|---|---|---|---|
ZZ | 117°51′57.72″ | 24°7′58.81″ | 6 November 2020 | 45 |
DL | 121°31′19″ | 38°52′26.43″ | 23 August 2020 | 50 |
RC | 122°33′37.27″ | 37°8′40.55″ | 4 November 2020 | 39 |
TJ | 120°45′42.87″ | 38°9′29.19″ | 23 August 2020 | 50 |
DQ | 120°50′5.05″ | 38°17′54.6″ | 13 March 2021 | 39 |
NH | 120°54′51.41″ | 38°20′59.71″ | 23 August 2020 | 36 |
Searching Item | Number |
---|---|
total number of sequences examined: | 80,032 |
total size of examined sequences (bp): | 1,865,475,499 |
total number of identified SSRs: | 415,996 |
number of SSR containing sequences: | 36,665 |
number of sequences containing more than one SSR: | 22,605 |
number of SSRs present in compound formation: | 102,835 |
mononucleotide: | 82,256 (19.77%) |
dinucleotide: | 160,881 (38.67%) |
trinucleotide: | 62,014 (14.91%) |
tetranucleotide: | 100,776 (24.23%) |
pentanucleotide: | 7816 (1.88%) |
hexanucleotide: | 2253 (0.54%) |
Loci | Primer Sequence | Annealing Temperature | Repeat Motif | Fluorescent Labeling |
---|---|---|---|---|
WXZ-1 | F: GACAGGTCAGCCGAAATTGC R: CCAAATGCCTGTGAATGCCC | 55 °C | (CAA)13 | ROX |
WXZ-2 | F: TGTGACGGTGACCCTTTGTC R: TCTGAGTGTATTTGGTCCGCA | 55 °C | (CAT)12 | TAMRA |
WXZ-3 | F: GGAACCAAACCCAGGTGCTA R: AGTCAAACCCGGAATGCCAG | 55 °C | (CTG)6 | ROX |
WXZ-4 | F: TGGGAGGGATGTACCGCATA R: GGTTTGCCCTCTCCAGACTC | 55 °C | (GCA)13 | TAMRA |
WXZ-5 | F: AAGGAGGCGACTATTGCACC R: TGTTTCCACGTCTGCCAGTT | 55 °C | (CACAC)10 | HEX |
WXZ-6 | F: GGATTGAGGGTTGGGGGATG R: CTTGGCCTGCAAGCTGATTG | 55 °C | (CTA)9 | TAMRA |
WXZ-7 | F: GGAAAGTGCCAAGTGGTGTG R: TACCCTACTGCCCCACCATC | 55 °C | (GAT)15 | ROX |
WXZ-8 | F: GATCTACCAGAGCCCACTGC R: TGACATCGTGAGCTTCGACC | 55 °C | (CAT)9 | FAM |
WXZ-9 | F: CAAAACCACAAGCATGGCGA R: TGCGTTCGACCTGTCAGAAG | 55 °C | (ATC)17 | FAM |
WXZ-10 | F: TCACTGATGTCGATTTTGCGC R: TCCACCTTTGGCGTCAGTTT | 55 °C | (ATT)14 | FAM |
WXZ-11 | F: ACCTCGCATCAACAATCGGT R: CCCCAATCCTGCTTTTTGGC | 55 °C | (TGT)8 | FAM |
WXZ-12 | F: TGACCACAGTGACATCGACA R: CCTGTCATATAACGCGGGGG | 55 °C | (GACA)8 | HEX |
WXZ-13 | F: CGCCATTGCAACTGCGTTAT R: AGTGGAAGCGACACGACAAT | 55 °C | (GAACC)8 | HEX |
Loci | Parameters | Population | |||||
---|---|---|---|---|---|---|---|
DL | NH | DQ | TJ | RC | ZZ | ||
WXZ-1 | Na | 12 | 11 | 14 | 13 | 9 | 10 |
Ne | 4.8868 | 6.4815 | 9.2862 | 5.6761 | 5.6860 | 4.2883 | |
PIC | 0.7800 | 0.8279 | 0.8827 | 0.8080 | 0.8010 | 0.7430 | |
Ho | 0.8478 | 0.6857 | 0.7632 | 0.8367 | 1.0000 | 0.8537 | |
He | 0.8041 | 0.8580 | 0.9042 | 0.8323 | 0.8348 | 0.7763 | |
Fis | −0.0660 | 0.1892 | 0.1447 * | −0.0157 | −0.2134 | −0.1133 | |
F null | 0.0000 | 0.0837 | 0.0714 | 0.0820 | 0.0000 | 0.0000 | |
WXZ-2 | Na | 6 | 6 | 6 | 6 | 6 | 6 |
Ne | 5.3570 | 3.7405 | 4.2250 | 4.7357 | 4.8907 | 3.9918 | |
PIC | 0.7868 | 0.6946 | 0.7339 | 0.7590 | 0.7653 | 0.7194 | |
Ho | 0.9130 | 0.7143 | 0.7692 | 0.8571 | 0.7949 | 0.6818 | |
He | 0.8223 | 0.7433 | 0.7732 | 0.7970 | 0.8059 | 0.7581 | |
Fis | −0.1226 | 0.0251 | −0.0078 | −0.0866 | 0.0008 | 0.0903 | |
F null | 0.0438 | 0.1205 | 0.1284 | 0.0589 | 0.1099 | 0.1783 | |
WXZ-3 | Na | 12 | 14 | 18 | 17 | 10 | 11 |
Ne | 7.6701 | 5.1042 | 6.5786 | 10.5771 | 6.9294 | 8.2915 | |
PIC | 0.8560 | 0.7861 | 0.8371 | 0.8982 | 0.8397 | 0.8680 | |
Ho | 0.9362 | 0.8857 | 0.9211 | 0.9796 | 0.8462 | 0.8605 | |
He | 0.8790 | 0.8157 | 0.8593 | 0.9148 | 0.8668 | 0.8897 | |
Fis | −0.0765 | −0.1015 | −0.0862 | −0.0819 | 0.0111 | 0.0215 * | |
F null | 0.0000 | 0.0019 | 0.0126 | 0.0000 | 0.0000 | 0.0766 | |
WXZ-4 | Na | 7 | 9 | 9 | 9 | 5 | 5 |
Ne | 3.4195 | 2.3330 | 2.0599 | 3.9925 | 2.9194 | 1.5624 | |
PIC | 0.6761 | 0.5478 | 0.4982 | 0.7269 | 0.6081 | 0.3431 | |
Ho | 0.7021 | 0.4118 | 0.2368 | 0.4348 | 0.5641 | 0.3333 | |
He | 0.7152 | 0.5799 | 0.5214 | 0.7578 | 0.6660 | 0.3650 | |
Fis | −0.0077 | 0.2793 * | 0.5397 * | 0.4199 * | 0.1420 | 0.0740 | |
F null | 0.1031 | 0.1800 | 0.2158 | 0.2698 | 0.0412 | 0.0477 | |
WXZ-5 | Na | 11 | 12 | 16 | 13 | 9 | 11 |
Ne | 7.6835 | 6.5860 | 8.1120 | 7.1373 | 5.8500 | 5.8401 | |
PIC | 0.8564 | 0.8322 | 0.8649 | 0.8451 | 0.8065 | 0.8109 | |
Ho | 0.8936 | 0.8857 | 0.8462 | 0.8298 | 0.9231 | 0.7500 | |
He | 0.8792 | 0.8605 | 0.8881 | 0.8691 | 0.8398 | 0.8383 | |
Fis | −0.0273 | −0.0443 | 0.0349 | 0.0350 | −0.1134 | 0.0950 | |
F null | 0.0000 | 0.0234 | 0.0000 | 0.0024 | 0.0000 | 0.0447 | |
WXZ-6 | Na | 8 | 8 | 10 | 11 | 9 | 7 |
Ne | 6.5295 | 5.2326 | 6.0504 | 5.9297 | 5.0417 | 4.7964 | |
PIC | 0.8281 | 0.7835 | 0.8149 | 0.8147 | 0.7773 | 0.7646 | |
Ho | 0.5227 | 0.2667 | 0.4138 | 0.5778 | 0.4848 | 0.4884 | |
He | 0.8566 | 0.8226 | 0.8494 | 0.8407 | 0.8140 | 0.8008 | |
Fis | 0.3827 * | 0.6073 * | 0.5043 * | 0.3050 * | 0.3952 * | 0.3830 * | |
F null | 0.1865 | 0.2985 | 0.2541 | 0.1742 | 0.2247 | 0.3135 | |
WXZ-7 | Na | 7 | 11 | 12 | 10 | 8 | 10 |
Ne | 3.2891 | 4.3286 | 4.1786 | 4.5259 | 4.5134 | 6.5739 | |
PIC | 0.6478 | 0.7431 | 0.7327 | 0.7500 | 0.7493 | 0.8309 | |
Ho | 0.7083 | 0.6857 | 0.7436 | 0.7959 | 0.8974 | 0.8182 | |
He | 0.7033 | 0.7801 | 0.7706 | 0.7871 | 0.7885 | 0.8576 | |
Fis | −0.0178 | 0.1083 | 0.0225 | −0.0217 | −0.1529 | 0.0350 * | |
F null | 0.0000 | 0.0315 | 0.0042 | 0.0000 | 0.0000 | 0.0695 | |
WXZ-8 | Na | 8 | 10 | 9 | 9 | 7 | 9 |
Ne | 5.4468 | 5.3728 | 4.5882 | 5.8561 | 5.0226 | 2.9969 | |
PIC | 0.7929 | 0.7897 | 0.7496 | 0.8078 | 0.7765 | 0.6437 | |
Ho | 0.9167 | 0.8000 | 0.7949 | 0.8571 | 0.7895 | 0.7045 | |
He | 0.8250 | 0.8257 | 0.7922 | 0.8378 | 0.8116 | 0.6740 | |
Fis | −0.1228 | 0.0171 | −0.0164 | −0.0337 | 0.0143 | −0.0574 | |
F null | 0.0000 | 0.0151 | 0.0000 | 0.0000 | 0.0000 | 0.0397 | |
WXZ-9 | Na | 11 | 16 | 13 | 10 | 8 | 8 |
Ne | 5.9689 | 7.8108 | 7.6432 | 5.8418 | 5.2813 | 4.8851 | |
PIC | 0.8126 | 0.8611 | 0.8562 | 0.8077 | 0.7847 | 0.7692 | |
Ho | 0.8958 | 0.8824 | 0.8974 | 0.9184 | 0.8205 | 0.8372 | |
He | 0.8412 | 0.8850 | 0.8805 | 0.8374 | 0.8212 | 0.8047 | |
Fis | −0.0761 | −0.0119 | −0.0325 | −0.1080 | −0.0122 | −0.0527 | |
F null | 0.0000 | 0.0198 | 0.0000 | 0.0000 | 0.0000 | 0.0000 | |
WXZ-10 | Na | 8 | 11 | 9 | 11 | 8 | 8 |
Ne | 4.1143 | 5.7110 | 5.0578 | 5.7235 | 6.4586 | 4.4879 | |
PIC | 0.7221 | 0.8057 | 0.7788 | 0.8026 | 0.8266 | 0.7471 | |
Ho | 0.7708 | 0.7429 | 0.8421 | 0.7755 | 0.7949 | 0.6279 | |
He | 0.7649 | 0.8369 | 0.8130 | 0.8338 | 0.8561 | 0.7863 | |
Fis | −0.0183 | 0.0995 | −0.0496 | 0.0603 | 0.0595 | 0.1921 * | |
F null | 0.0000 | 0.0591 | 0.0000 | 0.0605 | 0.0238 | 0.2029 | |
WXZ-11 | Na | 12 | 11 | 9 | 13 | 9 | 9 |
Ne | 5.9211 | 4.6402 | 3.0022 | 5.7855 | 3.3065 | 3.0156 | |
PIC | 0.8127 | 0.7577 | 0.6277 | 0.8085 | 0.6756 | 0.6346 | |
Ho | 0.8667 | 0.8000 | 0.8108 | 0.7959 | 0.6154 | 0.6818 | |
He | 0.8404 | 0.7959 | 0.6760 | 0.8357 | 0.7066 | 0.6761 | |
Fis | −0.0428 | −0.0198 | −0.2158 | 0.0378 | 0.1178 | −0.0201 | |
F null | 0.0084 | 0.0000 | 0.0000 | 0.0485 | 0.0455 | 0.0239 | |
WXZ-12 | Na | 8 | 8 | 9 | 8 | 7 | 10 |
Ne | 2.9425 | 5.1797 | 5.7723 | 5.5314 | 3.8073 | 5.3672 | |
PIC | 0.6315 | 0.7808 | 0.8046 | 0.7955 | 0.7061 | 0.7900 | |
Ho | 0.5625 | 0.8286 | 0.8462 | 0.7955 | 0.8205 | 0.9535 | |
He | 0.6671 | 0.8186 | 0.8375 | 0.8286 | 0.7469 | 0.8233 | |
Fis | 0.1479 | −0.0268 | −0.0235 | 0.0290 | −0.1128 | −0.1718 | |
F null | 0.1194 | 0.0000 | 0.0286 | 0.1230 | 0.0095 | 0.0000 | |
WXZ-13 | Na | 14 | 13 | 14 | 13 | 10 | 10 |
Ne | 5.4677 | 10.3814 | 9.5063 | 5.2196 | 6.6419 | 5.7705 | |
PIC | 0.8027 | 0.8955 | 0.8858 | 0.7908 | 0.8319 | 0.8044 | |
Ho | 0.5870 | 0.6857 | 0.6154 | 0.5510 | 0.6410 | 0.7727 | |
He | 0.8261 | 0.9168 | 0.9064 | 0.8167 | 0.8605 | 0.8362 | |
Fis | 0.2817 * | 0.2412 * | 0.3123 * | 0.3184 * | 0.2454 * | 0.0653 * | |
F null | 0.1307 | 0.1188 | 0.1656 | 0.1381 | 0.1039 | 0.0406 | |
Average | Na | 9.5385 | 10.7692 | 11.3846 | 11.0000 | 8.0769 | 8.7692 |
Ne | 5.2844 | 5.6079 | 5.8508 | 5.8871 | 5.1038 | 4.7590 | |
Ho | 0.7787 | 0.7135 | 0.7308 | 0.7696 | 0.7686 | 0.7203 | |
He | 0.8019 | 0.8107 | 0.8055 | 0.8299 | 0.8014 | 0.7605 |
Population | DL | ZZ | NH | DQ | RC | TJ |
---|---|---|---|---|---|---|
DL | 0.2937 | 0.2718 | 0.2399 | 0.219 | 0.1133 | |
ZZ | 0.0992 ** | 0.229 | 0.1826 | 0.4167 | 0.2533 | |
NH | 0.0759 ** | 0.0728 ** | 0.0511 | 0.3175 | 0.2099 | |
DQ | 0.0685 ** | 0.0608 ** | 0 | 0.3131 | 0.1766 | |
RC | 0.0661 ** | 0.1334 ** | 0.1007 ** | 0.0869 ** | 0.2688 | |
TJ | 0.0271 ** | 0.0783 ** | 0.0514 ** | 0.0439 ** | 0.0736 ** |
Groups | Source of Variation | Degree of Freedom | Sum of Squares | Variance Component | Source of Variation | p-Value |
---|---|---|---|---|---|---|
6 populations | Among populations | 5 | 119.157 | 0.214 | 4% | |
Among individuals | 248 | 1427.921 | 0.489 | 9% | ||
Within individuals | 254 | 1214.000 | 4.780 | 87% | ||
Total | 507 | 2761.079 | 5.483 | 100% | 0.001 | |
6 populations, divided into wild group and cultured group | Among populations | 1 | 14.957 | 0.067 | 1% | |
Among individuals | 252 | 1532.121 | 0.650 | 12% | ||
Within individuals | 254 | 1214.000 | 4.780 | 87% | ||
Total | 507 | 2761.079 | 5.497 | 100% | 0.001 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yang, H.; Wu, Z.; Ge, G.; Sun, X.; Wu, B.; Liu, Z.; Yu, T.; Zheng, Y.; Zhou, L. Population Genetics of Haliotis discus hannai in China Inferred Through EST-SSR Markers. Genes 2025, 16, 73. https://doi.org/10.3390/genes16010073
Yang H, Wu Z, Ge G, Sun X, Wu B, Liu Z, Yu T, Zheng Y, Zhou L. Population Genetics of Haliotis discus hannai in China Inferred Through EST-SSR Markers. Genes. 2025; 16(1):73. https://doi.org/10.3390/genes16010073
Chicago/Turabian StyleYang, Hongsu, Zhou Wu, Guangyu Ge, Xiujun Sun, Biao Wu, Zhihong Liu, Tao Yu, Yanxin Zheng, and Liqing Zhou. 2025. "Population Genetics of Haliotis discus hannai in China Inferred Through EST-SSR Markers" Genes 16, no. 1: 73. https://doi.org/10.3390/genes16010073
APA StyleYang, H., Wu, Z., Ge, G., Sun, X., Wu, B., Liu, Z., Yu, T., Zheng, Y., & Zhou, L. (2025). Population Genetics of Haliotis discus hannai in China Inferred Through EST-SSR Markers. Genes, 16(1), 73. https://doi.org/10.3390/genes16010073