Next Article in Journal
Aspects of Tuberculosis in Greece over the Last Century: Historical Perspectives and Today’s Challenges
Next Article in Special Issue
Evaluation of the Antibacterial and Antibiofilm Activity of Erythrina senegalensis Leaf Extract Against Multidrug-Resistant Bacteria
Previous Article in Journal
Urinary Neutrophil Gelatinase-Associated Lipocalin as a Predictor of COVID-19 Mortality in Hospitalized Patients
Previous Article in Special Issue
Evaluation of the Efficacy of Three Newcastle Disease Vaccines Produced at the National Veterinary Institute, Bishoftu, Ethiopia, at Different Temperature Storage Conditions
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Communication

Association Between the Duration of Diarrhea and the Length of Hospitalization Among Clostridioides difficile Patients in Northern Nigeria

1
Department of Microbiology, Federal University, Dutsin-Ma P.M.B. 5001, Katsina State, Nigeria
2
Department of Health Systems and Population Health Sciences, Tilman J. Fertitta Family College of Medicine, University of Houston, Houston, TX 77204, USA
3
Institute of Community Health, College of Pharmacy, University of Houston, Houston, TX 77204, USA
4
Department of Epidemiology, Human Genetics & Environmental Sciences, School of Public Health, University of Texas Health Science Center at Houston, Houston, TX 77030, USA
5
Microbiology and Infectious Diseases Program, Graduate School of Biomedical Sciences, University of Texas MD Anderson Cancer Center UTHealth, Houston, TX 77030, USA
*
Author to whom correspondence should be addressed.
Acta Microbiol. Hell. 2024, 69(4), 236-244; https://doi.org/10.3390/amh69040022
Submission received: 3 June 2024 / Revised: 20 September 2024 / Accepted: 25 September 2024 / Published: 31 October 2024
(This article belongs to the Special Issue Feature Papers in Medical Microbiology in 2024)

Abstract

The United States Centers for Disease Control and Prevention (CDC) has categorized Clostridioides difficile infection (CDI) as a significant concern in extended-care facilities, hospitals, and outpatient clinics. However, little is known about CDI in low- and middle-income countries. This study determined CDI prevalence and impact in outpatient adults presenting with diarrhea in Nigeria. Toxigenic culture and PCR were used to detect and validate C. difficile. Prior antibiotic use, medical history, and demographic data were also obtained. Descriptive and inferential statistics were used for data analysis. The patient demographics were 35.48% (22/62) for the 18–24 years age group and 32.26% (20/62) for both the 25–30 years age group and the 31+ years group, with an average age of 29.7 years. Forty-eight percent of the patients (30/62) tested positive for CDI, and the prevalence increased with age. Most patients (86.67%, 52/60) reported moderate/severe cases of diarrhea and 67.7% had no knowledge of antibiotics. The results showed that 62.30% of the cases were hospitalized with the duration of diarrhea being significantly associated (r = 0.98, p ˂ 0.001) with the length of hospitalization. These results suggest that C. difficile is common among diarrhea patients in this population and that Nigerian hospitals’ infection prevention and control measures must include this pathogen.

1. Introduction

Clostridioides difficile is a spore-forming Gram-positive bacterium that spreads through the fecal–oral route. C. difficile produces toxins in the colon, which result in diarrhea and colonic inflammation. Some of the risk factors of C. difficile infection (CDI) include recent hospitalization, antibiotics treatment, a weakened immune system, gastrointestinal surgery, proton pump therapy, and an age of 65 years or older [1]. However, old age (˃65 years) does not appear to be a significant risk factor for CDI in Africa [2]. This may be due to the overall younger African population; an estimated 3.5% is ≥65 years old, compared to 19.1% and 16.8% for Europe and North America, respectively [3].
CDI has been the leading cause of hospital-onset diarrhea worldwide [1]. Community-acquired CDI is on the increase in high-income countries, with the disease having a significant impact on patients and healthcare systems [4]. The United States (U.S.) Centers for Disease Control and Prevention (CDC) has estimated that 500,000 CDI cases occur yearly in the U.S., making it the most prevalent healthcare-associated infection (HAI) in the country [5]. In Europe, it is estimated that CDI causes 152,905 cases annually and is the 8th most frequently detected bacterium among HAI patients. Annually, 3700 hospital-acquired CDI deaths occur in the European Union and European Economic area [6]. Comprehensive and recent epidemiologic data on CDI are limited in Africa, Latin America, and Asia [7]. This is likely due to limitations in surveillance systems, awareness, and laboratory capacity and capabilities [8]. As a result, diarrhea patients are not routinely tested for CDI. When tested, it is usually with an enzyme immunoassay (EIA), which is less sensitive compared to stool culture [9].
In low- and middle-income countries, such as Nigeria, where the prevalence of diarrhea among children is 18.8% [10], vulnerability to diarrhea-causing pathogens among children and adults is often associated with unhygienic practices; this includes improper fecal disposal, food preparation, and consumption of contaminated water [11]. Moreover, several studies in Nigeria have reported E. coli and Salmonella as the primary causative agents of diarrhea [12,13]. Despite these, there is limited information available on the prevalence of CDI [14,15]. This study determined the prevalence of CDI and its potential impact among adult outpatients presenting with diarrhea in three hospitals in Northern Nigeria.

2. Materials and Methods

2.1. Study Population and Sample Collection

In this cross-sectional study, 62 adult outpatients (≥18 years) presenting with diarrhea were randomly enrolled from three hospitals (Malam Mande General Hospital, Dutsin-Ma, Turai Yaradua Maternity and Children Hospital, Katsina and Government House Clinic, Katsina) in Katsina State, Nigeria. All hospitals are managed by the Katsina State Hospital Management Board. The Malam Mande General Hospital is located in a rural area, while the other two hospitals are in an urban area. Case definition was determined by the attending physicians’ evaluation. Due to the non-availability of data on symptoms or diarrhea frequency, the severity of the disease was determined by the patient’s treatment setting [16] as an outpatient or admitted into the hospital (inpatient). Cases requiring hospitalization were classified as severe; mild cases were resolved within a few hours, while moderate cases were resolved within a day.
Following informed consent, questionnaires that captured previous antibiotic use, demographic data, and medical history, including hospitalization, were administered to patients. Afterward, stool samples were collected and stored at −20 °C. Subsequently, samples were placed on ice and shipped for laboratory analysis at the University of Texas Health Science Center, School of Public Health Center for Infectious Diseases, Houston, Texas, USA.

2.2. C. difficile Detection and Confirmation

The stool samples were tested for C. difficile using toxigenic culture and PCR (Darkoh et al., 2011) [17]. The bacterial isolates were confirmed by PCR amplifying of C. difficile-specific genes [18]. A Bactron 600 anaerobic chamber (Sheldon Manufacturing, Cornelius, OR, USA) maintained anaerobic conditions of 10% H2, 5% CO2, and 85% N2. The GenElute Bacterial Genomic DNA Kit (Sigma-Aldrich, St Louis, MO, USA) was used to extract DNA. Primers specific for toxin A (tcdA), TcdC (tcdC), and 16S ribosomal marker (16S rRNA) were used for the PCR reaction [19,20,21,22]. The Primer sequences are tcdA (F-5′AGATTCCTATATTTACATGACAATAT3′, R-5′GTATCAGGCATAAAGTAATATACTTT3′); tcdC (F-5′GAGCACAAAGGGTATTGCTCTACTGGC3′, R-5′CCAGACACAGCTAATCTTATTTGCACCT3′); and 16S rRNA (F-ACACGGTCCAAACTCCTACG, R-5′AGGCGAGTTTCAGCCTACAA3′). PCR amplification was performed using OneTaq Quick-Load 2X Master Mix (New England Biolabs, Ipswich, MA, USA) with an initial denaturation temperature of 94 °C for 30 s, followed by 36 cycles at 94 °C for 30 s, 55 °C for 30 s, 68 °C for 30 s; and a final extension of 68 °C for 5 min. The PCR results were assessed by agarose gel electrophoresis (1.0%) followed by staining with ethidium bromide and UV exposure. Toxin production was determined using the C. difficile TOX A/B II ELISA test (TechLab, Blacksburg, VA, USA).

2.3. Statistical Analysis

We used descriptive statistics to describe the independent variables and applied the chi-square inferential test of independence to assess the associations between the severity of diarrhea, the history of antibiotics use, and the occurrence of toxigenic C. difficile in the patient’s stool samples. The relationships between hospitalization, age of the patients, and length of diarrhea were examined using bivariate curve fitting models. In contrast, density contour mappings were used to determine these measures’ potential patterns (clusters) in the study population. All statistical tests were two-tailed, and ≤0.05 probability was the threshold for declaring statistical significance. Statistical analyses and data management were performed using SAS JMP Statistical DiscoveryTM Software version 16.2 (SAS Institute, Cary, NC, USA).

3. Results

Sixty-two stool samples were randomly collected from adults presenting with diarrhea, split equally between men and women with an average age of 29.7 years. The distribution of the patients based on age groups 18–24, 25–30, and >30 years were 35.5%, 32.3%, and 32.3%, respectively. Most of the patients (74.2%, n = 46) resided in rural areas (Table 1). Although 62.9% of the participant did not indicate their educational level, about 9.7% (n = 6) of them had secondary school education.
Of the 62 diarrhea patients, 48.4% (n = 30) tested positive for CDI. All putative CDI isolates were PCR positive for the tcdA and tcdC genes, and all isolates were positive for toxin production as determined by the ELISA assay. No isolates that tested PCR-negative showed toxin production as determined by the ELISA assay. Among the confirmed CDI patients, 53% were female and 47% were males. CDI was most prevalent (37%, n = 11) among adults who were above 31 years old and least prevalent (30%, n = 9) among those who were between 18 and 24 years old (Figure 1B).
Most (62.9%) of the adult patients did not know if they had used antibiotics in the last 14 days. Moreover, 67.7% (42/62) reported having no knowledge of antibiotics (Table 2), while 14.5% (9/62) reported metronidazole use in the last 14 days. Most of the patients (86.7%) reported moderate to severe cases of diarrhea to the hospital. However, 37.7% of the patients had been previously hospitalized due to diarrhea, whereas 62.3% were not hospitalized. There was no significant association between CDI occurrence, antibiotic use, age, or other potential risk factors tested, except diarrhea-related hospitalization (χ2 = 5.191, p = 0.0227) (Table 2).
The hospitalized patients were four times (aPR: 4.19, 95%; 1.18–14.88, p ˂0.05) more likely to have toxigenic C. difficile than those not hospitalized (Table 3). Figure 2 shows the bivariate relationship between the duration of diarrhea, length of hospitalization, and age of adult patients with positive CDI. A highly significant correlation was observed between diarrhea duration and hospitalization length (r = 0.98, p ˂ 0.001). With increased diarrhea duration, adult patients remained at the hospital longer (4.8 days) (Figure 2A). However, the age of the patients was not a significant predictor of the duration of diarrhea (Figure 2B) and length of hospitalization (Figure 2C). There was no significant correlation between the duration of hospitalization and age (r = −0.5934, p > 0.05) (Figure 2C).

4. Discussion

Most studies on CDI have focused on high-income countries, where C. difficile is the leading cause of antimicrobial-associated diarrhea [2]. In sub-Saharan Africa, which experiences a very high prevalence of diarrheal diseases and is the second leading cause of death on the continent [23], information on CDI is limited. Failure to test diarrhea patients’ stools or inappropriate testing may have resulted in CDI underreporting and underdiagnosis in the African continent [24]. In the northwestern part of Nigeria, where this study was conducted, no CDI study has been conducted previously in the adult population. Only a single CDI study has been reported in children in this region [15].
In this study, CDI prevalence was 48.4% among adult diarrhea patients. This was higher than the prevalence of 41% (31/76) observed among pediatric patients [15]. Also, a prevalence of 21.65% (21/97) was reported among HIV inpatients and outpatients with diarrhea at two hospitals from Jos and Abuja in Central Nigeria [14]. This suggests that the disease burden may be higher if a broader study is conducted in these locations.
A higher incidence of CDI among females (53%) compared to males (47%) observed in this study is similar to that of Nasereddin et al. [25] among adult hospitalized patients from Jordan, who also reported an incidence rate of 54% for females and males (46%). In many other studies on hospitalization, female adult patients are also predominantly affected by CDI compared to their male counterparts. Among the age groups, CDI increased in prevalence with the age of the patients. Older patients are disproportionately affected, reaching higher rates as age increases [26]. Esteban-Vasallo et al. [27] reported that trends by age and gender are not commonly assessed and that comparisons are not always possible due to differences in design and analyses. The immune system’s role is also vital because the immune system may be compromised as the patients grow older and become more predisposed to CDI [28]. Our previous studies on pediatric patients from these locations showed that CDI is also more prevalent among immunocompromised individuals, especially infants (˂2 years) and children (2–12 years) [15]. However, despite studies showing that one of the risk factors of CDI is old age (˃65 years) [Kullin et al., 2022] [2], high CDI prevalences were reported among patients of lower age groups in this study. This could be because Africa has a higher youthful population than Europe and the United States of America (UN, 2019) [3]. Although CDI is less studied in rural areas in Africa, it was noted to be prevalent among rural dwellers in this study. However, several factors, such as limited access to healthcare facilities and antibiotics, poor sanitation and hygiene, and weakened immune systems due to malnutrition, could contribute to the prevalence of CDI. Additionally, in some rural areas, reliance on traditional medicine rather than modern healthcare practices may also contribute to improper treatment of infections, potentially leading to complications like CDI.
From our study, none of the CDI risk factors had a significant relationship with prevalence. Nevertheless, there was a strong association between the length of hospitalization and the duration of diarrhea. Dionne et al. [29] reported that CDI was responsible for a longer duration of hospitalization among critically ill patients with a mechanical ventilator compared to those without CDI, but that CDI was not associated with increased mortality. To the best of our knowledge, this could be the first time an association between length of hospitalization and duration of diarrhea among CDI outpatients has been reported.
One of the limitations of our study is the small sample size of the participants. Although the sample size met adequate statistical power and threshold, the generalization of our findings should be restrained because of the non-random sampling technique applied in our study. Secondly, other diarrheal-causing microorganisms were not isolated or studied. This will be the subject of further research in this population by our research team. Finally, the survey was self-reporting. Therefore, some participants may have exhibited social desirability or recall biases in their responses. Nevertheless, we believe that the objective measurements in our study through the laboratory analyses allow for the reliability of our findings and the conclusions reached.

5. Conclusions

Due to the high prevalence of CDI observed in this study and the association between length of hospitalization and duration of diarrhea among the patients, it is pertinent that infection prevention and control measures be implemented at the hospitals to help prevent the spread of CDI. Healthcare providers should be encouraged to report cases of diarrhea and CDI to public health authorities to track trends and identify any potential outbreaks. In addition, public health campaigns to educate the communities about the importance of hygiene, safe water, and proper sanitation practices could help raise awareness and change behaviors.

Author Contributions

Conceptualization, A.T.A. and C.D.; methodology, A.T.A., C.D. and O.M.; formal analysis, A.T.A. and O.M.; investigation, A.T.A. and C.D.; resources, A.T.A., C.D. and O.M.; data curation, A.T.A., C.D. and O.M.; writing—original draft preparation, A.T.A.; writing—review and editing, A.T.A., C.D. and O.M.; project administration, A.T.A.; funding acquisition, A.T.A. and C.D. All authors have read and agreed to the published version of the manuscript.

Funding

This study was partly supported by NIH/NIAID grants R01AI116914 and R01AI150685 and R. Palmer Beasley, M.D., and Lu-Yu Hwang, M.D. Endowment funds.

Institutional Review Board Statement

The study was conducted in accordance with the Declaration of Helsinki and approved by the Institutional Review Board (or Ethics Committee) of Katsina State, Nigeria’s Ministry of Health, with approval no: MOH/ADM/SUB/1152/258.

Informed Consent Statement

Informed consent was obtained from all subjects involved in the study.

Data Availability Statement

Data are unavailable due to privacy or ethical restrictions.

Acknowledgments

The authors would like to thank Malam Mande General Hospital, Turai Yaradua Maternity and Children Hospital, and Government House Clinic management for facilitating the recruitment of patients for this study.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Kazakova, S.V.; Baggs, J.; McDonald, L.C.; Yi, S.H.; Hatfield, K.M.; Guh, A.; Reddy, S.C.; Jernigan, J.A. Association between antibiotic use and hospital-onset Clostridioides difficile infection in US acute care hospitals, 2006–2012: An ecologic analysis. Clin. Infect. Dis. 2020, 70, 11–18. [Google Scholar] [CrossRef] [PubMed]
  2. Kullin, B.; Abratt, V.R.; Reid, S.J.; Riley, T.V. Clostridioides difficile infection in Africa: A narrative review. Anaerobe 2022, 74, 102549. [Google Scholar] [CrossRef] [PubMed]
  3. United Nations, Department of Economic, Social Affairs, Population Division, World Population Prospects 2019, Volume 1, Comprehensive Tables. 2019. Available online: https://population.un.org/wpp/ (accessed on 20 February 2023).
  4. Pant, C.; Deshpande, A.; Altaf, M.A.; Minocha, A.; Sferra, T.J. Clostridium difficile infection in children: A comprehensive review. Curr. Med. Res. Opin. 2013, 29, 967–984. [Google Scholar] [CrossRef] [PubMed]
  5. Guery, B.; Galperine, T.; Barbut, F. Clostridioides difficile: Diagnosis and treatments. BMJ 2019, 366, 14609–14615. [Google Scholar] [CrossRef]
  6. European Centre for Disease Prevention and Control (ECDC). Clostridium difficile Infections—Facts and Surveillance; ECDC: Stockholm, Sweden, 2019; Available online: https://www.ecdc.europa.eu/en/clostridium-difficile-infections/facts (accessed on 18 March 2023).
  7. Freeman, J.; Bauer, M.P.; Baines, S.D.; Corver, J.; Fawley, W.N.; Goorhuis, B.; Kuijper, E.J.; Wilcox, M.H. The changing epidemiology of Clostridium difficile infections. Clin. Microbiol. Rev. 2010, 23, 529–549. [Google Scholar] [CrossRef]
  8. Cheng, J.W.; Xiao, M.; Kudinha, T. The role of glutamate dehydrogenase (GDH) testing assay in the diagnosis of Clostridium difficile infections: A high sensitive screening test and an essential step in the proposed laboratory diagnosis workflow for developing countries like China. PLoS ONE 2015, 10, e0144604. [Google Scholar] [CrossRef]
  9. Roldan, G.A.; Cui, A.X.; Pollock, N.R. Assessing the burden of Clostridium difficile infection in low-and middle-income countries. J. Clin. Microbiol. 2018, 56, 10–128. [Google Scholar] [CrossRef]
  10. World Health Organization (WHO). Diarrhoea: Why Children Are Still Dying and What Can Be Done; UNICEF/WHO Report; WHO: Geneva, Switzerland, 2009.
  11. UNICEF. The State of the World’s Children in 2013: Child Survival; Unicef: New York, NY, USA, 2013. [Google Scholar]
  12. Adesoji, A.T.; Liadi, A.M. Antibiogram studies of Escherichia coli and Salmonella species isolated from diarrheal patients attending Malam Mande General Hospital Dutsin-ma, Katsina State, Nigeria. Pan Afr. Med. J. 2020, 37, 110. [Google Scholar] [CrossRef]
  13. Nwike, I.E.; Ugwu, M.C.; Ejikeugwu, P.C.; Ujam, N.T.; Iroha, I.R.; Esimone, C.O. Phenotypic and molecular characterization of enteropathogenic Escherichia coli and Salmonella spp. causing childhood diarrhoea in Awka, South-Eastern Nigeria. Bull. Natl. Res. Cent. 2023, 47, 97. [Google Scholar] [CrossRef]
  14. Onwueme, K.; Fadairo, Y.; Idoko, L.; Onuh, J.; Alao, O.; Agaba, P.; Lawson, L.; Ukomadu, C.; Idoko, J. High prevalence of toxinogenic Clostridium difficile in Nigerian adult HIV patients. Trans. R. Soc. Trop. Med. Hyg. 2011, 105, 667–669. [Google Scholar] [CrossRef]
  15. Adesoji, A.T.; Mgbere, O.; Darkoh, C. Pediatric diarrhea patients living in urban areas have a higher incidence of Clostridioides difficile infection. PLoS Glob. Public Health 2023, 3, e0000477. [Google Scholar] [CrossRef] [PubMed]
  16. Kotloff, K.L.; Nataro, J.P.; Blackwelder, W.C.; Nasrin, D.; Farag, T.H.; Panchalingam, S.; Wu, Y.; Sow, S.O.; Sur, D.; Breiman, R.F.; et al. Burden and aetiology of diarrhoeal disease in infants and young children in developing countries (the Global Enteric Multicenter Study, GEMS): A prospective, case-control study. Lancet 2013, 382, 209–222. [Google Scholar] [CrossRef] [PubMed]
  17. Darkoh, C.; DuPont, H.L.; Kaplan, H.B. Novel one-step method for detection and isolation of active-toxin-producing Clostridium difficile strains directly from stool samples. J. Clin. Microbiol. 2011, 49, 4219–4224. [Google Scholar] [CrossRef] [PubMed]
  18. Oyaro, M.O.; Plants-Paris, K.; Bishoff, D.; Malonza, P.; Gontier, C.S.; DuPont, H.L.; Darkoh, C. High rate of Clostridium difficile among young adults presenting with diarrhea at two hospitals in Kenya. Int. J. Infect. Dis. 2018, 74, 24–28. [Google Scholar] [CrossRef]
  19. Lemee, L.; Dhalluin, A.; Testelin, S.; Mattrat, M.A.; Maillard, K.; Lemeland, J.F.; Pons, J.L. Multiplex PCR targeting tpi (triose phosphate isomerase), tcdA (Toxin A), and tcdB (Toxin B) genes for toxigenic culture of Clostridium difficile. J. Clin. Microbiol. 2004, 42, 5710–5714. [Google Scholar] [CrossRef]
  20. Murray, R.; Boyd, D.; Levett, P.N.; Mulvey, M.R.; Alfa, M.J. Truncation in the tcdC region of the Clostridium difficile PathLoc of clinical isolates does not predict increased biological activity of Toxin B or Toxin A. BMC Infect. Dis. 2009, 9, 103. [Google Scholar] [CrossRef]
  21. Fry, P.R.; Thakur, S.; Abley, M.; Gebreyes, W.A. Antimicrobial resistance, toxinotype, and genotypic profiling of Clostridium difficile isolates of swine origin. J. Clin. Microbiol. 2012, 50, 2366–2372. [Google Scholar] [CrossRef]
  22. Fiedoruk, K.; Daniluk, T.; Rozkiewicz, D.; Zeremba, M.L.; Oldak, E.; Sciepuk, M.; Leszczynska, K. Conventional and molecular methods in the diagnosis of community-acquired diarrhoea in children under 5 years of age from the north-eastern region of Poland. Int. J. Infect. Dis. 2015, 37, 145–151. [Google Scholar] [CrossRef]
  23. Global Health Estimates. Deaths by Cause, Age, Sex, by Country and by Region, 2000–2015; World Health Organization: Geneva, Switzerland, 2016.
  24. Effelsberg, N.; Buchholz, M.; Kampmeier, S.; Lucke, A.; Schwierzeck, V.; Angulo, F.J.; Brestrich, G.; Martin, C.; Moïsi, J.C.; von Eiff, C.; et al. Frequency of diarrhea, stool specimen collection and testing, and detection of Clostridioides difficile infection among hospitalized adults in the Muenster/Coesfeld area, Germany. Curr. Microbiol. 2023, 80, 37. [Google Scholar] [CrossRef]
  25. Nasereddin, L.M.; Bakri, F.G.; Shehabi, A.A. Clostridium difficile infections among Jordanian adult hospitalized patients. Am. J. Infect. Control 2009, 37, 864–866. [Google Scholar] [CrossRef]
  26. Soler, P.; Nogareda, F.; Cano, R. Rates of Clostridium difficile infection in patients discharged from Spanish hospitals, 1997–2005. Infect. Control Hosp. Epidemiol. 2008, 29, 886–889. [Google Scholar] [CrossRef] [PubMed]
  27. Esteban-Vasallo, M.D.; Naval Pellicer, S.; Domínguez-Berjón, M.F.; Cantero Caballero, M.; Asensio, Á.; Saravia, G.; Astray-Mochales, J. Age and gender differences in Clostridium difficile-related hospitalization trends in Madrid (Spain) over a 12-year period. Eur. J. Clin. Microbiol. Infect. Dis. 2016, 35, 1037–1044. [Google Scholar] [CrossRef] [PubMed]
  28. Raqib, R.; Mia, S.S.; Qadri, F.; Alam, T.I.; Alam, N.H.; Chowdhury, A.K.; Mathan, M.M.; Andersson, J. Innate immune responses in children and adults with Shigellosis. Infect. Immun. 2000, 68, 3620–3629. [Google Scholar] [CrossRef] [PubMed]
  29. Dionne, J.C.; Johnstone, J.; Heels-Ansdell, D.; Duan, E.; Lauzier, F.; Arabi, Y.M.; Adhikari, N.K.; Sligl, W.; Dodek, P.; Rochwerg, B.; et al. Clostridioides difficile infection in mechanically ventilated critically ill patients: A nested cohort study. J. Crit. Care 2023, 75, 154254. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Distribution of the presence of C. difficile in the stools of adult patients with diarrhea based on sex (A) and age group (B).
Figure 1. Distribution of the presence of C. difficile in the stools of adult patients with diarrhea based on sex (A) and age group (B).
Amh 69 00022 g001
Figure 2. Bivariate relationship between length of hospitalization (A) (Length of Hospitalization = −3.581 + 2.465 × Duration of diarrhea; r2 = 0.978; r = 0.98 (95%CI: 0.84–0.99, p = 0.0013 ***)), duration of diarrhea (B) (Duration of Diarrhea = 2.899 − 0.00061 × Age (Years). r2 = 0.0081; r = −0.0231 (95%CI: −0.3802–0.3400, p = 0.9036)), and age of patients (C) (Length of Hospitalization = 9.483 − 0.11487 × Age (Years). r2 = 0.2167; r = −0.5934 (95%CI: −0.9686–0.6063, p = 0.2915)) with CDI. The contour lines indicate regions with different densities. High-density areas are represented with a red color gradient, medium-density areas with a light green color gradient, and lower-density areas with a purple color gradient. Significance Level: *** = p < 0.001.
Figure 2. Bivariate relationship between length of hospitalization (A) (Length of Hospitalization = −3.581 + 2.465 × Duration of diarrhea; r2 = 0.978; r = 0.98 (95%CI: 0.84–0.99, p = 0.0013 ***)), duration of diarrhea (B) (Duration of Diarrhea = 2.899 − 0.00061 × Age (Years). r2 = 0.0081; r = −0.0231 (95%CI: −0.3802–0.3400, p = 0.9036)), and age of patients (C) (Length of Hospitalization = 9.483 − 0.11487 × Age (Years). r2 = 0.2167; r = −0.5934 (95%CI: −0.9686–0.6063, p = 0.2915)) with CDI. The contour lines indicate regions with different densities. High-density areas are represented with a red color gradient, medium-density areas with a light green color gradient, and lower-density areas with a purple color gradient. Significance Level: *** = p < 0.001.
Amh 69 00022 g002
Table 1. Demographic characteristics of adult patients with diarrhea.
Table 1. Demographic characteristics of adult patients with diarrhea.
Characteristicn%
Sex
Female3150.00
Male3150.00
Age Category (years)
18–242235.48
25–302032.26
31+2032.26
Mean ± SEM (29.71 ± 1.31)
Educational Status
No schooling812.90
Secondary education or below69.68
Above secondary education914.52
Unknown3962.90
Marital Status
Single3253.33
Married2846.67
Area of Residence
Urban1625.81
Rural4674.19
Note: Within characteristic, n or percentages may not add up to the total number of records or a 100 percent due to missing response and/or rounding.
Table 2. History of antibiotics use, presence of toxigenic C. difficile, and disease severity among adult patients with diarrhea.
Table 2. History of antibiotics use, presence of toxigenic C. difficile, and disease severity among adult patients with diarrhea.
MeasureN (%)CDI
PositiveNegative
n (%)n (%)
Knowledge of Antibiotics
No42 (67.74)19 (30.65)23 (37.10)
Yes20 (32.26)11 (17.74)9 (14.52)
Test Statistics: χ2 value, p-value 0.517, 0.4721 ns
Use Antibiotics in the last 14 days
No10 (16.13)4 (6.45)6 (9.68)
Yes13 (20.97)8 (12.90)5 (8.06)
Unknown39 (62.90)18 (29.03)21 (33.87)
Test Statistics: χ2 value, p-value 1.260, 0.5326 ns
Type of Antibiotic Used in the last 14 days
Metronidazole/Flaggy9 (14.52)4 (6.45)5 (8.06)
Other types of Antibiotics3 (4.84)3 (4.84)0 (0.00)
Unknown history of antibiotic use50 (80.65)23 (37.10)27 (43.55)
Test Statistics: χ2 value, p-value 3.370, 0.1854 ns
Antibiotics used in the Last 90 days (3 Months)
No45 (76.27)22 (37.29)23 (38.98)
Yes14 (23.73)8 (13.56)6 (10.17)
Test Statistics: χ2 value, p-value 0.291, 0.5895 ns
Last occurrence of diarrhea prior to clinic visit
Less than 14 days31 (52.54)17 (28.81)14 (23.73)
14 days or more6 (10.17)4 (6.78)2 (3.39)
Unknown22 (37.29)9 (15.25)13 (22.03)
Test Statistics: χ2 value, p-value 1.668, 0.4344 ns
Frequency of diarrhea occurrence
Every 7–14 days23 (63.89)15 (41.67)8 (22.22)
Every 15 days to 1 month13 (36.11)7 (19.44)6 (16.67)
Test Statistics: χ2 value, p-value 0.452, 0.5014 ns
Common Medication taken when diarrhea occurs.
Metronidazole17 (36.96)7 (15.22)10 (21.74)
Other antibiotics29 (63.04)16 (34.78)13 (28.26)
Test Statistics: χ2 value, p-value 0.840, 0.3595 ns
Severity of Diarrhea
Mild8 (13.335 (8.33)3 (5.00)
Moderate/Severe52 (86.67)25 (41.67)27 (45.00)
Test Statistics: χ2 value, p-value 0.577, 0.4475 ns
Hospitalization due to diarrhea
No23 (37.70)7 (11.48)16 (26.23)
Yes38 (62.30)23 (37.70)15 (24.59)
Test Statistics: χ2 value, p-value 5.191, 0.0227 *
Note: Within measure, percentages may not add up to 100 precisely due to rounding; “n” may not add up to the total number of cases due to missing responses. Significance Level: * = p < 0.05; ns = not significant (p > 0.05).
Table 3. Prevalence ratios of toxigenic C. difficile among adult patients with diarrhea.
Table 3. Prevalence ratios of toxigenic C. difficile among adult patients with diarrhea.
CharacteristicsUnadjustedAdjusted
uaPR95% CIaPR95% CI
Gender
Female (Ref)1.001.00
Male0.770.28–2.100.940.30–2.94
Age Group (years)
18–24 (Ref)1.001.00
25–301.440.42–4.900.970.21–4.50
31+1.770.52–6.001.370.21–9.11
Marital Status
Single (Ref)1.001.00
Married1.480.54–4.111.490.31–7.20
Residential Location
Urban (Ref)1.001.00
Rural1.530.48–4.811.590.40–6.24
Hospitalization
No (Ref)1.001.00
Yes3.50 *1.17–10.544.19 *1.18–14.88
Abbreviations: uaPR: Unadjusted Prevalence Ratio aPR: Adjusted Prevalence Ratio, 95% CI: 95% Confidence Interval, Ref: Referent. Significance Level: * = p < 0.05.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Adesoji, A.T.; Mgbere, O.; Darkoh, C. Association Between the Duration of Diarrhea and the Length of Hospitalization Among Clostridioides difficile Patients in Northern Nigeria. Acta Microbiol. Hell. 2024, 69, 236-244. https://doi.org/10.3390/amh69040022

AMA Style

Adesoji AT, Mgbere O, Darkoh C. Association Between the Duration of Diarrhea and the Length of Hospitalization Among Clostridioides difficile Patients in Northern Nigeria. Acta Microbiologica Hellenica. 2024; 69(4):236-244. https://doi.org/10.3390/amh69040022

Chicago/Turabian Style

Adesoji, Ayodele T., Osaro Mgbere, and Charles Darkoh. 2024. "Association Between the Duration of Diarrhea and the Length of Hospitalization Among Clostridioides difficile Patients in Northern Nigeria" Acta Microbiologica Hellenica 69, no. 4: 236-244. https://doi.org/10.3390/amh69040022

APA Style

Adesoji, A. T., Mgbere, O., & Darkoh, C. (2024). Association Between the Duration of Diarrhea and the Length of Hospitalization Among Clostridioides difficile Patients in Northern Nigeria. Acta Microbiologica Hellenica, 69(4), 236-244. https://doi.org/10.3390/amh69040022

Article Metrics

Back to TopTop