Meat Characteristics, Expression of Myosin Heavy Chain and Metabolism-Related Genes in Thai Native Pigs
Abstract
1. Introduction
2. Materials and Methods
2.1. Pig Husbandry and Slaughtering
2.2. Muscle Sampling
2.3. Gene Expression
2.3.1. RNA Extraction and cDNA Synthesis
2.3.2. Quantitative Real-Time PCR
2.3.3. Chemical Composition and Glycogen Analysis
2.3.4. Ribonucleotide Analysis
2.3.5. Meat Quality Analysis
2.3.6. Sarcomere Length and Muscle Fiber Diameter Measurement
2.3.7. Fatty Acids Analysis
2.3.8. Statistical Analysis
3. Results
3.1. Expression of Myosin Heavy Chain and Metabolism-Related Genes
3.2. Chemical Composition, Glycogen and Ribonucleotide Contents
3.3. Meat Quality Characteristics
3.4. Muscle Fatty Acids
3.5. Principal Component Analysis
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Nakai, S. Decision-making on the use of diverse combinations of agricultural products and natural plants in pig feed: A case study of native pig smallholder in northern Thailand. Trop. Anim. Health Prod. 2008, 40, 201–208. [Google Scholar] [CrossRef] [PubMed]
- Szyndler-Nędza, M.; Świątkiewicz, M.; Migdał, Ł.; Migdał, W. The quality and health-promoting value of meat from pigs of the native breed as the effect of extensive feeding with acorns. Animals 2021, 11, 789. [Google Scholar] [CrossRef] [PubMed]
- Kasprzyk, A.; Walenia, A. Native Pig Breeds as a Source of Biodiversity—Breeding and Economic Aspects. Agriculture 2023, 13, 1528. [Google Scholar] [CrossRef]
- Debrecéni, O.; Lípová, P.; Bučko, O.; Cebulska, A.; Kapelánski, W. Effect of pig genotypes from Slovak and Polish breeds on meat quality. Arch. Anim. Breed. 2018, 61, 99–107. [Google Scholar] [CrossRef]
- Department of Livestock Development. Information of Pig Farmers, Fiscal Year. 2021. Available online: https://ict.dld.go.th/webnew/images/stories/stat_web/yearly/2564/country/5-pig.pdf (accessed on 10 October 2023).
- Chaweewan, K.; Mahinchai, P.; Kongsook, S.; Soponchit, S.; Weerasamith, P.; Awiruttapanich, W.; Prapawat, P.; Jamparat, W.; Chanthaworn, T.; Rattanamahavichai, N. Genetic Divergence of Thai Indigenous Pigs from Three Distinct Geographic Regions Revealed by Microsatellite Marker Analysis. Animals 2023, 13, 625. [Google Scholar] [CrossRef] [PubMed]
- Information and Communication Technology Center, Department of Livestock Development (DLD). Available online: https://ict.dld.go.th/webnew/index.php/th/service-ict/report/413-report-thailand-livestock/reportservey2566/1800-province-2023 (accessed on 24 April 2024).
- Kim, G.; Overholt, M.; Lowell, J.; Harsh, B.; Klehm, B.; Dilger, A.; Boler, D. Evaluation of muscle fiber characteristics based on muscle fiber volume in porcine longissimus muscle in relation to pork quality. Meat. Muscle Bio. 2018, 2, 362–374. [Google Scholar] [CrossRef]
- LeMaster, M.N.; Ha, M.; Dunshea, F.R.; Chauhan, S.; D’Souza, D.; Warner, R.D. Impact of cooking temperature on pork longissimus, and muscle fibre type, on quality traits and protein denaturation of four pork muscles. Meat Sci. 2024, 209, 109395. [Google Scholar] [CrossRef] [PubMed]
- Chang, K.; Da Costa, N.; Blackley, R.; Southwood, O.; Evans, G.; Plastow, G.; Wood, J.; Richardson, R. Relationships of myosin heavy chain fibre types to meat quality traits in traditional and modern pigs. Meat Sci. 2003, 64, 93–103. [Google Scholar] [CrossRef] [PubMed]
- Wimmers, K.; Ngu, N.; Jennen, D.; Tesfaye, D.; Murani, E.; Schellander, K.; Ponsuksili, S. Relationship between myosin heavy chain isoform expression and muscling in several diverse pig breeds. J. Anim. Sci. 2008, 86, 795–803. [Google Scholar] [CrossRef]
- Aalhus, J.L.; Robertson, W.; Ye, J. Muscle fiber characteristics and their relation to meat quality. In Applied Muscle Biology and Meat Science; CRC Press: Boca Raton, FL, USA, 2009; pp. 97–114. [Google Scholar]
- Lee, C.W.; Lee, J.R.; Kim, M.K.; Jo, C.; Lee, K.H.; You, I.; Jung, S. Quality improvement of pork loin by dry aging. Korean J. Food Sci. Anim. Resour. 2016, 36, 369. [Google Scholar] [CrossRef]
- Eom, J.-U.; Seo, J.-K.; Song, S.; Kim, G.-D.; Yang, H.-S. Comparison of Chemical Composition, Quality, and Muscle Fiber Characteristics between Cull Sows and Commercial Pigs: The Relationship between Pork Quality Based on Muscle Fiber Characteristics. Food Sci. Anim. Resour. 2024, 44, 87. [Google Scholar] [CrossRef] [PubMed]
- Song, B.; Cheng, Y.; Azad, M.A.K.; Ding, S.; Yao, K.; Kong, X. Muscle characteristics comparison and targeted metabolome analysis reveal differences in carcass traits and meat quality of three pig breeds. Food Funct. 2023, 14, 7603–7614. [Google Scholar] [CrossRef]
- Xu, Y.; Jin, M.; Wang, L.; Zhang, A.; Zuo, B.; Xu, D.; Ren, Z.; Lei, M.; Mo, X.; Li, F. Differential proteome analysis of porcine skeletal muscles between Meishan and Large White. J. Anim. Sci. 2009, 87, 2519–2527. [Google Scholar] [CrossRef] [PubMed]
- Hamill, R.M.; Aslan, O.; Mullen, A.M.; O’Doherty, J.V.; McBryan, J.; Morris, D.G.; Sweeney, T. Transcriptome analysis of porcine M. semimembranosus divergent in intramuscular fat as a consequence of dietary protein restriction. BMC Genom. 2013, 14, 1–14. [Google Scholar] [CrossRef]
- Lebret, B.; Dourmad, J.-Y.; Mourot, J.; Pollet, P.-Y.; Gondret, F. Production performance, carcass composition, and adipose tissue traits of heavy pigs: Influence of breed and production system. J. Anim. Sci. 2014, 92, 3543–3556. [Google Scholar] [CrossRef]
- Xu, C.; Wang, Y.; Huang, Y.; Liu, J.; Feng, J. Postnatal expression pattern of adipose type fatty acid binding protein in different adipose tissues of porcine. Asian-Australas. J. Anim. Sci. 2007, 20, 811–816. [Google Scholar] [CrossRef]
- Benítez, R.; Trakooljul, N.; Núñez, Y.; Isabel, B.; Murani, E.; De Mercado, E.; Gómez-Izquierdo, E.; García-Casco, J.; López-Bote, C.; Wimmers, K. Breed, diet, and interaction effects on adipose tissue transcriptome in iberian and duroc pigs fed different energy sources. Genes 2019, 10, 589. [Google Scholar] [CrossRef]
- Poklukar, K.; Čandek-Potokar, M.; Batorek Lukač, N.; Tomažin, U.; Škrlep, M. Lipid deposition and metabolism in local and modern pig breeds: A review. Animals 2020, 10, 424. [Google Scholar] [CrossRef] [PubMed]
- Kiczak, L.; Tomaszek, A.; Pasławska, U.; Bania, J.; Noszczyk-Nowak, A.; Skrzypczak, P.; Pasławski, R.; Zacharski, M.; Janiszewski, A.; Kuropka, P. Sex differences in porcine left ventricular myocardial remodeling due to right ventricular pacing. Biol. Sex Differ. 2015, 6, 1–16. [Google Scholar] [CrossRef]
- Hemmings, K.; Parr, T.; Daniel, Z.; Picard, B.; Buttery, P.; Brameld, J. Examination of myosin heavy chain isoform expression in ovine skeletal muscles. J. Anim. Sci. 2009, 87, 3915–3922. [Google Scholar] [CrossRef][Green Version]
- AOAC Association of Official Analytical Chemists. Official Methods of Analysis of the Association Official Analytical Chemists, 16th ed.; AOAC, Inc.: Arlington, VA, USA, 1995. [Google Scholar]
- Dreiling, C.; Brown, D.; Casale, L.; Kelly, L. Muscle glycogen: Comparison of iodine binding and enzyme digestion assays and application to meat samples. Meat Sci. 1987, 20, 167–177. [Google Scholar] [CrossRef] [PubMed]
- Chaosap, C.; Lukkananukool, A.; Polyorach, S.; Sommart, K.; Sivapirunthep, P.; Limsupavanich, R. Effects of dietary energy density in a fermented total mixed ration formulated with different ratios of rice straw and cassava pulp on 2-or 14-day-aged meat quality, collagen, fatty acids, and ribonucleotides of native Thai cattle longissimus muscle. Foods 2022, 11, 2046. [Google Scholar] [CrossRef]
- Cross, H.; West, R.; Dutson, T. Comparison of methods for measuring sarcomere length in beef semitendinosus muscle. Meat Sci. 1981, 5, 261–266. [Google Scholar] [CrossRef] [PubMed]
- Ulbricht, T.L.V.; Southgate, D.A.T. Coronary heart disease: Seven dietary factors. Lancet 1991, 338, 985–992. [Google Scholar] [CrossRef]
- Chaosap, C.; Sivapirunthep, P.; Sitthigripong, R.; Tavitchasri, P.; Maduae, S.; Kusee, T.; Setakul, J.; Adeyemi, K. Meat quality, post-mortem proteolytic enzymes, and myosin heavy chain isoforms of different Thai native cattle muscles. Animal Biosci. 2021, 34, 1514. [Google Scholar] [CrossRef]
- Andrés, A.I.; Cava, R.; Mayoral, A.I.; Tejeda, J.F.; Morcuende, D.; Ruiz, J. Oxidative stability and fatty acid composition of pig muscles as affected by rearing system, crossbreeding and metabolic type of muscle fibre. Meat Sci. 2001, 59, 39–47. [Google Scholar] [CrossRef]
- Guo, J.; Shan, T.; Wu, T.; Zhu, L.; Ren, Y.; An, S.; Wang, Y. Comparisons of different muscle metabolic enzymes and muscle fiber types in Jinhua and Landrace pigs. J. Anim. Sci. 2011, 89, 185–191. [Google Scholar] [CrossRef]
- Anderson, M.J.; Lonergan, S.M.; Huff-Lonergan, E. Differences in phosphorylation of phosphoglucomutase 1 in beef steaks from the longissimus dorsi with high or low star probe values. Meat Sci. 2014, 96, 379–384. [Google Scholar] [CrossRef]
- Bai, Y.; Ren, C.; Hou, C.; Chen, L.; Wang, Z.; Li, X.; Zhang, D. Phosphorylation and acetylation responses of glycolytic enzymes in meat to different chilling rates. Food Chem. 2023, 421, 135896. [Google Scholar] [CrossRef]
- Fortin, A.; Robertson, W.; Tong, A. The eating quality of Canadian pork and its relationship with intramuscular fat. Meat Sci. 2005, 69, 297–305. [Google Scholar] [CrossRef]
- Liu, Y.; Kong, X.; Jiang, G.; Tan, B.E.; Deng, J.; Yang, X.; Li, F.; Xiong, X.; Yin, Y. Effects of dietary protein/energy ratio on growth performance, carcass trait, meat quality, and plasma metabolites in pigs of different genotypes. J. Anim. Sci. Biotechnol. 2015, 6, 1–10. [Google Scholar] [CrossRef]
- Zhang, Y.; Zhang, Y.; Li, H.; Guo, T.; Jia, J.; Zhang, P.; Wang, L.; Xia, N.; Qian, Q.; Peng, H. Comparison of Nutrition and Flavor Characteristics of Five Breeds of Pork in China. Foods 2022, 11, 2704. [Google Scholar] [CrossRef]
- Choe, J.; Choi, Y.; Lee, S.; Shin, H.; Ryu, Y.; Hong, K.; Kim, B. The relation between glycogen, lactate content and muscle fiber type composition, and their influence on postmortem glycolytic rate and pork quality. Meat Sci. 2008, 80, 355–362. [Google Scholar] [CrossRef] [PubMed]
- Tikk, M.; Tikk, K.; Tørngren, M.A.; Meinert, L.; Aaslyng, M.D.; Karlsson, A.H.; Andersen, H.J. Development of inosine monophosphate and its degradation products during aging of pork of different qualities in relation to basic taste and retronasal flavor perception of the meat. J. Agri. Food Chem. 2006, 54, 7769–7777. [Google Scholar] [CrossRef] [PubMed]
- Muroya, S.; Oe, M.; Ojima, K.; Watanabe, A. Metabolomic approach to key metabolites characterizing postmortem aged loin muscle of Japanese Black (Wagyu) cattle. Asian-Australas. J. Anim. Sci. 2019, 32, 1172. [Google Scholar] [CrossRef]
- Matoba, T.; Kuchiba, M.; Kimura, M.; Hasegawa, K. Thermal degradation of flavor enhancers, inosine 5′-monophosphate, and guanosine 5-monophosphate in aqueous solution. J. Food Sci. 1988, 53, 1156–1159. [Google Scholar] [CrossRef]
- Ali, M.; Baek, K.H.; Lee, S.Y.; Kim, H.C.; Park, J.Y.; Jo, C.; Jung, J.H.; Park, H.C.; Nam, K.C. Comparative meat qualities of Boston butt muscles (M. subscapularis) from different pig breeds available in Korean market. Food Sci. Anim. Resour. 2021, 41, 71–84. [Google Scholar] [CrossRef]
- Adeyemi, K.D.; Shittu, R.M.; Sabow, A.B.; Abubakar, A.A.; Karim, R.; Karsani, S.A.; Sazili, A.Q. Comparison of myofibrillar protein degradation, antioxidant profile, fatty acids, metmyoglobin reducing activity, physicochemical properties and sensory attributes of Gluteus medius and Infraspinatus muscles in goats. J. Anim. Sci. Technol. 2016, 58, 1–17. [Google Scholar] [CrossRef]
- Huff-Lonergan, E.; Lonergan, S.M. Mechanisms of water-holding capacity of meat: The role of postmortem biochemical and structural changes. Meat Sci. 2005, 71, 194–204. [Google Scholar] [CrossRef]
- Ertbjerg, P.; Puolanne, E. Muscle structure, sarcomere length and influences on meat quality: A review. Meat Sci. 2017, 132, 139–152. [Google Scholar] [CrossRef] [PubMed]
- Madeira, M.S.; Pires, V.M.; Alfaia, C.M.; Costa, A.S.; Luxton, R.; Doran, O.; Bessa, R.J.; Prates, J.A. Differential effects of reduced protein diets on fatty acid composition and gene expression in muscle and subcutaneous adipose tissue of Alentejana purebred and Large White× Landrace× Pietrain crossbred pigs. Br. J. Nutr. 2013, 110, 216–229. [Google Scholar] [CrossRef] [PubMed]
- Garrido, N.; Izquierdo, M.; Hernández-García, F.I.; Núñez, Y.; García-Torres, S.; Benítez, R.; Padilla, J.Á.; Óvilo, C. Differences in Muscle Lipogenic Gene Expression, Carcass Traits and Fat Deposition among Three Iberian Pig Strains Finished in Two Different Feeding Systems. Animals 2023, 13, 1138. [Google Scholar] [CrossRef]
- Wood, J.; Enser, M.; Fisher, A.; Nute, G.; Sheard, P.; Richardson, R.; Hughes, S.; Whittington, F. Fat deposition, fatty acid composition and meat quality: A review. Meat Sci. 2008, 78, 343–358. [Google Scholar] [CrossRef]
- Yi, W.; Huang, Q.; Wang, Y.; Shan, T. Lipo-Nutritional Quality of Pork: The Lipid Composition, Regulation, and Molecular Mechanisms of Fatty Acid Deposition. Anim. Nutr. 2023, 13, 373–385. [Google Scholar] [CrossRef]
- Adeyemi, K.D.; Abdulrahman, A.; Ibrahim, S.O.; Zubair, M.F.; Atolani, O.; Badmos, A.A. Dietary supplementation of Tetracarpidium conophorum (African Walnut) seed enhances muscle n-3 fatty acids in broiler chickens. Eur. J. Lipid Sci. Technol. 2020, 122, 1900418. [Google Scholar] [CrossRef]
- UK Department of Health. Report on health and social subjects No. 46. In Nutritional Aspects of Cardiovascular Disease; HMSO: London, UK, 1994. [Google Scholar]
- World Health Organization. Interim summary of conclusions and dietary recommendations on total fat and fatty acids. In Joint FAO/WHO Expert Consultation on Fats and Fatty Acids in Human Nutrition, 10 to 14 November; World Health Organization: Geneva, Switzerland, 2008. [Google Scholar]
- Nevrkla, P.; Kapelański, W.; Václavková, E.; Hadaš, Z.; Cebulska, A.; Horký, P. Meat quality and fatty acid profile of pork and backfat from an indigenous breed and a commercial hybrid of pigs. Ann. Anim. Sci. 2017, 17, 1215–1227. [Google Scholar] [CrossRef]
- Reggiani, C.; Mascarello, F. Fibre Type Identification and functional characterization in adult livestock animals. In Muscle Development of Livestock Animals, Physiology, Genetics and Meat Quality; Te Pas, M.F.W., Everts, M.E., Haagsman, H.P., Eds.; CABI Publishing: Cambridge, UK, 2004; pp. 39–62. [Google Scholar]
- Enser, M.; Hallett, K.G.; Hewett, B.; Fursey, G.A.J.; Wood, J.D.; Harrington, G. Fatty acid content and composition of UK beef and lamb muscle in relation to production system and implications for human nutrition. Meat Sci. 1998, 49, 329–341. [Google Scholar] [CrossRef]
- Shi-Zheng, G.; Su-Mei, Z. Physiology, affecting factors and strategies for control of pig meat intramuscular fat. Recent Patents on Food, Nutr Agr. 2008, 1, 59–74. [Google Scholar]
- Kim, J.M.; Lee, S.H.; Ryu, Y.C. Comparisons of meat quality and muscle fibre characteristics on multiple pig breeds and sexes using principal component analysis. Anim. Prod. Sci. 2017, 58, 2091–2099. [Google Scholar] [CrossRef]

| Gene 1 | Primer Sequence (5′ to 3′) | Annealing Temperature, °C | Accession No. | Reference | |
|---|---|---|---|---|---|
| MyHC I | Forward: | AAGGGCTTGAACGAGGAGTAGA | 60 | AB053226 | [11] |
| Reverse: | TTATTCTGCTTCCTCCAAAGGG | ||||
| MyHC IIA | Forward: | GCTGAGCGAGCTGAAATCC | 60 | AB025260 | |
| Reverse: | ACTGAGACACCAGAGCTTCT | ||||
| MyHC IIX | Forward: | AGAAGATCAACTGAGTGAACT | 60 | AB025262 | |
| Reverse: | AGAGCTGAGAAACTAACGTG | ||||
| MyHC IIB | Forward: | ATGAAGAGGAACCACATTA | 57 | AB025261 | |
| Reverse: | TTATTGCCTCAGTAGCTTG | ||||
| A-FABP | Forward: | TACTGAGATTGCCTTCAAATTGGG | 60 | - | [19] |
| Reverse: | TCTGGTAGCCGTGACACCTTTC | ||||
| TPI−1 | Forward: | GCCAAATAATAAGCCACATCCA | 56 | gi|194042634 | [16] |
| Reverse: | AGGCGACACCATCAGAAGCA | ||||
| PGAM−1 | Forward: | GATGTGGTACGTCCCTCTGC | 60 | gi|374694 | |
| Reverse: | GGCACTTACAGGCGTATTCAG | ||||
| cGPD | Forward: | TGTGATGGGCTGGGCTTTG | 60 | gi|2149958 | |
| Reverse: | GTGATGAGGTCGGCGATGC | ||||
| GAPDH | Forward: | TCACTGCCACCCAGAAGA | 65 | ABO38240 | [22] |
| Reverse: | TACCAGGAAATGAGCTTGAC |
| Gene 1 | Geographical Region (GR) | RMSE | p Value | ||
|---|---|---|---|---|---|
| NT | ST | NE | |||
| MyHC I 2 | 0.53 | 0.24 | 0.55 | 0.63 | 0.473 |
| MyHC IIa 2 | 3.41 | 8.92 | 3.79 | 5.17 | 0.058 |
| MyHC IIx 2 | 71.90 | 67.86 | 73.27 | 10.87 | 0.522 |
| MyHC IIb 2 | 24.14 | 23.37 | 22.37 | 8.79 | 0.894 |
| A-FABP 3 | 1.04 | 1.10 | 1.51 | 0.71 | 0.271 |
| TPI−1 3 | 1.05 | 0.82 | 0.72 | 0.37 | 0.163 |
| PGAM−1 3 | 1.42 | 1.11 | 1.00 | 0.73 | 0.407 |
| cGPD 3 | 1.50 | 1.75 | 1.38 | 0.85 | 0.631 |
| Trait | Geographical Region (GR) | RMSE | p Value | ||
|---|---|---|---|---|---|
| NT | ST | NE | |||
| Fat (%) | 3.07 | 3.55 | 3.35 | 1.13 | 0.575 |
| Moisture (%) | 71.98 | 70.97 | 71.40 | 1.48 | 0.221 |
| Glycogen (mg/g wet weight) | 55.22 a | 28.12 b | 18.22 b | 13.17 | <0.0001 |
| Ribonucleotides (mg/100 g) | |||||
| Hypoxanthine | 2.03 b | 5.46 a | 4.31 a | 2.09 | 0.004 |
| Inosine | 15.10 b | 55.30 a | 41.17 a | 16.81 | 0.0001 |
| Inosine monophosphate | 144.43 b | 284.98 a | 277.37 a | 77.07 | 0.003 |
| Guanosine monophosphate | 2.41 | 2.65 | 2.16 | 1.24 | 0.748 |
| Trait | Geographical Region (GR) | RMSE | p Value | ||
|---|---|---|---|---|---|
| NT | ST | NE | |||
| pH45 | 6.09 | 6.18 | 6.30 | 0.34 | 0.264 |
| pH24 | 5.48 b | 5.56 ab | 5.66 a | 0.12 | 0.002 |
| L* | 56.65 | 57.70 | 55.09 | 1.84 | 0.055 |
| a* | 5.71 a | 4.21 b | 6.22 a | 1.52 | 0.012 |
| b* | 14.83 | 15.06 | 14.22 | 2.34 | 0.666 |
| Cooking loss (%) | 20.79 a | 14.87 b | 14.86 b | 3.06 | <0.0001 |
| Shear force (kg) | 5.67 | 5.04 | 5.74 | 1.31 | 0.374 |
| Muscle fiber diameter (µ) | 48.63 | 53.28 | 53.51 | 7.24 | 0.131 |
| Sarcomere length (µ) | 1.83 b | 1.95 a | 1.93 a | 0.09 | 0.002 |
| Fatty Acid | Geographical Region (GR) | RMSE | p Value | ||
|---|---|---|---|---|---|
| NT | ST | NE | |||
| C14:0 | 1.83 | 1.64 | 1.69 | 0.37 | 0.466 |
| C16:0 | 17.22 b | 20.89 ab | 23.39 a | 4.39 | 0.009 |
| C16:1 | 9.43 | 8.14 | 7.62 | 2.12 | 0.126 |
| C18:0 | 9.63 | 10.87 | 11.61 | 3.73 | 0.436 |
| C18:1n9c | 39.82 | 45.44 | 42.24 | 6.58 | 0.154 |
| C18:2n6c | 17.14 a | 9.17 b | 9.63 b | 4.87 | 0.001 |
| C18:3n3 | 0.47 | 0.47 | 0.65 | 0.40 | 0.454 |
| C20:4n6 | 3.04 a | 1.44 b | 1.69 b | 0.84 | 0.0003 |
| C20:1 | 1.02 | 1.56 | 1.15 | 0.61 | 0.118 |
| C20:2 | 0.40 | 0.36 | 0.31 | 0.19 | 0.539 |
| ∑n-3 | 0.47 | 0.47 | 0.65 | 0.40 | 0.454 |
| ∑n-6 | 20.18 a | 10.61 | 11.32 | 3.21 | 0.002 |
| SFA | 28.68 b | 33.41 a | 36.70 a | 5.17 | 0.004 |
| MUFA | 50.27 | 55.14 | 51.01 | 7.00 | 0.236 |
| PUFA | 21.04 a | 11.45 b | 12.29 b | 6.08 | 0.002 |
| P:S | 0.75 a | 0.34 b | 0.34 b | 0.24 | 0.0004 |
| n-6/n-3 | 42.93 a | 22.57 b | 17.41 b | 6.23 | 0.005 |
| Atherogenicity index | 0.30 b | 0.41 a | 0.47 a | 0.06 | 0.003 |
| Thrombogenicity index | 0.77 b | 0.97 a | 1.10 a | 0.09 | 0.001 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chaosap, C.; Chaweewan, K.; Adeyemi, K.D.; Phonkate, N.; Sitthigripong, R. Meat Characteristics, Expression of Myosin Heavy Chain and Metabolism-Related Genes in Thai Native Pigs. Foods 2024, 13, 1502. https://doi.org/10.3390/foods13101502
Chaosap C, Chaweewan K, Adeyemi KD, Phonkate N, Sitthigripong R. Meat Characteristics, Expression of Myosin Heavy Chain and Metabolism-Related Genes in Thai Native Pigs. Foods. 2024; 13(10):1502. https://doi.org/10.3390/foods13101502
Chicago/Turabian StyleChaosap, Chanporn, Kamon Chaweewan, Kazeem D. Adeyemi, Netanong Phonkate, and Ronachai Sitthigripong. 2024. "Meat Characteristics, Expression of Myosin Heavy Chain and Metabolism-Related Genes in Thai Native Pigs" Foods 13, no. 10: 1502. https://doi.org/10.3390/foods13101502
APA StyleChaosap, C., Chaweewan, K., Adeyemi, K. D., Phonkate, N., & Sitthigripong, R. (2024). Meat Characteristics, Expression of Myosin Heavy Chain and Metabolism-Related Genes in Thai Native Pigs. Foods, 13(10), 1502. https://doi.org/10.3390/foods13101502

