Evaluation of the Efficacy of Three Newcastle Disease Vaccines Produced at the National Veterinary Institute, Bishoftu, Ethiopia, at Different Temperature Storage Conditions

Round 1

Reviewer 1 Report

Comments and Suggestions for Authors

Hi guys, 

The work is interesting for the region where it is done. However, the author needs to make significant improvements before submitting it to a reputable publisher such as MDPI.

Some suggestions,

The introduction section lacks a passage discussing the relationship between temperature and vaccine efficacy, which could justify the necessity of the work.

There are numerous typos throughout the paper, especially in the materials method section, which could potentially influence the reader's perspective.

While the result part is satisfactory, we would appreciate it if you could provide a high-quality, fresh PCR image. If this is the only picture, then you can improve the color contrast quality. Also, figure 3 is not the same resolution as other pictures. 

The most crucial section, the discussion, requires significant enhancements. I only found one citation in the discussion section, and the entire discussion section is essentially a repetition of the results section.

The conclusion part is also the same repetition of the result part. The summary should be concise and educational for the audience.

 

I hope that if you guys follow the comments, your paper will be much stronger and more attractive to the reader. Best of luck!!

Comments on the Quality of English Language

You need to edit/rewrite with a good language editor. The language structure and cohesion are not quality full. 

Author Response

Please see the attachment.

Author Response File: Author Response.pdf

Reviewer 2 Report

Comments and Suggestions for Authors

I evaluate the research concept positively, but both the style of the manuscript and the analysis of the results require significant correction.

The work is written carelessly and the text requires stylistic and linguistic corrections. Sentences cannot contain any mental shortcuts, all shortcuts must be explained the first time they are used.

The antibody titer measurement results obtained for each group of chickens should be presented as mean +/- standard deviation!

The results should be subjected to statistical analysis to determine whether the observed differences are significant, e.g. whether the antibody titer obtained after vaccination birds using a preparation stored at 4°C is significantly higher than the antibody titer obtained using a preparation stored at a different temperature. (Newcastle Lasota vaccine, day 14).

The abstract is unclear because it contains many unexplained abbreviations

Figure 1 - the term "antibody response" is unclear; is it about antibody titer? please correct this in both the table title and the figure; I suggest adding "C" to the chart legend, e.g. +23C, +4C,

Chapter 2.4. What volume of serum was obtained from 1.5 ml of blood?

Chapter 2.5. L130-131 - what was the range of serum dilutions used from the study groups and the control group?

L131 - what HA antigen was used in the hemagglutination inhibition test? please provide the manufacturer and parameters of the preparation.

Chapter 2.7. - The description of the methodology is unclear (only at the end of the chapter does the reader learn what PCR was about) and the first sentence is stylistically incorrect. Did the authors design the starters themselves? If so, how and what was the DNA template (please provide the sequence accession number from the database). Otherwise, add a citation. How was RNA isolated? Why are "Cycle" and "Denaturation" capitalized?

L13 – avian – not “Avian”

L150 – polymerase, not „Polymerase”

L160 – explain SPSS and add company

L165-166 - the sentence is stylistically incorrect and has therefore changed its meaning

L175 – change “high” to higher if making a comparison

L177 – Figure 1 – not “figure 1”

L206 – “Another” – do you meant another than Newcastle thermostable vaccine?

L21 - The HB1, Lasota and I-2 vaccines had antibody titer of 151… - this is mental shortcuts; vaccines do not contain  antibodies, only antigens; a similar mental abbreviation also appears in other places in the text, e.g. L25, L306, L196

L49 - I believe that the reason for vaccination failure may be the poor antigenicity of the vaccine, not the low level of antibodies (besides, I have doubts about the term "level", because it is very general, in science precise terms should be used, e.g. concentration or titer).

L37 – Avulavirinae and Orthoavulavirus - taxonomic names should be written in italics

L43 % L259 - national veterinary institute (NVI) - all parts of the name of units such as an institute are written in capital letters

L177 – Newcastle – not “new castle”

L72 & L91 – the full name of the Institute should not be repeated (the full name is in line 43)

L39 – “[1] [2].” – I think it should be [1-2] – correct in whole text, please

L41 - Zegeye et al. [add citation number next to authore name, please]

L53, L134, L141 - explain the abbreviation NCD, ARBCs, ELD (L141)

L54 – remove “these”

L79 and whole text, including Table 1 – change “hour/s” into “h”

Many places in the text lack spaces, e.g. L118 (3mL), 172, 186, 203, 205, 230, 238, 240, 305…

The title of Figure 6 should be changed to be more informative; what sequences/gene were amplified?

Figure 6 is of poor quality and is difficult to read, and the captions "MM, S2, S3, etc. are shifted in relation to the paths on the gel"

Lasota should be written in capital letter – whole text, eg. L302

L305 – incorrect style

L307 & 310- +30 oc; +4 oc

L31 & L314 – Did you determine the titer of the viable virus in the vaccine?

L116 - What were the criteria for assessing infectivity?

L127 - Allan and Gough (1974) – change into “Allan and Gough [cyt. No.]”

The format of the entire Reference chapter is incorrect. 

Comments on the Quality of English Language

text requires stylistic and linguistic corrections

Author Response

Please see the attachment.

Author Response File: Author Response.pdf

Round 2

Reviewer 1 Report

Comments and Suggestions for Authors

Thanks for addressing all the issues. 

Author Response

Reviewer 1

Q1: Does the introduction provide sufficient background and include all relevant references?

A1: According to the reviewer comment and suggestion modification to the introduction was done.

Introduction

Newcastle disease (NCD) caused by Newcastle disease virus (NDV) an Avian Paramyxovirus-1 (APMV-1), subfamily Avulavirinae, genus Orthoavulavirus and species Avian orthoavulavirus is one of the important contagious viral disease of domestic poultry and wild birds[1, 2]Though it is vaccine-preventable, it is a persistent threat to the poultry industry across the globe in general and Ethiopia in particular. In Ethiopia a meta-analysis conducted indicated that a pooled sero-prevallence of 21.47% (19.54-23.4%) [3] . The control approach used so far in Ethiopia is vaccination using three vaccines produced by NVI and available vaccine from commercial providers. Though millions of doses are used for vaccinating commercial poultry production year round outbreak occurrence is a common phenomenon (anecdotal evidence). The repeated outbreak occurrence results from vaccine failure that arises from change in the genetic diversity of the circulating (mismatched vaccine strains) strain, incorrect vaccine timing, mishandling of vaccines, poor vaccine quality, and low antigen load in the vaccine. Other factors include immune suppression, maternal antibodies, stress, and management practices [4, 5].

Some countries in Africa and Asia implemented regular vaccination programs using live or inactivated vaccines of NCD based on lento genic viruses of genotypes I and II for effective control of the disease [7] [7]. On contrary well-vaccinated commercial farms in many endemic countries have reported outbreaks of NCD [8]. The virus is known for its rapid evolution that brought genetic divergence between strains responsible for outbreaks and the vaccines available to control the disease [9, 10]. On the other hand these vaccines can still protect chickens from the disease but not viral excretion [11, 12, 13].

Vaccination is the most cost-effective way to control Newcastle disease (NCD) in poultry. Several conventional live vaccines are available internationally and have successfully reduced disease incidence. However, maintaining a cold chain during storage and distribution is a major challenge, especially in tropical regions where NCD is widespread. Poor biosecurity and inadequate storage conditions lead to significant economic losses, and in countries with unreliable electricity, vaccines may be transported for hours without refrigeration, further diminishing their efficacy [6].Storage temperature impact on vaccine efficacy has been reported by different researchers, among which is the Foot-and-mouth disease (FMD) vaccine and other vaccines were often stored outside the recommended temperature ranges in veterinary drugstores has reduced the vaccine efficacy [14].Another research indicated that a type O FMD vaccine remained 100% effective after 2 years at 4°C, 3 weeks at 25 °C, and 1 week at 37 °C. However, efficacy dropped to 80% after 4 weeks storage at 25°C or 2 weeks at 37°C [15].

 

Effective vaccination is essential for preventing Newcastle disease (NCD) in poultry. Although challenge experiments are the best way to evaluate vaccine efficacy, their expense and time requirements often lead to the use of serological tests to assess immune responses, such as antibody titers. Detection of Newcastle disease virus (NCDV) typically relies on hem agglutination (HA) and hemagglutination inhibition (HI) tests, regarded as the gold standard. However, despite vaccines use in broilers, recent reports of vaccination failures have raised concerns about the effectiveness of current vaccination approaches [16].

The vaccines produced at National Veterinary Institute (NVI) are used at different age and production stages starting from day one. The repeated outbreak occurrence in Ethiopia might arise from vaccine failure as indicated above due to improper storage of the vaccine out of the recommended storage condition and possibly other factors associated with value chain of the vaccine.

The optimal storage temperature for NCD vaccine produced at NVI are indicated on the product description of the vaccines from+4°Cto-20°C [17] Based on the above rationale we aimed to evaluate the antibody titer of chickens vaccinated using NCD-HB1, NCD-Lasota and NCD-Thermostable-I2 vaccines stored both in and out of the recommended storage condition intentionally

Reviewer 2 Report

Comments and Suggestions for Authors

The authors have proofread the work, but only partially. Statistical analyses have not been performed to determine whether the observed differences in antibody titers are statistically significant (determining the mean and standard deviation does not allow determining whether a given difference is significant or not).

Secondly, the test still contains many stylistic errors (including mental shortcuts), punctuation and typographical errors. The work is written unprofessionally. Contrary to the authors' assurances, the text has certainly not undergone professional language proofreading. In this form, it is certainly not suitable for publication.

 

Here are some examples of language errors:

- sentences starting with "But" - L31, L213, L331

- repeated mental shortcut that the vaccine has antibodies! The vaccine contains antigens, and may induce antibodies (stimulate the production of antibodies in the host) - L36, L314, L344

- lack of spaces in many places in the text

- drug store or drugstore? 

-New castle insted of Newcastle - L26

- hours instead of h

- term "standard deciation" should be removed in whole text, and the information about the antibody titer should be written like this: 151+/- 103 (e.g. L27).

- L281 - information about the name and manufacturer of the molecular pattern used should be included in the M&M chapter

- L20 - put "antibody titer" in brackets

- L322 - add surname/-s: ...with the finding of who? [20].

- there are lack of uniformity in the writing of vaccine names, e.g. NCD-HB1 (L26), HB1 (L82), NCDHB1 (L111), NCDHB1 (L116)

-L32 - use C insted of degree centigrade

- What does "log antibody titer" mean (in many places in the text)? The antibody titer is the reciprocal of the highest serum dilution at which agglutination occurs, i.e. if the highest dilution with a positive reaction is 1:128, the antibody titer is 128 (not 128 log).

- The figures/graphs must show the standard deviation values.

- The process of obtaining hemagglutinin should be described in detail (L149).

- L180 - do you mean viral matrix protein?

- The figure legend is unclear. What exactly is the gene being amplified? What is the exact name of the protein encoded by this gene? (is M+4100 the name of the protein or the name of the primer?). The names and sequences of the primers are given in the M&M section and should not be repeated in the figure legend. It is written under the figure that Matrix was amplified! It is possible to amplify the viral gene encoding a specific matrix protein, not Matrix.  Which two sets of primers? in the section. M&M was given one set (1 pair) of starters, not two sets.

- L 309 - antigen can not be viable - virus can be viable, not antigen

- L310 - findings of who? add surname, please

- The entire References section is written contrary to MDPI guidelines.

 

Comments for author File: Comments.pdf

Comments on the Quality of English Language

The text requires linguistic and stylistic correction.

Author Response

 

Reply to Reviewer 2

The authors have proofread the work, but only partially. Statistical analyses have not been performed to determine whether the observed differences in antibody titers are statistically significant (determining the mean and standard deviation does not allow determining whether a given difference is significant or not).

Secondly, the test still contains many stylistic errors (including mental shortcuts), punctuation and typographical errors. The work is written unprofessionally. Contrary to the authors' assurances, the text has certainly not undergone professional language proofreading. In this form, it is certainly not suitable for publication.

Dear Reviewer as Much as possible the comments and suggestions were addressed throughout the text and particular attentions were given to the below one.

 

Here are some examples of language errors:

Q1- sentences starting with "But" – But is removed and the seentecne is corrected as follows:

A1:L31,: All vaccines stored at different temperature (+4, +23 and +30°C) on day 28 post vaccination and used in this experiment had given  antibody titer >128 except the Newcastle disease vaccine thermostable stored at +30°C that had 115  antibody titer.

A1: L213, On the other hand vaccine stored at +4 °C had induced a better antibody titer of 136 (+/-53.4) starting from day 14 which was not the case in other storage condition.

 

A1: L331: From this study it was observed that +4 °C storage temperature condition could also gave a good protective antibody titer starting from day 14 post vaccination.

Q2:- repeated mental shortcut that the vaccine has antibodies! The vaccine contains antigens, and may induce antibodies ( –

Dear Reviewer thank you for the comments,

A2:L36, : The vaccine collected from private veterinary drugstore (customer vaccine) believed to be stored at -20 °C, specifically of Newcastle disease Hachiner’s B1 (NCD-HB1) and NCDThermostable-I2) used in this experiment induced very low antibody titer (<128  antibody titer) from day 14 to 21 which increased >128 antibody titer on day 28.

A2:L314,: The HI mean induced antibody titer of the vaccine stored at +4 °C at day 14, 21, and 28 post vaccination with NCD Lasota showed protective titer (136, 144, and 208) which is ≥ 2⁴

 A2:L344: The vaccine stored at the second storage condition +23 °C also induced a good antibody titer that started from day 7 to day 28 post vaccination.

Q3:- lack of spaces in many places in the text

- drug store or drugstore? 

A3::drugstore

Q4:-New castle instead of Newcastle –

A4: L26: Newcastle

Q5:- hours instead of h

A5:Hours

Q6- term "standard deciation" should be removed in whole text, and the information about the antibody titer should be written like this: 151+/- 103 (e.g. L27).

A6: Corrected accordingly

Q7- L281 - information about the name and manufacturer of the molecular pattern used should be included in the text.

 A7: The molecular marker used here is DNA Molecular Weight Marker XIV (100 bp ladder) from sigma Aldrich. (Figure 4).e M&M chapter

Q8:- L20 - put "antibody titer" in brackets

Haemagglutination and Haemagglutination inhibition assays were used to evaluate the immune response (antibody titer) of chickens.

Q9- L322 - add surname/-s: ...with the finding of who? [20].

A9:Bordoloi et al was added

Q10:- there are lack of uniformity in the writing of vaccine names, e.g. NCD-HB1 (L26), HB1 (L82), NCDHB1 (L111), NCDHB1 (L116)

A10:Uniformity is kept by making NCD-HB1 this is done for all other vaccines

Q11-L32 - use C instead of degree centigrade

A11:Degree centigrade is replaced by ^OC

Q12- What does "log antibody titer" mean (in many places in the text)? The antibody titer is the reciprocal of the highest serum dilution at which agglutination occurs, i.e. if the highest dilution with a positive reaction is 1:128, the antibody titer is 128 (not 128 log).

A12:This corrected as antibody titer

-Q13 The figures/graphs must show the standard deviation values.

A13: Instead of the STDEV, we used standard error and showed as follows;

NCD-HB1

 

NCD-Lasota

 

 

 

 

 

 

 

NCD-TH-I2

 

Q14- The process of obtaining hemagglutinin should be described in detail (L149).

A14:Haemagglutination inhibition (HI) test as serological method was used as described [20] conducted with two-fold serum dilutions, 4 units of hemagglutinin (In-house produced at NVI).This was done by inoculating local virulent NCD strain of Newcastle disease virus to  an eleven day embryonated chicken egg, the allantoic fluid containing the virus is harvested. Cell remnants and debris were removed by centrifugation. Then the supernatant will be filtered using 0.22μL and concentrated using precipitation. The hemagglutinin was used for this experiment was from the final precipitate.

Q15- L180 - do you mean viral matrix protein?

A15:Polymerase chain reaction (PCR) was performed targeting viral matrix gene using a primer (M) M+4100, FW: 5'- AGTGATGTGCTCGGACCTTC-3'’ and M−4220, RV: 5’CCTGAGGAGAGGCATTTGCTA3’ primers as described previously .

 

Q16- The figure legend is unclear. What exactly is the gene being amplified? What is the exact name of the protein encoded by this gene? (is M+4100 the name of the protein or the name of the primer?). The names and sequences of the primers are given in the M&M section and should not be repeated in the figure legend. It is written under the figure that Matrix was amplified! It is possible to amplify the viral gene encoding a specific matrix protein, not Matrix.  Which two sets of primers? in the section. M&M was given one set (1 pair) of starters, not two sets.

A16:The figure four legend is corrected as “Figure 4. Gel electrophoresis of the virulent strain of Newcastle disease virus detected using Polymerase chain reaction (PCR). Legend: S1-4: Brain tissue from control chicken’s that died after challenge; S5, 7and 9: trachea swab from control chickens that after the challenge; S6 and 8: spleen sample from vaccinated and challenged chickens”.

Q17- L 309 - antigen cannot be viable - virus can be viable, not antigen

A17: corrected as  Viable virus titer

Q18- L310 - findings of who? add surname, please

A18: Added

Q19- The entire References section is written contrary to MDPI guidelines.

A19: The reference is corrected as follows

[1]	H. M. I. M. Z. M. K. M. I. M. Haque MH, "" Isolation and detection of Newcastle disease virus from field outbreaks in broiler and layer chickens by reverse transcription-Polymerase chain reaction.,," J. Vet. Med., 8:, , pp. 87-92, (2010)..
[2]	D. J. L. C. S. R. D. R. S. R. A. M. A. S. F. B. M. F. H. A. C. O. MA, ""Prevalence of Newcastle disease virus in Broiler chickens (Gallus gallus) in Brazil.,"," Brazilian J. Microbiol., vol. 41, no. 2, pp. 349-57,, 2010..
[3]	T. W. M. W. S. H. L. M. Zegeye A, ""Epidemiology of Newcastle disease in chickens of Ethiopia: a systematic review and meta-analysis.,," Trop Anim Health Prod, Vols. 29,, no. 54(5),, p. 328, 2022..
[4]	Y. M. Butcher GD, " "Investigating Vaccination Failure in Poultry Flocks.,"," EDIS. fact sheet, vol. 1, (2009).
[5]	M. E. E. N. I. M. Müller H, " Current status of vaccines against infectious bursal disease.," Avian Pathology,, vol. 41, no. 2, pp. 133-139., 2012.
[6]	J. H. S. D. A. E. K. O. T. a. M. E. H. Zineb Boumart, "Thermal Stability Study of Five Newcastle Disease Attenuated Vaccine Strains," Avian Diseases, , vol. 60, no. 4, pp. 779-783., 2016.
[7]	K. A. C. Q. Y. a. M. P. Dimitrov, " "Newcastle disease vaccines – A solved problem or a continuous challenge?," Veterinary Microbiology,," Veterinary Microbiology,, vol. 206, pp. 126-13, 2017.
[8]	O. J. N. J. Ezema WS, "7. " LaSota vaccination may not protect against the lesions of velogenic Newcastle disease virus against the lesions of velogenic Newcastle disease in chickens.,"," Tropical Animal. Health Productivity, vol. 41, pp. 477-484, 2009.

 

Author Response File: Author Response.docx