Long-Term Effects of Dietary Protein and Branched-Chain Amino Acids on Metabolism and Inflammation in Mice
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animal Study
2.2. Body Composition and Body Length Measurements
2.3. Femur Length Measurement
2.4. Insulin and Glucose Tolerance Tests
2.5. Flow Cytometry
2.6. Tissue RNA Isolation and Gene Expression Analysis
2.7. Liver Proteomics
2.8. Plasma Cytokine Analysis
2.9. Plasma FGF21 Concentration
2.10. Statistical Analysis
3. Results
3.1. BCAA Supplementation Conditionally Increased Body Weight, Lean Mass, and Fat Mass of Mice Fed a Low Protein Diet
3.2. Dietary Protein Had an Impact on Bone Mineral Density
3.3. The Low Protein Group Exhibited Improved Insulin Tolerance after 9-Month Dietary Intervention
3.4. Low Protein Diet Upregulated Fgf21 mRNA in Liver and Thermogenic Gene Expression in Inguinal White Adipose Tissue
3.5. BCAA Supplementation Induced Pro-Inflammatory Gene Expression in White Adipose Tissue and Liver
3.6. Dietary Intervention Differentially Impacted Anti-Inflammatory Gene Expression in White Adipose Tissue and Liver
3.7. BCAA Supplementation Increased Thymus Weight, while the Dietary Intervention Had No Effects on Thymocyte Cell Counts or Different T-Cell Populations in Thymus
3.8. BCAA Supplementation Increased Spleen Weight, while Dietary Intervention Had No Impact on Splenocyte Cell Counts and the Percentages of the Naive and the Memory T Lymphocytes in Spleen
3.9. Low Protein Diet Induced Circulating IL-5 after Prolonged Intervention
3.10. Liver Proteomics
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Acknowledgments
Conflicts of Interest
References
- Nations, U. World population prospects: The 2015 revision. U. N. Econ. Soc. Aff. 2015, 33, 1–66. [Google Scholar]
- Beard, J.R.; Officer, A.; de Carvalho, I.A.; Sadana, R.; Pot, A.M.; Michel, J.P.; Lloyd-Sherlock, P.; Epping-Jordan, J.E.; Peeters, G.M.; Mahanani, W.R.; et al. The world report on ageing and health: A policy framework for healthy ageing. Lancet 2016, 387, 2145–2154. [Google Scholar] [CrossRef]
- López-Otín, C.; Blasco, M.A.; Partridge, L.; Serrano, M.; Kroemer, G. The hallmarks of aging. Cell 2013, 153, 1194–1217. [Google Scholar] [CrossRef] [PubMed]
- Zamboni, M.; Mazzali, G.; Fantin, F.; Rossi, A.; Di Francesco, V. Sarcopenic obesity: A new category of obesity in the elderly. Nutr. Metab. Cardiovasc. Dis. NMCD 2008, 18, 388–395. [Google Scholar] [CrossRef] [PubMed]
- Corica, F.; Bianchi, G.; Corsonello, A.; Mazzella, N.; Lattanzio, F.; Marchesini, G. Obesity in the context of aging: Quality of life considerations. Pharm. Econ. 2015, 33, 655–672. [Google Scholar] [CrossRef] [PubMed]
- Wensveen, F.M.; Valentic, S.; Sestan, M.; Turk Wensveen, T.; Polic, B. The “big bang” in obese fat: Events initiating obesity-induced adipose tissue inflammation. Eur. J. Immunol. 2015, 45, 2446–2456. [Google Scholar] [CrossRef] [PubMed]
- Hotamisligil, G.S.; Shargill, N.S.; Spiegelman, B.M. Adipose expression of tumor necrosis factor-alpha: Direct role in obesity-linked insulin resistance. Science 1993, 259, 87–91. [Google Scholar] [CrossRef] [PubMed]
- Weisberg, S.P.; McCann, D.; Desai, M.; Rosenbaum, M.; Leibel, R.L.; Ferrante, A.W., Jr. Obesity is associated with macrophage accumulation in adipose tissue. J. Clin. Investig. 2003, 112, 1796–1808. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lutz, C.T.; Quinn, L.S. Sarcopenia, obesity, and natural killer cell immune senescence in aging: Altered cytokine levels as a common mechanism. Aging 2012, 4, 535–546. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bodey, B.; Bodey, B., Jr.; Siegel, S.E.; Kaiser, H.E. Involution of the mammalian thymus, one of the leading regulators of aging. In Vivo 1997, 11, 421–440. [Google Scholar] [PubMed]
- Kurashima, C.; Utsuyama, M.; Kasai, M.; Ishijima, S.A.; Konno, A.; Hirokawa, K. The role of thymus in the aging of th cell subpopulations and age-associated alteration of cytokine production by these cells. Int. Immunol. 1995, 7, 97–104. [Google Scholar] [CrossRef] [PubMed]
- Haynes, L.; Eaton, S.M.; Burns, E.M.; Randall, T.D.; Swain, S.L. Cd4 t cell memory derived from young naive cells functions well into old age, but memory generated from aged naive cells functions poorly. Proc. Natl. Acad. Sci. USA 2003, 100, 15053–15058. [Google Scholar] [CrossRef] [PubMed]
- Goronzy, J.J.; Weyand, C.M. Understanding immune senescence to improve vaccine responses. Nat. Immunol. 2013, 14, 428–436. [Google Scholar] [CrossRef] [PubMed]
- Nichol, K.L.; Nordin, J.D.; Nelson, D.B.; Mullooly, J.P.; Hak, E. Effectiveness of influenza vaccine in the community-dwelling elderly. N. Engl. J. Med. 2007, 357, 1373–1381. [Google Scholar] [CrossRef] [PubMed]
- Shaw, A.C.; Joshi, S.; Greenwood, H.; Panda, A.; Lord, J.M. Aging of the innate immune system. Curr. Opin. Immunol. 2010, 22, 507–513. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Franceschi, C.; Capri, M.; Monti, D.; Giunta, S.; Olivieri, F.; Sevini, F.; Panourgia, M.P.; Invidia, L.; Celani, L.; Scurti, M.; et al. Inflammaging and anti-inflammaging: A systemic perspective on aging and longevity emerged from studies in humans. Mech. Ageing Dev. 2007, 128, 92–105. [Google Scholar] [CrossRef] [PubMed]
- Passeri, G.; Pini, G.; Troiano, L.; Vescovini, R.; Sansoni, P.; Passeri, M.; Gueresi, P.; Delsignore, R.; Pedrazzoni, M.; Franceschi, C. Low vitamin d status, high bone turnover, and bone fractures in centenarians. J. Clin. Endocrinol. Metab. 2003, 88, 5109–5115. [Google Scholar] [CrossRef] [PubMed]
- Franceschi, C.; Olivieri, F.; Marchegiani, F.; Cardelli, M.; Cavallone, L.; Capri, M.; Salvioli, S.; Valensin, S.; De Benedictis, G.; Di Iorio, A.; et al. Genes involved in immune response/inflammation, igf1/insulin pathway and response to oxidative stress play a major role in the genetics of human longevity: The lesson of centenarians. Mech. Ageing Dev. 2005, 126, 351–361. [Google Scholar] [CrossRef] [PubMed]
- Alvarez-Rodriguez, L.; Lopez-Hoyos, M.; Munoz-Cacho, P.; Martinez-Taboada, V.M. Aging is associated with circulating cytokine dysregulation. Cell. Immunol. 2012, 273, 124–132. [Google Scholar] [CrossRef] [PubMed]
- Lumeng, C.N.; Liu, J.; Geletka, L.; Delaney, C.; Delproposto, J.; Desai, A.; Oatmen, K.; Martinez-Santibanez, G.; Julius, A.; Garg, S.; et al. Aging is associated with an increase in t cells and inflammatory macrophages in visceral adipose tissue. J. Immunol. 2011, 187, 6208–6216. [Google Scholar] [CrossRef] [PubMed]
- Wu, D.; Ren, Z.; Pae, M.; Guo, W.; Cui, X.; Merrill, A.H.; Meydani, S.N. Aging up-regulates expression of inflammatory mediators in mouse adipose tissue. J. Immunol. 2007, 179, 4829–4839. [Google Scholar] [CrossRef] [PubMed]
- Cai, D.; Yuan, M.; Frantz, D.F.; Melendez, P.A.; Hansen, L.; Lee, J.; Shoelson, S.E. Local and systemic insulin resistance resulting from hepatic activation of ikk-beta and nf-kappab. Nat. Med. 2005, 11, 183–190. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.S.; Ward, W.O.; Ren, H.; Vallanat, B.; Darlington, G.J.; Han, E.S.; Laguna, J.C.; DeFord, J.H.; Papaconstantinou, J.; Selman, C.; et al. Meta-analysis of gene expression in the mouse liver reveals biomarkers associated with inflammation increased early during aging. Mech. Ageing Dev. 2012, 133, 467–478. [Google Scholar] [CrossRef] [PubMed]
- Kim, I.H.; Xu, J.; Liu, X.; Koyama, Y.; Ma, H.Y.; Diggle, K.; You, Y.H.; Schilling, J.M.; Jeste, D.; Sharma, K.; et al. Aging increases the susceptibility of hepatic inflammation, liver fibrosis and aging in response to high-fat diet in mice. Age 2016, 38, 291–302. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Samuel, V.T.; Shulman, G.I. Mechanisms for insulin resistance: Common threads and missing links. Cell 2012, 148, 852–871. [Google Scholar] [CrossRef] [PubMed]
- Vasto, S.; Candore, G.; Balistreri, C.R.; Caruso, M.; Colonna-Romano, G.; Grimaldi, M.P.; Listi, F.; Nuzzo, D.; Lio, D.; Caruso, C. Inflammatory networks in ageing, age-related diseases and longevity. Mech. Ageing Dev. 2007, 128, 83–91. [Google Scholar] [CrossRef] [PubMed]
- Franceschi, C.; Bonafe, M. Centenarians as a model for healthy aging. Biochem. Soc. Trans. 2003, 31, 457–461. [Google Scholar] [CrossRef] [PubMed]
- Solon-Biet, S.M.; McMahon, A.C.; Ballard, J.W.; Ruohonen, K.; Wu, L.E.; Cogger, V.C.; Warren, A.; Huang, X.; Pichaud, N.; Melvin, R.G.; et al. The ratio of macronutrients, not caloric intake, dictates cardiometabolic health, aging, and longevity in ad libitum-fed mice. Cell Metab. 2014, 19, 418–430. [Google Scholar] [CrossRef] [PubMed]
- Le Couteur, D.G.; Tay, S.S.; Solon-Biet, S.; Bertolino, P.; McMahon, A.C.; Cogger, V.C.; Colakoglu, F.; Warren, A.; Holmes, A.J.; Pichaud, N.; et al. The influence of macronutrients on splanchnic and hepatic lymphocytes in aging mice. J. Gerontol. Ser. A Biol. Sci. Med. Sci. 2015, 70, 1499–1507. [Google Scholar] [CrossRef] [PubMed]
- Solon-Biet, S.M.; Cogger, V.C.; Pulpitel, T.; Heblinski, M.; Wahl, D.; McMahon, A.C.; Warren, A.; Durrant-Whyte, J.; Walters, K.A.; Krycer, J.R.; et al. Defining the nutritional and metabolic context of fgf21 using the geometric framework. Cell Metab. 2016, 24, 555–565. [Google Scholar] [CrossRef] [PubMed]
- Laeger, T.; Henagan, T.M.; Albarado, D.C.; Redman, L.M.; Bray, G.A.; Noland, R.C.; Munzberg, H.; Hutson, S.M.; Gettys, T.W.; Schwartz, M.W.; et al. Fgf21 is an endocrine signal of protein restriction. J. Clin. Investig. 2014, 124, 3913–3922. [Google Scholar] [CrossRef] [PubMed]
- Laeger, T.; Albarado, D.C.; Burke, S.J.; Trosclair, L.; Hedgepeth, J.W.; Berthoud, H.-R.; Gettys, T.W.; Collier, J.J.; Münzberg, H.; Morrison, C.D. Metabolic responses to dietary protein restriction require an increase in fgf21 that is delayed by the absence of gcn2. Cell Rep. 2016, 16, 707–716. [Google Scholar] [CrossRef] [PubMed]
- De Sousa-Coelho, A.L.; Marrero, P.F.; Haro, D. Activating transcription factor 4-dependent induction of fgf21 during amino acid deprivation. Biochem. J. 2012, 443, 165–171. [Google Scholar] [CrossRef] [PubMed]
- Perez-Marti, A.; Garcia-Guasch, M.; Tresserra-Rimbau, A.; Carrilho-Do-Rosario, A.; Estruch, R.; Salas-Salvado, J.; Martinez-Gonzalez, M.A.; Lamuela-Raventos, R.; Marrero, P.F.; Haro, D.; et al. A low-protein diet induces body weight loss and browning of subcutaneous white adipose tissue through enhanced expression of hepatic fibroblast growth factor 21 (fgf21). Biochem. Nutr. Food Res. 2017, 61, 1600725. [Google Scholar] [CrossRef] [PubMed]
- D’Antona, G.; Ragni, M.; Cardile, A.; Tedesco, L.; Dossena, M.; Bruttini, F.; Caliaro, F.; Corsetti, G.; Bottinelli, R.; Carruba, M.O.; et al. Branched-chain amino acid supplementation promotes survival and supports cardiac and skeletal muscle mitochondrial biogenesis in middle-aged mice. Cell Metab. 2010, 12, 362–372. [Google Scholar] [CrossRef] [PubMed]
- Platt, K.M.; Charnigo, R.J.; Shertzer, H.G.; Pearson, K.J. Branched-chain amino acid supplementation in combination with voluntary running improves body composition in female c57bl/6 mice. J. Diet. Suppl. 2016, 13, 473–486. [Google Scholar] [CrossRef] [PubMed]
- Nishitani, S.; Takehana, K.; Fujitani, S.; Sonaka, I. Branched-chain amino acids improve glucose metabolism in rats with liver cirrhosis. Am. J. Physiol. Gastrointest. Liver Physiol. 2005, 288, G1292–G1300. [Google Scholar] [CrossRef] [PubMed]
- Arakawa, M.; Masaki, T.; Nishimura, J.; Seike, M.; Yoshimatsu, H. The effects of branched-chain amino acid granules on the accumulation of tissue triglycerides and uncoupling proteins in diet-induced obese mice. Endocr. J. 2011, 58, 161–170. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lu, M.; Zhang, X.; Zheng, D.; Jiang, X.; Chen, Q. Branched-chain amino acids supplementation protects streptozotocin-induced insulin secretion and the correlated mechanism. BioFactors 2015, 41, 127–133. [Google Scholar] [CrossRef] [PubMed]
- Terakura, D.; Shimizu, M.; Iwasa, J.; Baba, A.; Kochi, T.; Ohno, T.; Kubota, M.; Shirakami, Y.; Shiraki, M.; Takai, K.; et al. Preventive effects of branched-chain amino acid supplementation on the spontaneous development of hepatic preneoplastic lesions in c57bl/ksj-db/db obese mice. Carcinogenesis 2012, 33, 2499–2506. [Google Scholar] [CrossRef] [PubMed]
- Hale, J.E.; Butler, J.P.; Gelfanova, V.; You, J.S.; Knierman, M.D. A simplified procedure for the reduction and alkylation of cysteine residues in proteins prior to proteolytic digestion and mass spectral analysis. Anal. Biochem. 2004, 333, 174–181. [Google Scholar] [CrossRef] [PubMed]
- Laeger, T.; Reed, S.D.; Henagan, T.M.; Fernandez, D.H.; Taghavi, M.; Addington, A.; Munzberg, H.; Martin, R.J.; Hutson, S.M.; Morrison, C.D. Leucine acts in the brain to suppress food intake but does not function as a physiological signal of low dietary protein. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2014, 307, R310–R320. [Google Scholar] [CrossRef] [PubMed]
- Youm, Y.H.; Grant, R.W.; McCabe, L.R.; Albarado, D.C.; Nguyen, K.Y.; Ravussin, A.; Pistell, P.; Newman, S.; Carter, R.; Laque, A.; et al. Canonical nlrp3 inflammasome links systemic low-grade inflammation to functional decline in aging. Cell Metab. 2013, 18, 519–532. [Google Scholar] [CrossRef] [PubMed]
- Park, M.H.; Kim, D.H.; Lee, E.K.; Kim, N.D.; Im, D.S.; Lee, J.; Yu, B.P.; Chung, H.Y. Age-related inflammation and insulin resistance: A review of their intricate interdependency. Arch. Pharm. Res. 2014, 37, 1507–1514. [Google Scholar] [CrossRef] [PubMed]
- Mueller, S.N.; Gebhardt, T.; Carbone, F.R.; Heath, W.R. Memory t cell subsets, migration patterns, and tissue residence. Ann. Rev. Immunol. 2013, 31, 137–161. [Google Scholar] [CrossRef] [PubMed]
- Miller, R.A. The aging immune system: Primer and prospectus. Science 1996, 273, 70–74. [Google Scholar] [CrossRef] [PubMed]
- Gruver, A.L.; Hudson, L.L.; Sempowski, G.D. Immunosenescence of ageing. J. Pathol. 2007, 211, 144–156. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- White, B.D.; Porter, M.H.; Martin, R.J. Effects of age on the feeding response to moderately low dietary protein in rats. Physiol. Behav. 2000, 68, 673–681. [Google Scholar] [CrossRef]
- Schwartz, G.J. Central leucine sensing in the control of energy homeostasis. Endocrinol. Metab. Clin. N. Am. 2013, 42, 81–87. [Google Scholar] [CrossRef] [PubMed]
- Zhang, F.; Zhao, S.; Yan, W.; Xia, Y.; Chen, X.; Wang, W.; Zhang, J.; Gao, C.; Peng, C.; Yan, F.; et al. Branched chain amino acids cause liver injury in obese/diabetic mice by promoting adipocyte lipolysis and inhibiting hepatic autophagy. EBioMedicine 2016, 13, 157–167. [Google Scholar] [CrossRef] [PubMed]
- Newgard, C.B.; An, J.; Bain, J.R.; Muehlbauer, M.J.; Stevens, R.D.; Lien, L.F.; Haqq, A.M.; Shah, S.H.; Arlotto, M.; Slentz, C.A.; et al. A branched-chain amino acid-related metabolic signature that differentiates obese and lean humans and contributes to insulin resistance. Cell Metab. 2009, 9, 311–326. [Google Scholar] [CrossRef] [PubMed]
- Coskun, T.; Bina, H.A.; Schneider, M.A.; Dunbar, J.D.; Hu, C.C.; Chen, Y.; Moller, D.E.; Kharitonenkov, A. Fibroblast growth factor 21 corrects obesity in mice. Endocrinology 2008, 149, 6018–6027. [Google Scholar] [CrossRef] [PubMed]
- Bruckbauer, A.; Zemel, M.B. Synergistic effects of metformin, resveratrol, and hydroxymethylbutyrate on insulin sensitivity. Diabetes Metab. Syndr. Obes. Targets Ther. 2013, 6, 93. [Google Scholar] [Green Version]
- Zhang, Y.; Xie, Y.; Berglund, E.D.; Coate, K.C.; He, T.T.; Katafuchi, T.; Xiao, G.; Potthoff, M.J.; Wei, W.; Wan, Y.; et al. The starvation hormone, fibroblast growth factor-21, extends lifespan in mice. Elife 2012, 1, e00065. [Google Scholar] [CrossRef] [PubMed]
- Potthoff, M.J.; Kliewer, S.A.; Mangelsdorf, D.J. Endocrine fibroblast growth factors 15/19 and 21: From feast to famine. Genes Dev. 2012, 26, 312–324. [Google Scholar] [CrossRef] [PubMed]
- Ge, X.; Wang, Y.; Lam, K.S.L.; Xu, A. Metabolic actions of fgf21: Molecular mechanisms and therapeutic implications. Acta. Pharm. Sin. B 2012, 2, 350–357. [Google Scholar] [CrossRef]
- Harms, M.; Seale, P. Brown and beige fat: Development, function and therapeutic potential. Nat. Med. 2013, 19, 1252–1263. [Google Scholar] [CrossRef] [PubMed]
- Wu, D.; Molofsky, A.B.; Liang, H.E.; Ricardo-Gonzalez, R.R.; Jouihan, H.A.; Bando, J.K.; Chawla, A.; Locksley, R.M. Eosinophils sustain adipose alternatively activated macrophages associated with glucose homeostasis. Science 2011, 332, 243–247. [Google Scholar] [CrossRef] [PubMed]
- Hasek, B.E.; Boudreau, A.; Shin, J.; Feng, D.; Hulver, M.; Van, N.T.; Laque, A.; Stewart, L.K.; Stone, K.P.; Wanders, D.; et al. Remodeling the integration of lipid metabolism between liver and adipose tissue by dietary methionine restriction in rats. Diabetes 2013, 62, 3362–3372. [Google Scholar] [CrossRef] [PubMed]
- Mitchell, S.J.; Madrigal-Matute, J.; Scheibye-Knudsen, M.; Fang, E.; Aon, M.; Gonzalez-Reyes, J.A.; Cortassa, S.; Kaushik, S.; Gonzalez-Freire, M.; Patel, B.; et al. Effects of sex, strain, and energy intake on hallmarks of aging in mice. Cell Metab. 2016, 23, 1093–1112. [Google Scholar] [CrossRef] [PubMed]
- Hui, X.; Gu, P.; Zhang, J.; Nie, T.; Pan, Y.; Wu, D.; Feng, T.; Zhong, C.; Wang, Y.; Lam, K.S.; et al. Adiponectin enhances cold-induced browning of subcutaneous adipose tissue via promoting m2 macrophage proliferation. Cell Metab. 2015, 22, 279–290. [Google Scholar] [CrossRef] [PubMed]
- Yang, H.; Youm, Y.H.; Vandanmagsar, B.; Rood, J.; Kumar, K.G.; Butler, A.A.; Dixit, V.D. Obesity accelerates thymic aging. Blood 2009, 114, 3803–3812. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Ingredient (g) | Control | Control + BCAA | Low Protein | Low Protein + BCAA |
---|---|---|---|---|
Casein | 140 | 140 | 70 | 70 |
L-Leucine | 0 | 11.1 | 0 | 11.1 |
L-Isoleucine | 0 | 8.2 | 0 | 8.2 |
L-Valine | 0 | 8.2 | 0 | 8.2 |
L-Cystine | 1.8 | 1.8 | 1.8 | 1.8 |
Corn starch | 496 | 468 | 544 | 516 |
Maltodextrin 10 | 125 | 125 | 125 | 125 |
Sucrose | 100 | 100 | 100 | 100 |
Cellulose | 50 | 50 | 50 | 50 |
Soybean oil | 40 | 40 | 40 | 40 |
t-Butylhydroquinone | 0.008 | 0.008 | 0.008 | 0.008 |
Mineral Mix S10022M | 35 | 35 | 35 | 35 |
Vitamin Mix V10037 | 10 | 10 | 10 | 10 |
Choline Bitartrate | 2.5 | 2.5 | 2.5 | 2.5 |
Macronutrient composition (kcal%) | Control | Control + BCAA | Low protein | Low protein + BCAA |
Protein | 13 | 16 | 7 | 10 |
Carbohydrate | 77 | 74 | 83 | 80 |
Fat | 10 | 10 | 10 | 10 |
kcal/g | 3.7 | 3.7 | 3.8 | 3.8 |
Gene | Primer Sequence |
---|---|
Ppib | F AGCAAGTTCCATCGTGTCATC |
R CCGTAGTGCTTCAGCTTGA | |
Ifn-γ | F CTGAGACAATGAACGCTACACA |
R TCCACATCTATGCCACTTGAG | |
Mcp1 | F CATCCACGTGTTGGCTCA |
R AACTACAGCTTCTTTGGGACA | |
Ucp1 | F CAAATCAGCTTTGCCTCACTC |
R CACACCTCCAGTCATTAAGCC | |
Adiponectin | F TGTCTGTACGATTGTCAGTGG |
R GCAGGATTAAGAGGAACAGGAG | |
Pgc-1α | F AGAAGTCCCATACACAACCG |
R GGTCACTGGAAGATATGGCA | |
Cidea | F TCAAACCATGACCGAAGTAGC |
R GTAACCAGGCCAGTTGTGAT | |
Fgf21 | F CAGCCTTAGTGTCTTCTCAGC |
R GGGATGGGTCAGGTTCAGA | |
Prdm16 | F CACAAGACATCTGAGGACACA |
R CACTTGAACGGCTTCTCTTTG | |
Cxcl5 | F TTCTGTTGCTGTTCACGCT |
R ATCACCTCCAAATTAGCGATCA | |
Arg1 | F GAATGGAAGAGTCAGTGTGGT |
R AGTGTTGATGTCAGTGTGAGC | |
Il-10 | F GTCATCGATTTCTCCCCTGTG |
R ATGGCCTTGTAGACACCTTG | |
Tnf-α | F AGACCCTCACACTCAGATCA |
R TCTTTGAGATCCATGCCGTTG |
Dietary Groups | Baseline | 6 Months | 12 Months | |
---|---|---|---|---|
Lean mass (g) | Control | 22.63 ± 0.55 | 25.88 ± 0.65 ab | 26.45 ± 0.63 a |
Control + BCAA | 22.30 ± 0.48 | 26.33 ± 0.77 ab | 26.45 ± 0.79 a | |
Low protein | 22.37 ± 0.43 | 23.67 ± 0.58 b | 23.61 ± 0.48 b | |
Low protein + BCAA | 22.86 ± 0.53 | 26.49 ± 0.52 a | 27.04 ± 0.63 a | |
Fat mass (g) | Control | 4.33 ± 0.16 | 11.10 ± 0.56 ab | 12.67 ± 0.67 ab |
Control + BCAA | 4.37 ± 0.14 | 11.82 ± 0.70 ab | 14.21 ± 0.75 ab | |
Low protein | 4.51 ± 0.21 | 9.14 ± 0.88 b | 10.73 ± 0.94 b | |
Low protein + BCAA | 4.22 ± 0.16 | 12.98 ± 0.59 a | 15.95 ± 0.88 a | |
Femur BMD (g/cm2) | Control | 0.071 ± 0.002 | 0.079 ± 0.001 | 0.076 ± 0.002 |
Control + BCAA | 0.067 ± 0.002 | 0.075 ± 0.002 | 0.074 ± 0.001 | |
Low protein | 0.067 ± 0.002 * | 0.073 ± 0.001 * | 0.071 ± 0.001 * | |
Low protein + BCAA | 0.072 ± 0.002 | 0.076 ± 0.002 | 0.073 ± 0.001 | |
Femur BMC (g) | Control | 0.037 ± 0.002 | 0.038 ± 0.001 | 0.036 ± 0.001 |
Control + BCAA | 0.037 ± 0.002 | 0.036 ± 0.001 | 0.034 ± 0.001 | |
Low protein | 0.034 ± 0.001 | 0.034 ± 0.001 | 0.031 ± 0.001 | |
Low protein + BCAA | 0.037 ± 0.001 | 0.035 ± 0.001 | 0.033 ± 0.001 |
Dietary Groups | Name | Overlap | Molecules (Direction of Regulation) |
---|---|---|---|
Low protein vs. Control | Oxidative phosphorylation | 18/109 | COX4I1, NDUFA12, SDHA, NDUFB8, NDUFV1, NDUFA2, ATP5D, COX6C, NDUFS1, SDHB, COX7A2, NDUFS2, ATP5L, NDUFA6, NDUFA3, ATP5C1, NDUFB4, NDUFV2 (all upregulated by low protein) |
Mitochondrial dysfunction | 19/171 | COX4I1, HSD17B10, NDUFA12, SDHA, NDUFB8, NDUFV1, NDUFA2, ATP5D, COX6C, NDUFS1, SDHB, COX7A2, NDUFS2, ATP5L, NDUFA6, NDUFA3, ATP5C1, NDUFB4, NDUFV2 (all upregulated by low protein) | |
Superpathway of Citrulline Metabolism | 8/14 | OAT, OTC, CPS1, ASS1, ARG1, PRODH, GLS2, ASL (all upregulated by low protein) | |
Urea Cycle | 5/6 | OAT, CPS1, ASS1, ARG1, ASL (all upregulated by low protein) | |
Citrulline Biosynthesis | 5/8 | OAT, OTC, ARG1, PRODH, GLS2 (all upregulated by low protein) | |
Low protein vs. Low protein + BCAA | Tyrosine Degradation I | 3/5 | FAH, HGD, HPD (all downregulated by low protein) |
Urea Cycle | 3/6 | OTC, ARG1, ASL (all downregulated by low protein) | |
Cysteine Biosynthesis/Homocysteine Degradation | 2/2 | CBS, CTH (both downregulated by low protein) | |
Superpathway of Citrulline Metabolism | 3/14 | OTC, ARG1, ASL (all downregulated by low protein) | |
TCA Cycle II (Eukaryotic) | 3/23 | SDHB, FH, SDHA (all downregulated by low protein) |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mu, W.-C.; VanHoosier, E.; Elks, C.M.; Grant, R.W. Long-Term Effects of Dietary Protein and Branched-Chain Amino Acids on Metabolism and Inflammation in Mice. Nutrients 2018, 10, 918. https://doi.org/10.3390/nu10070918
Mu W-C, VanHoosier E, Elks CM, Grant RW. Long-Term Effects of Dietary Protein and Branched-Chain Amino Acids on Metabolism and Inflammation in Mice. Nutrients. 2018; 10(7):918. https://doi.org/10.3390/nu10070918
Chicago/Turabian StyleMu, Wei-Chieh, Erin VanHoosier, Carrie M. Elks, and Ryan W. Grant. 2018. "Long-Term Effects of Dietary Protein and Branched-Chain Amino Acids on Metabolism and Inflammation in Mice" Nutrients 10, no. 7: 918. https://doi.org/10.3390/nu10070918
APA StyleMu, W.-C., VanHoosier, E., Elks, C. M., & Grant, R. W. (2018). Long-Term Effects of Dietary Protein and Branched-Chain Amino Acids on Metabolism and Inflammation in Mice. Nutrients, 10(7), 918. https://doi.org/10.3390/nu10070918