H2AJ Is a Direct Androgen Receptor Target Gene That Regulates Androgen-Induced Cellular Senescence and Inhibits Mesenchymal Markers in Prostate Cancer Cells
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture and Treatments
2.2. siRNA and Overexpression-Vector Transfection of H2AJ
2.3. Senescence Associated β-Galactosidase Activity Staining
2.4. Growth Assays
2.5. RNA Extraction and Reverse Transcription-Quantitative Real-Time PCR (qRT-PCR)
2.6. Protein Extraction and Western Blotting
2.7. Chromatin Immunoprecipitation-q-PCR
2.8. Immunofluorescence Staining
2.9. Public Data Availability
2.10. Bioinformatics and Statistical Analyses
3. Results
3.1. H2AJ Is a Direct Target of AR and Specifically Is Expressed in C4-2 Cells
3.2. H2AJ KD Reduces Growth and Induces Cellular Senescence Through the p21WAF1/Cip1 Cyclin-Dependent Kinase Inhibitor
3.3. H2AJ KD Increases the Formation of Senescence Associated Heterochromatin Foci (SAHF) and Expression of Mesenchymal Markers
3.4. Overexpression of H2AJ in LNCaP Cell Line Reduces Cellular Senescence and Induces Cell Growth
3.5. Bioinformatic Analyses Revealed a Large Overlap of H2AJ Transcriptome with the Cellular Senescence Score of PCa
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
References
- Siegel, D.A.; O’Neil, M.E.; Richards, T.B.; Dowling, N.F.; Weir, H.K. Prostate Cancer Relative Survival by Stage and Race/Ethnicity, United States, 2001 to 2015; American Society of Clinical Oncology: Alexandria, VA, USA, 2020. [Google Scholar]
- Fujita, K.; Nonomura, N. Role of androgen receptor in prostate cancer: A review. World J. Men’s Health 2019, 37, 288–295. [Google Scholar] [CrossRef] [PubMed]
- Aurilio, G.; Cimadamore, A.; Mazzucchelli, R.; Lopez-Beltran, A.; Verri, E.; Scarpelli, M.; Massari, F.; Cheng, L.; Santoni, M.; Montironi, R. Androgen receptor signaling pathway in prostate cancer: From genetics to clinical applications. Cells 2020, 9, 2653. [Google Scholar] [CrossRef] [PubMed]
- Harris, W.P.; Mostaghel, E.A.; Nelson, P.S.; Montgomery, B. Androgen deprivation therapy: Progress in understanding mechanisms of resistance and optimizing androgen depletion. Nat. Clin. Pract. Urol. 2009, 6, 76–85. [Google Scholar] [CrossRef] [PubMed]
- Denmeade, S.; Antonarakis, E.S.; Markowski, M.C. Bipolar androgen therapy (BAT): A patient’s guide. Prostate 2022, 82, 753–762. [Google Scholar] [CrossRef]
- Nabavi, N.; Mahdavi, S.R.; Ardalan, M.A.; Chamanara, M.; Mosaed, R.; Lara, A.; Bastos, D.; Harsini, S.; Askari, E.; Velho, P.I. Bipolar androgen therapy: When excess fuel extinguishes the fire. Biomedicines 2023, 11, 2084. [Google Scholar] [CrossRef]
- Markowski, M.C.; Taplin, M.-E.; Aggarwal, R.; Sena, L.A.; Wang, H.; Qi, H.; Lalji, A.; Sinibaldi, V.; Carducci, M.A.; Paller, C.J. Bipolar androgen therapy plus nivolumab for patients with metastatic castration-resistant prostate cancer: The COMBAT phase II trial. Nat. Commun. 2024, 15, 14. [Google Scholar] [CrossRef]
- Denmeade, S.R.; Wang, H.; Agarwal, N.; Smith, D.C.; Schweizer, M.T.; Stein, M.N.; Assikis, V.; Twardowski, P.W.; Flaig, T.W.; Szmulewitz, R.Z.; et al. TRANSFORMER: A randomized phase II study comparing bipolar androgen therapy versus enzalutamide in asymptomatic men with castration-resistant metastatic prostate cancer. J. Clin. Oncol. 2021, 39, 1371. [Google Scholar] [CrossRef]
- Markowski, M.C.; Taplin, M.-E.; Aggarwal, R.R.; Wang, H.; Lalji, A.; Paller, C.J.; Marshall, C.H.; Carducci, M.A.; Eisenberger, M.A.; De Marzo, A.M. COMBAT-CRPC: Concurrent Administration of Bipolar Androgen Therapy (BAT) and Nivolumab in Men with Metastatic Castration-Resistant Prostate Cancer (mCRPC); Wolters Kluwer Health: Riverwoods, IL, USA, 2021. [Google Scholar]
- Mirzakhani, K.; Kallenbach, J.; Rasa, S.M.M.; Ribaudo, F.; Ungelenk, M.; Ehsani, M.; Gong, W.; Gassler, N.; Leeder, M.; Grimm, M.-O. The androgen receptor—lncRNASAT1-AKT-p15 axis mediates androgen-induced cellular senescence in prostate cancer cells. Oncogene 2022, 41, 943–959. [Google Scholar] [CrossRef]
- Heidari Horestani, M.; Atri Roozbahani, G.; Baniahmad, A. The clock gene BHLHE40 and atypical CCNG2 control androgen-induced cellular senescence as a novel tumor suppressive pathway in prostate cancer. J. Exp. Clin. Cancer Res. 2024, 43, 174. [Google Scholar] [CrossRef]
- Roediger, J.; Hessenkemper, W.; Bartsch, S.; Manvelyan, M.; Huettner, S.S.; Liehr, T.; Esmaeili, M.; Foller, S.; Petersen, I.; Grimm, M.-O. Supraphysiological androgen levels induce cellular senescence in human prostate cancer cells through the Src-Akt pathway. Mol. Cancer 2014, 13, 214. [Google Scholar] [CrossRef]
- Chatterjee, P.; Schweizer, M.T.; Lucas, J.M.; Coleman, I.; Nyquist, M.D.; Frank, S.B.; Tharakan, R.; Mostaghel, E.; Luo, J.; Pritchard, C.C. Supraphysiological androgens suppress prostate cancer growth through androgen receptor–mediated DNA damage. J. Clin. Investig. 2019, 129, 4245–4260. [Google Scholar] [CrossRef] [PubMed]
- Hernandez-Segura, A.; Nehme, J.; Demaria, M. Hallmarks of cellular senescence. Trends Cell Biol. 2018, 28, 436–453. [Google Scholar] [CrossRef] [PubMed]
- Ju, Z.; Choudhury, A.R.; Rudolph, K.L. A dual role of p21 in stem cell aging. Ann. N. Y. Acad. Sci. 2007, 1100, 333–344. [Google Scholar] [CrossRef] [PubMed]
- Aird, K.M.; Zhang, R. Detection of senescence-associated heterochromatin foci (SAHF). In Cell Senescence: Methods and Protocols; Humana Press: Totowa, NJ, USA, 2013; pp. 185–196. [Google Scholar]
- Olan, I.; Handa, T.; Narita, M. Beyond SAHF: An integrative view of chromatin compartmentalization during senescence. Curr. Opin. Cell Biol. 2023, 83, 102206. [Google Scholar] [CrossRef]
- Paluvai, H.; Di Giorgio, E.; Brancolini, C. The histone code of senescence. Cells 2020, 9, 466. [Google Scholar] [CrossRef]
- Wang, C.; Jurk, D.; Maddick, M.; Nelson, G.; Martin-Ruiz, C.; Von Zglinicki, T. DNA damage response and cellular senescence in tissues of aging mice. Aging Cell 2009, 8, 311–323. [Google Scholar] [CrossRef]
- Contrepois, K.; Coudereau, C.; Benayoun, B.A.; Schuler, N.; Roux, P.-F.; Bischof, O.; Courbeyrette, R.; Carvalho, C.; Thuret, J.-Y.; Ma, Z. Histone variant H2A. J accumulates in senescent cells and promotes inflammatory gene expression. Nat. Commun. 2017, 8, 14995. [Google Scholar] [CrossRef]
- Abd Al-razaq, M.A.; Freyter, B.M.; Isermann, A.; Tewary, G.; Mangelinck, A.; Mann, C.; Rübe, C.E. Role of histone variant H2A. J in fine-tuning chromatin organization for the establishment of ionizing radiation-induced senescence. Cells 2023, 12, 916. [Google Scholar] [CrossRef]
- Protopopov, A.I.; Li, J.; Winberg, G.; Gizatullin, R.Z.; Kashuba, V.I.; Klein, G.; Zabarovsky, E.R. Human cell lines engineered for tetracycline-regulated expression of tumor suppressor candidate genes from a frequently affected chromosomal region, 3p21. J. Gene Med. A Cross-Discip. J. Res. Sci. Gene Transf. Its Clin. Appl. 2002, 4, 397–406. [Google Scholar] [CrossRef]
- Thalmann, G.N.; Anezinis, P.E.; Chang, S.-M.; Zhau, H.E.; Kim, E.E.; Hopwood, V.L.; Pathak, S.; von Eschenbach, A.C.; Chung, L.W. Androgen-independent cancer progression and bone metastasis in the LNCaP model of human prostate cancer. Cancer Res. 1994, 54, 2577–2581. [Google Scholar]
- Jansson, K.H.; Lynch, J.E.; Lepori-Bui, N.; Czymmek, K.J.; Duncan, R.L.; Sikes, R.A. Overexpression of the VSSC-associated CAM, beta-2, enhances LNCaP cell metastasis associated behavior. Prostate 2012, 72, 1080–1092. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Ma, L.; Pei, X.; Wang, H.; Tang, X.; Pei, J.-F.; Ding, Y.-N.; Qu, S.; Wei, Z.-Y.; Wang, H.-Y. Comprehensive assessment of cellular senescence in the tumor microenvironment. Brief. Bioinform. 2022, 23, bbac118. [Google Scholar] [CrossRef]
- Chen, E.Y.; Tan, C.M.; Kou, Y.; Duan, Q.; Wang, Z.; Meirelles, G.V.; Clark, N.R.; Ma’ayan, A. Enrichr: Interactive and collaborative HTML5 gene list enrichment analysis tool. BMC Bioinform. 2013, 14, 128. [Google Scholar] [CrossRef] [PubMed]
- Ulgen, E.; Ozisik, O.; Sezerman, O.U. pathfindR: An R package for comprehensive identification of enriched pathways in omics data through active subnetworks. Front. Genet. 2019, 10, 858. [Google Scholar] [CrossRef] [PubMed]
- Xie, Z.; Bailey, A.; Kuleshov, M.V.; Clarke, D.J.; Evangelista, J.E.; Jenkins, S.L.; Lachmann, A.; Wojciechowicz, M.L.; Kropiwnicki, E.; Jagodnik, K.M. Gene set knowledge discovery with Enrichr. Curr. Protoc. 2021, 1, e90. [Google Scholar] [CrossRef]
- Zhou, Y.; Zhou, B.; Pache, L.; Chang, M.; Khodabakhshi, A.H.; Tanaseichuk, O.; Benner, C.; Chanda, S.K. Metascape provides a biologist-oriented resource for the analysis of systems-level datasets. Nat. Commun. 2019, 10, 1523. [Google Scholar] [CrossRef]
- Wu, T.; Hu, E.; Xu, S.; Chen, M.; Guo, P.; Dai, Z.; Feng, T.; Zhou, L.; Tang, W.; Zhan, L. clusterProfiler 4.0: A universal enrichment tool for interpreting omics data. Innovation 2021, 2, 100141. [Google Scholar] [CrossRef]
- Tang, Z.; Li, C.; Kang, B.; Gao, G.; Li, C.; Zhang, Z. GEPIA: A web server for cancer and normal gene expression profiling and interactive analyses. Nucleic Acids Res. 2017, 45, W98–W102. [Google Scholar] [CrossRef]
- Robinson, J.T.; Thorvaldsdóttir, H.; Winckler, W.; Guttman, M.; Lander, E.S.; Getz, G.; Mesirov, J.P. Integrative genomics viewer. Nat. Biotechnol. 2011, 29, 24–26. [Google Scholar] [CrossRef]
- Rauluseviciute, I.; Riudavets-Puig, R.; Blanc-Mathieu, R.; Castro-Mondragon, J.A.; Ferenc, K.; Kumar, V.; Lemma, R.B.; Lucas, J.; Chèneby, J.; Baranasic, D.; et al. JASPAR 2024: 20th anniversary of the open-access database of transcription factor binding profiles. Nucleic Acids Res. 2024, 52, D174–D182. [Google Scholar] [CrossRef]
- Huang, Y.; Hong, W.; Wei, X. The molecular mechanisms and therapeutic strategies of EMT in tumor progression and metastasis. J. Hematol. Oncol. 2022, 15, 129. [Google Scholar] [CrossRef] [PubMed]
- Horoszewicz, J.S.; Leong, S.S.; Kawinski, E.; Karr, J.P.; Rosenthal, H.; Chu, T.M.; Mirand, E.A.; Murphy, G.P. LNCaP model of human prostatic carcinoma. Cancer Res. 1983, 43, 1809–1818. [Google Scholar] [PubMed]
- Lin, D.L.; Tarnowski, C.P.; Zhang, J.; Dai, J.; Rohn, E.; Patel, A.H.; Morris, M.D.; Keller, E.T. Bone metastatic LNCaP-derivative C4-2B prostate cancer cell line mineralizes in vitro. Prostate 2001, 47, 212–221. [Google Scholar] [CrossRef] [PubMed]
- Chen, K.-C.; Hsieh, C.-L.; Peng, C.-C.; Hsieh-Li, H.-M.; Chiang, H.-S.; Huang, K.-D.; Peng, R.Y. Brain derived metastatic prostate cancer DU-145 cells are effectively inhibited in vitro by guava (Psidium gujava L.) leaf extracts. Nutr. Cancer 2007, 58, 93–106. [Google Scholar] [CrossRef]
- Tai, S.; Sun, Y.; Squires, J.M.; Zhang, H.; Oh, W.K.; Liang, C.Z.; Huang, J. PC3 is a cell line characteristic of prostatic small cell carcinoma. Prostate 2011, 71, 1668–1679. [Google Scholar] [CrossRef]
- Sramkoski, R.M.; Pretlow, T.G.; Giaconia, J.M.; Pretlow, T.P.; Schwartz, S.; Sy, M.-S.; Marengo, S.R.; Rhim, J.S.; Zhang, D.; Jacobberger, J.W. A new human prostate carcinoma cell line, 22Rv1. In Vitro Cell. Dev. Biol.-Anim. 1999, 35, 403–409. [Google Scholar] [CrossRef]
- Han, W.; Liu, M.; Han, D.; Toure, A.A.; Li, M.; Besschetnova, A.; Wang, Z.; Patalano, S.; Macoska, J.A.; Lam, H.-M. Exploiting the tumor-suppressive activity of the androgen receptor by CDK4/6 inhibition in castration-resistant prostate cancer. Mol. Ther. 2022, 30, 1628–1644. [Google Scholar] [CrossRef]
- Safi, R.; Wardell, S.E.; Watkinson, P.; Qin, X.; Lee, M.; Park, S.; Krebs, T.; Dolan, E.L.; Blattler, A.; Tsuji, T. Androgen receptor monomers and dimers regulate opposing biological processes in prostate cancer cells. Nat. Commun. 2024, 15, 7675. [Google Scholar] [CrossRef]
- Denayer, S.; Helsen, C.; Thorrez, L.; Haelens, A.; Claessens, F. The Rules of DNA Recognition by the Androgen Receptor. Mol. Endocrinol. 2010, 24, 898–913. [Google Scholar] [CrossRef]
- Vincentius, M.; Farica, Z.; Yuning, Z.; Kyle, P.; Raluca, G. High-throughput data and modeling reveal insights into the mechanisms of cooperative DNA-binding by transcription factor proteins. Nucleic Acids Res. 2023, 51, 11600–11612. [Google Scholar]
- Georgakopoulos-Soares, I.; Deng, C.; Agarwal, V.; Chan, C.S.Y.; Zhao, J.; Inoue, F.; Ahituv, N. Transcription factor binding site orientation and order are major drivers of gene regulatory activity. Nat. Commun. 2023, 14, 2333. [Google Scholar] [CrossRef] [PubMed]
- Denechaud, P.-D.; Fajas, L.; Giralt, A. E2F1, a novel regulator of metabolism. Front. Endocrinol. 2017, 8, 311. [Google Scholar] [CrossRef] [PubMed]
- Isermann, A.; Mann, C.; Rübe, C.E. Histone variant H2A. J marks persistent DNA damage and triggers the secretory phenotype in radiation-induced senescence. Int. J. Mol. Sci. 2020, 21, 9130. [Google Scholar] [CrossRef] [PubMed]
- Oizumi, T.; Suzuki, T.; Kobayashi, J.; Nakamura, A.J. Senescence-Associated Heterochromatin Foci Suppress γ-H2AX Focus Formation Induced by Radiation Exposure. Int. J. Mol. Sci. 2024, 25, 3355. [Google Scholar] [CrossRef]
- Dryhurst, D.; Ausió, J. Histone H2A. Z deregulation in prostate cancer. Cause or effect? Cancer Metastasis Rev. 2014, 33, 429–439. [Google Scholar] [CrossRef]
- Shah, K.; Gagliano, T.; Garland, L.; O’hanlon, T.; Bortolotti, D.; Gentili, V.; Rizzo, R.; Giamas, G.; Dean, M. Androgen receptor signaling regulates the transcriptome of prostate cancer cells by modulating global alternative splicing. Oncogene 2020, 39, 6172–6189. [Google Scholar] [CrossRef]
- Kokal, M.; Mirzakhani, K.; Pungsrinont, T.; Baniahmad, A. Mechanisms of androgen receptor agonist-and antagonist-mediated cellular senescence in prostate cancer. Cancers 2020, 12, 1833. [Google Scholar] [CrossRef]
- Chen, Z.; Trotman, L.C.; Shaffer, D.; Lin, H.-K.; Dotan, Z.A.; Niki, M.; Koutcher, J.A.; Scher, H.I.; Ludwig, T.; William, G.; et al. Crucial role of p53-dependent cellular senescence in suppression of Pten-deficient tumorigenesis. Nature 2005, 436, 725–730. [Google Scholar] [CrossRef]
- Horestani, M.H.; Schindler, K.; Baniahmad, A. Functional circuits of LYL1 controlled by supraphysiological androgen in prostate cancer cells to regulate cell senescence. Cell Commun. Signal. 2024, 22, 590. [Google Scholar] [CrossRef]
- Kallenbach, J.; Rasa, M.; Horestani, M.H.; Roozbahani, G.A.; Schindler, K.; Baniahmad, A. The oncogenic lncRNA MIR503HG suppresses cellular senescence counteracting supraphysiological androgen treatment in prostate cancer. J. Exp. Clin. Cancer Res. 2024, 43, 321. [Google Scholar] [CrossRef]
- Podhorecka, M.; Skladanowski, A.; Bozko, P. H2AX phosphorylation: Its role in DNA damage response and cancer therapy. J. Nucleic Acids 2010, 2010, 920161. [Google Scholar] [CrossRef] [PubMed]
- He, Z.-Y.; Wang, W.-Y.; Hu, W.-Y.; Yang, L.; Li, Y.; Zhang, W.-Y.; Yang, Y.-S.; Liu, S.-C.; Zhang, F.-L.; Mei, R. Gamma-H2AX upregulation caused by Wip1 deficiency increases depression-related cellular senescence in hippocampus. Sci. Rep. 2016, 6, 34558. [Google Scholar] [CrossRef] [PubMed]
- Giaimo, B.D.; Ferrante, F.; Herchenröther, A.; Hake, S.B.; Borggrefe, T. The histone variant H2A. Z in gene regulation. Epigenet. Chromatin 2019, 12, 37. [Google Scholar] [CrossRef] [PubMed]
- Redon, C.E.; Schmal, Z.; Tewary, G.; Mangelinck, A.; Courbeyrette, R.; Thuret, J.-Y.; Aladjem, M.I.; Bonner, W.M.; Rübe, C.E.; Mann, C. Histone variant H2A. J is enriched in luminal epithelial gland cells. Genes 2021, 12, 1665. [Google Scholar] [CrossRef]
- Colditz, J.; Rupf, B.; Maiwald, C.; Baniahmad, A. Androgens induce a distinct response of epithelial-mesenchymal transition factors in human prostate cancer cells. Mol. Cell. Biochem. 2016, 421, 139–147. [Google Scholar] [CrossRef]
- Narita, M. Cellular senescence and chromatin organisation. Br. J. Cancer 2007, 96, 686–691. [Google Scholar] [CrossRef]
KLK3 | FRW: GAGGCTGGGAGTGCGAGAAG REV: TTGTTCCTGATGCAGTGGGC |
TMPRSS2 | FRW: CCTGCAAGGACATGGGCTATA REV: CCGGCACTTGTGTTCAGTTTC |
E2F1 | FWD: GCAGAGCAGATGGTTATGG REV: GATCTGAAAGTTCTCCGAAGAG |
NKX3-1 | FWD: CCGAGACGCTGGCAGAGACC REV: GCTTAGGGGTTTGGGGAAG |
H2AJ | FWD: AGCGGTTTGTCTCCGTCTCTC REV: CTCCGCCGTAAGGTACTCCAA |
CDKN1A | FWD: GCAGACCAGCATGACAGATTTC REV: AGAAGATGTAGAGCGGGCCT |
CDH1 | FWD: GGCTGGACCGAGAGAGTTTC REV: TGCTGTTGTGCTTAACCCCT |
CDH2 | FWD: AGGGATCAAAGCCTGGAACAT REV: CTTGGAGCCTGAGACACGAT |
VIM | FWD: TGGCACGTCTTGACCTTGAA REV: AGCTCCTGGATTTCCTCTTCG |
TBP | FRW: GATCTTTGCAGTGACCCAGCATCA REV: CTCCAGCACACTCTTCTCAGC |
TUBA | FRW: TGGAACCCACAGTCATTGATGA REV: TGATCTCCTTGCCAATGGTGTA |
H2AJ-ChIP1 | FRW: TGGACTCATTTACAAAGAGACCCGG REV: TTGTCTTTGAGGCTATGGGCC |
H2AJ-ChIP2 | FRW: GTGAACGATTGGCTGGCTGTG REV: GGGTTGTCCGTAGACGTTGCTATG |
H2AJ-ChIP-Negative | FRW: CTGGAGTTGTAGGCGAGAGGTG REV: TGCCCAGCAGCTTGTTTAACTC |
Target | Dilution | Company | Cat No. |
---|---|---|---|
anti-p21WAF1/Cip1 | 1:1000 | Cell Signaling, Danvers, MA, USA | #2946 |
anti-H2AJ | 1:1000 | Active Motif, Carlsbad, CA, USA | AB_2793769 |
anti-AR | 1:1000 | Merck Millipore, Darmstadt, Germany | #06-680 |
anti-mouse IgG | 1:10,000 | Cell Signaling, USA | #7076S |
anti-rabbit IgG | 1:10,000 | Cell Signaling, USA | #7074S |
anti-β-Actin | 1:10,000 | Abcam, Ballynew, Ireland | ab6276 |
anti-AR (ChIP-qPCR) | 1:50 | Cell Signaling, USA | #5153 |
E cadherin | 1:1000 | Cell Signaling, USA | #3195 |
Vimentin | 1:1000 | Cell Signaling, USA | #5741s |
Matrix ID | Name | Score | Sequence ID | Predicted Motif Sequence |
---|---|---|---|---|
MA0007.2 | MA0007.2.AR | 8.886336 | Peak region 1 | GAGAACATCCACTTA |
MA0007.2 | MA0007.2.AR | 8.77093 | Peak region 1 | AACAACAGCCTGTCC |
MA0007.2 | MA0007.2.AR | 8.022745 | Peak region 1 | AGGAACAAGCTCGCC |
MA0007.2 | MA0007.2.AR | 6.7239027 | Peak region 2 | AGGAACAAATACATA |
MA0007.2 | MA0007.2.AR | 6.207951 | Peak region 2 | CAGAACATCTCGAAC |
MA0007.2 | MA0007.2.AR | 9.315744 | Peak region 3 | GGGGACACAAAGACA |
Fold Enrichment | p Value | |
---|---|---|
Signaling by VEGF | 1.308 | 8.72 × 10−6 |
Cellular response to chemical stress | 1.951 | 6.03 × 10−6 |
VEGFA-VEGFR2 Pathway | 1.103 | 5.73 × 10−11 |
G1/S Transition | 1.651 | 2.16 × 10−7 |
DNA Replication | 1.497 | 2.05 × 10−7 |
Signaling by TGFB family members | 1.282 | 0.00011 |
Signaling by EGFR in Cancer | 1.382 | 0.000242 |
Circadian Clock | 3.421 | 0.002307 |
Cellular Senescence | 1.625 | 0.022015 |
Formation of Senescence-Associated Heterochromatin Foci (SAHF) | 1.413 | 0.028165 |
Estrogen-dependent gene expression | 1.141 | 0.046655 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Heidari Horestani, M.; Atri Roozbahani, G.; Baniahmad, A. H2AJ Is a Direct Androgen Receptor Target Gene That Regulates Androgen-Induced Cellular Senescence and Inhibits Mesenchymal Markers in Prostate Cancer Cells. Cancers 2025, 17, 791. https://doi.org/10.3390/cancers17050791
Heidari Horestani M, Atri Roozbahani G, Baniahmad A. H2AJ Is a Direct Androgen Receptor Target Gene That Regulates Androgen-Induced Cellular Senescence and Inhibits Mesenchymal Markers in Prostate Cancer Cells. Cancers. 2025; 17(5):791. https://doi.org/10.3390/cancers17050791
Chicago/Turabian StyleHeidari Horestani, Mehdi, Golnaz Atri Roozbahani, and Aria Baniahmad. 2025. "H2AJ Is a Direct Androgen Receptor Target Gene That Regulates Androgen-Induced Cellular Senescence and Inhibits Mesenchymal Markers in Prostate Cancer Cells" Cancers 17, no. 5: 791. https://doi.org/10.3390/cancers17050791
APA StyleHeidari Horestani, M., Atri Roozbahani, G., & Baniahmad, A. (2025). H2AJ Is a Direct Androgen Receptor Target Gene That Regulates Androgen-Induced Cellular Senescence and Inhibits Mesenchymal Markers in Prostate Cancer Cells. Cancers, 17(5), 791. https://doi.org/10.3390/cancers17050791