Differential Expression of Insulin Growth Factor 1 (IGF-1) Isoforms in Different Types of Endometriosis: Preliminary Results of a Single-Center Study
Abstract
1. Introduction
2. Materials and Methods
2.1. Study Design and Sample Collection
2.2. Tissue Homogenization, RNA Isolation, and Quantitative PCR
- GAPDH-Forward(F) Sequence CAA CTC CCT CAA GAT TGT CAG CAA
- GAPDH-Reversed (R) Sequence GGC ATG GAC TGT GGT CAT GA
- IGF-1Ea F GTG-GAG-ACA-GGG-GCT-TTT-ATT-TC
- IGF-1Ea R CTTGTTTCCTGCACTCCCTCTACT
- IGF-1Eb F ATGTCCTCCTCGCACCTCT
- IGF-1Eb R CCTCCTTCTGTTCCCTC
- IGF-1Ec F CGAAGTCTCAGAGAAGGAAAGG
- IGF-1Ec R ACAGGTAACTCGTGCAGAGC
2.3. Statistical Analysis
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Giudice, L.C. Endometriosis. N. Engl. J. Med. 2010, 362, 2389–2398. [Google Scholar] [CrossRef] [PubMed]
- Nisolle, M.; Donnez, J. Peritoneal endometriosis, ovarian endometriosis, and adenomyotic nodules of the rectovaginal septum are three different entities. Fertil. Steril. 1997, 68, 585–596. [Google Scholar] [CrossRef] [PubMed]
- Koninckx, P.R.; Ussia, A.; Keckstein, J.; Wattiez, A.; Adamyan, L. Epidemiology of Subtle, Typical, Cystic, and Deep Endometriosis: A Systematic Review. Gynaecol. Surg. 2016, 13, 457–467. [Google Scholar] [CrossRef]
- Bulun, S.E. Endometriosis. N. Engl. J. Med. 2009, 360, 268–279. [Google Scholar] [CrossRef] [PubMed]
- Saunders, P.; Horne, A. Endometriosis: Etiology, pathobiology, and therapeutic prospects. Cell 2021, 184, 2807–2824. [Google Scholar] [CrossRef] [PubMed]
- Laganà, A.S.; Garzon, S.; Götte, M.; Viganò, P.; Franchi, M.; Ghezzi, F.; Martin, D.C. The Pathogenesis of Endometriosis: Molecular and Cell Biology Insights. Int. J. Mol. Sci. 2019, 20, 5615. [Google Scholar] [CrossRef] [PubMed]
- Chang, S.Y.; Ho, Y.S. Immunohistochemical analysis of insulin-like growth factor I, insulin-like growth factor I receptor and insulin-like growth factor II in endometriotic tissue and endometrium. Acta Obstet. Gynecol. Scand. 1997, 76, 112–117. [Google Scholar] [CrossRef]
- Heidari, S.; Kolahdouz-Mohammadi, R.; Khodaverdi, S.; Tajik, N.; Delbandi, A.A. Expression levels of MCP-1, HGF, and IGF-1 in endometriotic patients compared with non-endometriotic controls. BMC Womens Health 2021, 21, 422–435. [Google Scholar] [CrossRef]
- Philippou, A.; Maridaki, M.; Pneumaticos, S.; Koutsilieris, M. The complexity of the IGF1 gene splicing, posttranslational modification and bioactivity. Mol. Med. 2014, 20, 202–214. [Google Scholar] [CrossRef]
- Molnarf, N.; Benkhoucha, M.; Funakoshi, H.; Nakamura, T.; Lalive, P.H. Hepato_cyte growth factor: A regulator of infammation and autoimmunity. Autoimmun. Rev. 2015, 14, 293–303. [Google Scholar] [CrossRef]
- Philippou, A.; Papageorgiou, E.; Bogdanis, G.; Halapas, A.; Sourla, A.; Maridaki, M.; Pissimissis, N.; Koutsilieris, M. Expression of IGF-1 isoforms after exercise-induced muscle damage in humans: Characterization of the MGF E peptide actions in vitro. In Vivo 2009, 23, 567–575. [Google Scholar] [PubMed]
- Milingos, D.; Katopodis, H.; Milingos, S.; Protopapas, A.; Creatsas, G.; Michalas, S.; Antsaklis, A.; Koutsilieris, M. Insulin-like growth factor-1 isoform mRNA expression in women with endometriosis: Eutopic endometrium versus endometriotic cyst. Ann. N. Y. Acad. Sci. 2006, 1092, 434–439. [Google Scholar] [CrossRef] [PubMed]
- Canis, M.; Donnez, J.G.; Guzick, D.S.; Halme, J.K.; Rock, J.A.; Schenken, R.S.; Vernon, M.W. Revised American Society for Reproductive Medicine classification of endometriosis: 1996. Fertil. Steril. 1997, 67, 817–821. [Google Scholar]
- Tuttlies, F.; Keckstein, J.; Ulrich, U.; Possover, M.; Schweppe, K.W.; Wustlich, M.; Buchweitz, O.; Greb, R.; Kandolf, O.; Mangold, R.; et al. ENZIAN-score, a classification of deep infiltrating endometriosis. Zentralbl. Gynakol. 2005, 127, 275–281. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Golia D’Augè, T.; Cuccu, I.; Santangelo, G.; Muzii, L.; Giannini, A.; Bogani, G.; Di Donato, V. Novel Insights into Molecular Mechanisms of Endometrial Diseases. Biomolecules 2023, 13, 499. [Google Scholar] [CrossRef]
- Kim, J.G.; Suh, C.S.; Kim, S.H.; Choi, Y.M.; Moon, S.Y.; Lee, J.Y. Insulin-like growth factors (IGFs), IGF-binding proteins (IGFBPs), and IGFBP-3 protease activity in the peritoneal fluid of patients with and without endometriosis. Fertil. Steril. 2000, 73, 996–1000. [Google Scholar] [CrossRef]
- Khan, K.N.; Kitajima, M.; Hiraki, K.; Fujishita, A.; Sekine, I.; Ishimaru, T.; Masuzaki, H. Immunopathogenesis of pelvic endometriosis: Role of hepatocyte growth factor, macrophages and ovarian steroids. Am. J. ReprodImmunol. 2008, 60, 383–404. [Google Scholar] [CrossRef]
- Redwine, D.B. Ovarian endometriosis: A marker for more extensive pelvic and intestinal disease. Fertil. Steril. 1999, 72, 310–315. [Google Scholar] [CrossRef]
- Chapron, C.; Pietin-Vialle, C.; Borghese, B.; Davy, C.; Foulot, H.; Chopin, N. Associated ovarian endometrioma is a marker for greater severity of deeply infiltrating endometriosis. Fertil. Steril. 2009, 92, 453–457. [Google Scholar] [CrossRef]
- Abrão, M.S.; Petraglia, F.; Falcone, T.; Keckstein, J.; Osuga, Y.; Chapron, C. Deep endometriosis infiltrating the recto-sigmoid: Critical factors to consider before management. Hum. Reprod. Update 2015, 21, 329–339. [Google Scholar] [CrossRef]
- Donnez, J.; Nisolle, M.; Squifflet, J. Ureteral endometriosis: A complication of rectovaginal endometriotic (adenomyotic) nodules. Fertil. Steril. 2002, 77, 32–37. [Google Scholar] [CrossRef] [PubMed]
- Koninckx, P.R.; Martin, D.C. Deep endometriosis: A consequence of infiltration or retraction or possibly adenomyosis externa? Fertil. Steril. 1992, 58, 924–928. [Google Scholar] [CrossRef] [PubMed]
- Koninckx, P.R.; Ussia, A.; Adamyan, L.; Wattiez, A.; Gomel, V.; Martin, D.C. Pathogenesis of Endometriosis: The Genetic/Epigenetic Theory. Fertil. Steril. 2019, 111, 327–339. [Google Scholar] [CrossRef] [PubMed]
- Wu, Y.; Basir, Z.; Kajdacsy-Balla, A.; Strawn, E.; Macias, V.; Montgomery, K.; Guo, S.-W. Resolution of clonal origins for endometriotic lesions using laser capture microdissection and the human androgen receptor (HUMARA) assay. Fertil. Steril. 2003, 79 (Suppl. 1), 710–717. [Google Scholar] [CrossRef] [PubMed]
- Mayr, D.; Amann, G.; Siefert, C.; Diebold, J.; Anderegg, B. Does endometriosis really have premalignant potential? A clonal analysis of laser micro-dissected tissue. FASEB J. 2003, 17, 693–695. [Google Scholar] [CrossRef]
- Tamura, M.; Fukaya, T.; Murakami, I.; Uehara, S.; Yajima, A. Analysis of clonality in human endometriotic cysts based on evaluation of X chromosome inactivation in archival formalin-fixed, paraffin-embedded tissue. Lab. Investig. 1998, 78, 213–218. [Google Scholar] [PubMed]
- Yano, T.; Jimbo, H.; Yoshikawa, H.; Tsutsumi, O.; Taketani, Y. Molecular analysis of clonality in ovarian endometrial cysts. Gynecol. Obstet. Investig. 1999, 47 (Suppl. 1), 41–45. [Google Scholar] [CrossRef]
- Jimbo, H.; Hitomi, Y.; Yoshikawa, H.; Yano, T.; Momoeda, M.; Sakamoto, A.; Tsutsumi, O.; Taketani, Y.; Esumi, H. Evidence for monoclonal expansion of epithelial cells in ovarian endometrial cysts. Am. J. Pathol. 1997, 150, 1173–1178. [Google Scholar]
- Anaf, V.; Simon, P.; Fayt, I.; Noel, J. Smooth muscles are frequent components of endometriotic lesions. Hum. Reprod. 2000, 15, 767–771. [Google Scholar] [CrossRef]
- Barton, E.R. The ABCs of IGF-I isoforms: Impact on muscle hypertrophy and implications for repair. Applied physiology, nutrition, and metabolism. Appl. Physiol. Nutr. Metab. 2006, 31, 791–797. [Google Scholar] [CrossRef] [PubMed]
- Philippou, A.; Halapas, A.; Maridaki, M.; Koutsilieris, M. Type I insulin-like growth factor receptor signaling in skeletal muscle regeneration and hypertrophy. J. Musculoskelet. Neuronal Interact. 2007, 7, 208–218. [Google Scholar] [PubMed]
- Milingos, D.S.; Philippou, A.; Armakolas, A.; Papageorgiou, E.; Sourla, A.; Protopapas, A.; Liapi, A.; Antsaklis, A.; Mastrominas, M.; Koutsilieris, M. Insulinlike growth factor-1Ec (MGF) expression in eutopic and ectopic endometrium: Characterization of the MGF E-peptide actions in vitro. Mol. Med. 2011, 17, 21–28. [Google Scholar] [CrossRef] [PubMed]
- Pei, D.; Shu, X.; Gassama-Diagne, A.; Thiery, J.P. Mesenchymal-epithelial transition in development and reprogramming. Nat. Cell Biol. 2019, 21, 44–53. [Google Scholar] [CrossRef] [PubMed]
- Jolly, M.K.; Ware, K.E.; Gilja, S.; Somarelli, J.A.; Levine, H. EMT and MET: Necessary or permissive for metastasis? Mol. Oncol. 2017, 11, 755–769. [Google Scholar] [CrossRef] [PubMed]
- Kalluri, R.; Weinberg, R.A. The basics of epithelial-mesenchymal transition. J. Clin. Investig. 2009, 119, 1420–1428. [Google Scholar] [CrossRef] [PubMed]
- Wu, M.H.; Chen, K.F.; Lin, S.C.; Lgu, C.W.; Tsai, S.J. Aberrant expression of leptin in human endometriotic stromal cells is induced by elevated levels of hypoxia inducible factor-1alpha. Am. J. Pathol. 2007, 170, 590–598. [Google Scholar] [CrossRef]
- Bulun, S.E.; Zeitoun, K.M.; Takayama, K.; Sasano, H. Estrogen biosynthesis in endometriosis: Molecular basis and clinical relevance. J. Mol. Endocrinol. 2000, 25, 35–42. [Google Scholar] [CrossRef]
- Zhou, Y.; Zeng, C.; Li, X.; Wu, P.L.; Yin, L.; Yu, X.L.; Zhou, Y.F.; Xue, Q. IGF-I stimulates ERβ and aromatase expression via IGF1R/PI3K/AKT-mediated transcriptional activation in endometriosis. J. Mol. Med. 2016, 94, 887–897. [Google Scholar] [CrossRef]
- Forster, R.; Sarginson, A.; Velichkova, A.; Hogg, C.; Dorning, A.; Horne, A.W.; Saunders, P.T.K.; Greaves, E. Macrophage-derived insulin-like growth factor-1 is a key neurotrophic and nerve-sensitizing factor in pain associated with endometriosis. FASEB J. 2019, 33, 11210–11222. [Google Scholar] [CrossRef]
- Sbracia, M.; Zupi, E.; Alo, P.; Manna, C.; Marconi, D.; Scarpellini, F.; Grasso, J.A.; Di Tondo, U.; Romanini, C. Differential expression of IGF-I and IGF-II in eutopic and ectopic endometria of women with endometriosis and in women without endometriosis. Am. J. ReprodImmunol. 1997, 37, 326–329. [Google Scholar] [CrossRef] [PubMed]
- Matalliotakis, I.M.; Goumenou, A.G.; Koumantakis, G.E.; Neonaki, M.A.; Koumantakis, E.E.; Dionyssopoulou, E.; Athanassakis, I.; Vassiliadis, S. Serum concentrations of growth factors in women with and without endometriosis: The action of anti-endometriosis medicines. Int. Immunopharmacol. 2003, 3, 81–89. [Google Scholar] [CrossRef] [PubMed]
- Steff, A.M.; Gagné, D.; Pagé, M.; Rioux, A.; Hugo, P.; Gosselin, D. Serum concentrations of insulin-like growth factor-1, soluble tumor necrosis factor receptor-1 and angiogenin in endometriosis patients. Am. J. Reprod. Immunol. 2004, 51, 166–173. [Google Scholar] [CrossRef] [PubMed]
- Gurgan, T.; Bukulmez, O.; Yarali, H.; Tanir, M.; Akyildiz, S. Serum and peritoneal fluid levels of IGF I and II and insulinlike growth binding protein-3 in endometriosis. J. Reprod. Med. 1999, 44, 450–454. [Google Scholar]
- Cunha-Filho, J.S.; Lemos, N.A.; Freitas, F.M.; Kiefer, K.; Faller, M.; Passos, E.P. Insulin-like growth factor (IGF)-1 and IGF binding protein-1 and -3 in the follicular fluid of infertile patients with endometriosis. Hum. Reprod. 2003, 18, 423–428. [Google Scholar] [CrossRef][Green Version]
Pt | Age | Size (cm) and Location of Endometrioma | Size (cm) and Location of DIE Nodule | ||
---|---|---|---|---|---|
Right Ovary | Left Ovary | ||||
Endometrioma only patients (EMA-only group) | |||||
1 | 31 | 5 | 2 | (-) | |
2 | 28 | 3 + 4 | (-) | (-) | |
3 | 31 | 5 | (-) | (-) | |
4 | 26 | 8 + 7 | (-) | (-) | |
5 | 31 | (-) | 3 | (-) | |
6 | 35 | 7 | 5 | (-) | |
7 | 45 | 7 | (-) | (-) | |
8 | 31 | 7 | (-) | (-) | |
9 | 38 | 7 | (-) | (-) | |
10 | 29 | (-) | 4 | (-) | |
11 | 34 | (-) | 8 | (-) | |
12 | 35 | 7 | (-) | (-) | |
13 | 36 | 4 | 2 | (-) | |
14 | 32 | (-) | 6 | (-) | |
15 | 44 | 5 | 5 | (-) | |
Endometrioma and DIE patients (EMA+DIE group) | |||||
16 | 24 | 1.4 | 4 | 3 | PVW |
17 | 38 | 4 | (-) | 1.8 | Rectum |
18 | 29 | 3 | 5 | 2.5 | RVS |
19 | 41 | (-) | 5 | 1.8 | RVS |
20 | 38 | (-) | 6 | 5.5 | RVS |
21 | 36 | (-) | 3.5 | 2.6 + 3.2 | R USL/L USL |
DIE only patients (DIE-only group) | |||||
22 | 29 | (-) | (-) | 2.5 | R USL infiltrating PVW |
23 | 36 | (-) | (-) | 3.5 | L USL |
24 | 36 | (-) | (-) | 4 | POD |
25 | 29 | (-) | (-) | 3 + 1.3 | L USL/Rectum |
26 | 42 | (-) | (-) | 3 | R USL |
27 | 30 | (-) | (-) | 3 + 2.2 | POD/R USL |
28 | 46 | (-) | (-) | 3 | L USL |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Blontzos, N.; Mavrogianni, D.; Ntzeros, K.; Kathopoulis, N.; Moustogiannis, A.; Philippou, A.; Koutsilieris, M.; Protopapas, A. Differential Expression of Insulin Growth Factor 1 (IGF-1) Isoforms in Different Types of Endometriosis: Preliminary Results of a Single-Center Study. Biomolecules 2024, 14, 7. https://doi.org/10.3390/biom14010007
Blontzos N, Mavrogianni D, Ntzeros K, Kathopoulis N, Moustogiannis A, Philippou A, Koutsilieris M, Protopapas A. Differential Expression of Insulin Growth Factor 1 (IGF-1) Isoforms in Different Types of Endometriosis: Preliminary Results of a Single-Center Study. Biomolecules. 2024; 14(1):7. https://doi.org/10.3390/biom14010007
Chicago/Turabian StyleBlontzos, Nikolaos, Despoina Mavrogianni, Konstantinos Ntzeros, Nikolaos Kathopoulis, Athanasios Moustogiannis, Anastassios Philippou, Michael Koutsilieris, and Athanasios Protopapas. 2024. "Differential Expression of Insulin Growth Factor 1 (IGF-1) Isoforms in Different Types of Endometriosis: Preliminary Results of a Single-Center Study" Biomolecules 14, no. 1: 7. https://doi.org/10.3390/biom14010007
APA StyleBlontzos, N., Mavrogianni, D., Ntzeros, K., Kathopoulis, N., Moustogiannis, A., Philippou, A., Koutsilieris, M., & Protopapas, A. (2024). Differential Expression of Insulin Growth Factor 1 (IGF-1) Isoforms in Different Types of Endometriosis: Preliminary Results of a Single-Center Study. Biomolecules, 14(1), 7. https://doi.org/10.3390/biom14010007