Rapid Identification of the SNP Mutation in the ABCD4 Gene and Its Association with Multi-Vertebrae Phenotypes in Ujimqin Sheep Using TaqMan-MGB Technology
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethical Statement
2.2. Experimental Materials
2.3. Experimental Methods
2.3.1. Genomic DNA Extraction
2.3.2. DR Imaging for Vertebral Phenotype
2.3.3. Design of TaqMan-MGB Probes and Primers
2.3.4. Validation of the ABCD4 Gene SNP Locus (Chr7:89393414 C > T) by Sanger Sequencing
2.3.5. Construction of TaqMan-MGB Standard Plasmids
2.3.6. TaqMan-MGB Reaction
2.4. Data Processing
3. Results
3.1. Vertebral Phenotype Detection Using DR Imaging
3.2. Sequence Analysis of Standard Plasmids
3.3. TaqMan-MGB Genotyping and Validation
3.4. Validation of TaqMan-MGB Genotyping Accuracy and Association Between Genotypes and Phenotypes
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
GWAS | genome-wide association study |
MAS | marker-assisted selection |
DR | digital radiography |
MGB | minor groove binder |
LD | linear dichroism |
Arg | arginine |
Gln | glutamine |
FAM | fluorescein amidite |
HEX | hexachloro-fluorescein |
OR | odds ratios |
CI | confidence intervals |
References
- Li, C.; Zhang, X.; Cao, Y.; Wei, J.; You, S.; Jiang, Y.; Cai, K.; Wumaier, W.; Guo, D.; Qi, J.; et al. Multi-vertebrae variation potentially contribute to carcass length and weight of Kazakh sheep. Small Rumin. Res. 2017, 150, 8–10. [Google Scholar] [CrossRef]
- Sun, K.; Hong, Y.; Zhang, W.; Dong, J.; Wen, Z.; Hu, Z.; Tan, X.; Li, H.; Zhao, A.; Huang, M.; et al. Single- and multiple-locus model genome-wide association study for growth traits in Dongliao Black pigs. Anim. Biosci. 2025. online ahead of print. [Google Scholar] [CrossRef]
- Begenova, A.; Bissengaliyev, R.; Kulmagambetov, T.; Nurgulsim, K.; Bekenova, A.; Otepova, G.; Akhatayeva, Z. Molecular markers associated with growth, meat, and carcass traits in sheep: A review. Anim. Biotechnol. 2025, 36, 2526458. [Google Scholar] [CrossRef]
- Fang, C.; Druet, T.; Cao, H.; Liu, W.; Chen, Q.; Farnir, F. Whole genome sequences of 297 Duolang sheep for litter size. Sci. Data 2025, 12, 1086. [Google Scholar] [CrossRef]
- Zhou, C.; Zhang, Y.; Ma, T.; Wu, D.; Yang, Y.; Wang, D.; Li, X.; Guo, S.; Yang, S.; Song, Y.; et al. Whole-Genome Resequencing of Ujimqin Sheep Identifies Genes Associated with Vertebral Number. Animals 2024, 14, 677. [Google Scholar] [CrossRef]
- Han, M.; Wang, X.; Du, H.; Cao, Y.; Zhao, Z.; Niu, S.; Bao, X.; Rong, Y.; Ao, X.; Guo, F.; et al. Genome-wide association study identifies candidate genes affecting body conformation traits of Zhongwei goat. BMC Genomics 2025, 26, 37. [Google Scholar] [CrossRef]
- Niu, N.; Liu, Q.; Hou, X.; Liu, X.; Wang, L.; Zhao, F.; Gao, H.; Shi, L.; Wang, L.; Zhang, L. Genome-wide association study revealed ABCD4 on SSC7 and GREB1L and MIB1 on SSC6 as crucial candidate genes for rib number in Beijing Black pigs. Anim. Genet. 2022, 53, 690–695. [Google Scholar] [CrossRef]
- Shani, N.; Jimenez-Sanchez, G.; Steel, G.; Dean, M.; Valle, D. Identification of a fourth half ABC transporter in the human peroxisomal membrane. Hum. Mol. Genet. 1997, 6, 1925–1931. [Google Scholar] [CrossRef]
- Ciappio, E.D.; Liu, Z.; Brooks, R.S.; Mason, J.B.; Bronson, R.T.; Crott, J.W. Maternal B vitamin supplementation from preconception through weaning suppresses intestinal tumorigenesis in Apc1638N mouse offspring. Gut 2011, 60, 1695–1702. [Google Scholar] [CrossRef] [PubMed]
- Yang, R.; Guo, X.; Zhu, D.; Tan, C.; Bian, C.; Ren, J.; Huang, Z.; Zhao, Y.; Cai, G.; Liu, D.; et al. Accelerated deciphering of the genetic architecture of agricultural economic traits in pigs using a low-coverage whole-genome sequencing strategy. Gigascience 2021, 10, giab048. [Google Scholar] [CrossRef]
- Visscher, P.M.; Brown, M.A.; McCarthy, M.I.; Yang, J. Five years of GWAS discovery. Am. J. Hum. Genet. 2012, 90, 7–24. [Google Scholar] [CrossRef]
- Kutyavin, I.V.; Afonina, I.A.; Mills, A.; Gorn, V.V.; Lukhtanov, E.A.; Belousov, E.S.; Singer, M.J.; Walburger, D.K.; Lokhov, S.G.; Gall, A.A.; et al. 3’-minor groove binder-DNA probes increase sequence specificity at PCR extension temperatures. Nucleic Acids Res. 2000, 28, 655–661. [Google Scholar] [CrossRef]
- Yao, Y.; Nellåker, C.; Karlsson, H. Evaluation of minor groove binding probe and Taqman probe PCR assays: Influence of mismatches and template complexity on quantification. Mol. Cell Probes 2006, 20, 311–316. [Google Scholar] [CrossRef]
- Zhou, B.; Yang, G.; Hu, Z.; Chen, K.; Guo, W.; Wang, X.; Du, C. Development of a Real-Time Quantitative PCR Based on a TaqMan-MGB Probe for the Rapid Detection of Theileria haneyi. Microorganisms 2023, 11, 2633. [Google Scholar] [CrossRef]
- Kawaguchi, K.; Imanaka, T. Substrate Specificity and the Direction of Transport in the ABC Transporters ABCD1-3 and ABCD4. Chem. Pharm. Bull. 2022, 70, 533–539. [Google Scholar] [CrossRef] [PubMed]
- Kawaguchi, K.; Morita, M. ABC Transporter Subfamily D: Distinct Differences in Behavior between ABCD1-3 and ABCD4 in Subcellular Localization, Function, and Human Disease. Biomed. Res. Int. 2016, 2016, 6786245. [Google Scholar] [CrossRef] [PubMed]
- Sumi, M.; Okamura, T.; Kajiyama, S.; Miyoshi, T.; Nakanishi, N.; Hashimoto, Y.; Sasano, R.; Hamaguchi, M.; Fukui, M. Investigation of factors associated with osteoporosis using metabolome analysis. J. Clin. Biochem. Nutr. 2025, 76, 304–310. [Google Scholar] [CrossRef]
- Vaes, B.L.T.; Lute, C.; Blom, H.J.; Bravenboer, N.; de Vries, T.J.; Everts, V.; Dhonukshe-Rutten, R.A.; Müller, M.; de Groot, L.C.P.G.M.; Steegenga, W.T. Vitamin B(12) deficiency stimulates osteoclastogenesis via increased homocysteine and methylmalonic acid. Calcif. Tissue Int. 2009, 84, 413–422. [Google Scholar] [CrossRef]
- Liu, Z.; Choi, S.-W.; Crott, J.W.; Keyes, M.K.; Jang, H.; Smith, D.E.; Kim, M.; Laird, P.W.; Bronson, R.; Mason, J.B. Mild depletion of dietary folate combined with other B vitamins alters multiple components of the Wnt pathway in mouse colon. J. Nutr. 2007, 137, 2701–2708. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Tiedemann, H.B.; Schneltzer, E.; Zeiser, S.; Hoesel, B.; Beckers, J.; Przemeck, G.K.H.; de Angelis, M.H. From dynamic expression patterns to boundary formation in the presomitic mesoderm. PLoS Comput. Biol. 2012, 8, e1002586. [Google Scholar] [CrossRef]
- Yoshioka-Kobayashi, K.; Matsumiya, M.; Niino, Y.; Isomura, A.; Kori, H.; Miyawaki, A.; Kageyama, R. Coupling delay controls synchronized oscillation in the segmentation clock. Nature 2020, 580, 119–123. [Google Scholar] [CrossRef]
- Ferjentsik, Z.; Hayashi, S.; Dale, J.K.; Bessho, Y.; Herreman, A.; De Strooper, B.; del Monte, G.; de la Pompa, J.L.; Maroto, M. Notch is a critical component of the mouse somitogenesis oscillator and is essential for the formation of the somites. PLoS Genet. 2009, 5, e1000662. [Google Scholar] [CrossRef]
- Wang, H.; Xue, L.; Wang, L.; Liu, Y.; Chen, J.; Sun, Y.; An, T.; Chen, H.; Yu, C.; Xia, C.; et al. The quadruplex TaqMan MGB fluorescent quantitative PCR method for simultaneous detection of feline panleukopenia virus, feline herpesvirus 1, feline calicivirus and feline infectious peritonitis virus. Front. Cell Infect. Microbiol. 2025, 15, 1581946. [Google Scholar] [CrossRef]
- Zhao, L.; Tang, X.; Guo, W.; Zhang, B.; Peng, H.; Ye, L.; Liu, Y.; Liang, J.; Tian, M.; Bao, Y.; et al. Using a novel gene site to develop a duplex real-time TaqMan MGB probe PCR method for the SNP detection and differentiation between the MS-H live vaccine strain and wild-type Mycoplasma synoviae strains. Poult. Sci. 2025, 104, 105011. [Google Scholar] [CrossRef]
- Huang, G.; Cheng, J.; Liu, W.; Yang, T.; Ye, T.; Zhang, Q.; Chen, Q.; Xu, Y. Association of P2X7 polymorphisms on Type 2 diabetes mellitus susceptibility and diabetic complications. PLoS ONE 2025, 20, e0318134. [Google Scholar] [CrossRef] [PubMed]
- Endo, T.; Fujii, H.; Yoshioka, T.; Omura, M.; Shimada, T. TaqMan-MGB SNP genotyping assay to identify 48 citrus cultivars distributed in the Japanese market. Breed. Sci. 2020, 70, 363–372. [Google Scholar] [CrossRef] [PubMed]
- Mingxiao, M.; Jinhua, L.; Yingjin, S.; Li, L.; Yongfei, L. TaqMan MGB probe fluorescence real-time quantitative PCR for rapid detection of Chinese Sacbrood virus. PLoS ONE 2013, 8, e52670. [Google Scholar] [CrossRef]
- Huang, X.; Wang, X.; Zhou, L.; Kong, F.; Liu, Y.; Wang, Z.; Zhang, H. TaqMan-MGB PCR Method for Rapid Detection of QoI Fungicide Resistance in Chinese Populations of Plasmopara viticola. Plant Dis. 2023, 107, 3007–3013. [Google Scholar] [CrossRef] [PubMed]
- Yang, F.; Chen, B.; Liu, F.; Peng, X.; Sun, T.; Yao, H.; Wu, H.; Wu, N. Development of a TaqMan MGB RT-PCR assay for the detection of type A and subtype H10 avian influenza viruses. Arch. Virol. 2018, 163, 2497–2501. [Google Scholar] [CrossRef]
Type | Name | Primer Sequencing | Analysis Type | Amplification Length/bp | Annealing Temperature/°C |
---|---|---|---|---|---|
Primer | ABCD4-Sanger-F | 5′ CAGCCTACCGACTTCAGCAT3′ | PCR | 319 | 58 |
ABCD4-Sanger-R | 5′ TGTGTAATCAACACCCCGCA3′ | PCR | |||
Primer | ABCD4-F | 5′ TTCTCTTCTTCAGACCCAGGTTAGA 3′ | TaqMan | 90 | 60 |
ABCD4-R | 5′ TCTGTGATGACCAAGAGGGAAA 3′ | TaqMan | |||
Probe | ABCD4-FAM | 5′ 6-FAM-TGCAATTTCTCCGGCG-3′ BHQ1 | TaqMan | ||
ABCD4-HEX | 5′ HEX-TGCAATTTCTCCAGCG-3′ BHQ1 | TaqMan |
Thoracolumbar Vertebrae Phenotype | Total Detected by DR (n = 152) | Genotyping Method | Genotype (n, %) | Total (n) | Kappa Coefficient (95% CI) | ||
---|---|---|---|---|---|---|---|
C/C | C/T | T/T | |||||
T13L6 | 26 | TaqMan-MGB Probe | 6 (23.1) | 7 (26.9) | 13 (50.0) | 26 | 1.00 (1.00–1.00) |
Sanger sequencing | 6 (23.1) | 7 (26.9) | 13 (50.0) | 26 | |||
T13L7 | 80 | TaqMan-MGB Probe | 0 (0.0) | 10 (12.5) | 70 (87.5) | 80 | 1.00 (1.00–1.00) |
Sanger sequencing | 0 (0.0) | 10 (12.5) | 70 (87.5) | 80 | |||
T14L6 | 38 | TaqMan-MGB Probe | 0 (0.0) | 1 (2.6) | 37 (97.4) | 38 | 1.00 (1.00–1.00) |
Sanger sequencing | 0 (0.0) | 1 (2.6) | 37 (97.4) | 38 | |||
T14L7 | 8 | TaqMan-MGB Probe | 0 (0.0) | 1 (12.5) | 7 (87.5) | 8 | 1.00 (1.00–1.00) |
Sanger sequencing | 0 (0.0) | 1 (12.5) | 7 (87.5) | 8 |
Thoracolumbar Vertebrae Phenotype | Total Detected by DR (n = 152) | Genotype (n, %) | Association Strength | ||||
---|---|---|---|---|---|---|---|
C/C | C/T | T/T | χ2 Value | p Value | OR (95% CI) | ||
T13L6 | 26 | 6 (23.1) | 7 (26.9) | 13 (50.0) | _ | _ | 1.00 (Reference) |
T13L7 | 80 | 0 (0.0) | 10 (12.5) | 70 (87.5) | 28.62 | <0.001 | 6.50 (2.52–16.78) |
T14L6 | 38 | 0 (0.0) | 1 (2.6) | 37 (97.4) | 41.35 | <0.001 | 34.00 (4.35–265.20) |
T14L7 | 8 | 0 (0.0) | 1 (12.5) | 7 (87.5) | 6.89 | 0.037 | 7.00 (0.85–57.63) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, Y.; Zhang, M.; Su, H.; Liu, J.; Zhao, F.; Zhao, Y.; Li, X.; Yang, Y.; Cao, G.; Zhang, Y. Rapid Identification of the SNP Mutation in the ABCD4 Gene and Its Association with Multi-Vertebrae Phenotypes in Ujimqin Sheep Using TaqMan-MGB Technology. Animals 2025, 15, 2284. https://doi.org/10.3390/ani15152284
Zhang Y, Zhang M, Su H, Liu J, Zhao F, Zhao Y, Li X, Yang Y, Cao G, Zhang Y. Rapid Identification of the SNP Mutation in the ABCD4 Gene and Its Association with Multi-Vertebrae Phenotypes in Ujimqin Sheep Using TaqMan-MGB Technology. Animals. 2025; 15(15):2284. https://doi.org/10.3390/ani15152284
Chicago/Turabian StyleZhang, Yue, Min Zhang, Hong Su, Jun Liu, Feifei Zhao, Yifan Zhao, Xiunan Li, Yanyan Yang, Guifang Cao, and Yong Zhang. 2025. "Rapid Identification of the SNP Mutation in the ABCD4 Gene and Its Association with Multi-Vertebrae Phenotypes in Ujimqin Sheep Using TaqMan-MGB Technology" Animals 15, no. 15: 2284. https://doi.org/10.3390/ani15152284
APA StyleZhang, Y., Zhang, M., Su, H., Liu, J., Zhao, F., Zhao, Y., Li, X., Yang, Y., Cao, G., & Zhang, Y. (2025). Rapid Identification of the SNP Mutation in the ABCD4 Gene and Its Association with Multi-Vertebrae Phenotypes in Ujimqin Sheep Using TaqMan-MGB Technology. Animals, 15(15), 2284. https://doi.org/10.3390/ani15152284