Barley Sources of Resistance to the Net Form of Net Blotch (Pyrenophora teres f. teres) †
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant Material
2.2. Field Experiment and Phenotypic Evaluation
2.3. Statistical Analysis
2.4. Genotyping and Data Filtering Process
2.5. Genome-Wide Association Studies (GWAS)
3. Results and Discussion
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Kumar, A.; Verma, R.P.S.; Singh, A.; Kumar Sharma, H.; Devi, G. Barley Landraces: Ecological Heritage for Edaphic Stress Adaptations and Sustainable Production. Environ. Sustain. Indic. 2020, 6, 100035. [Google Scholar] [CrossRef]
- Clare, S.J.; Wyatt, N.A.; Brueggeman, R.S.; Friesen, T.L. Research Advances in the Pyrenophora Teres–Barley Interaction. Mol. Plant Pathol. 2020, 21, 272–288. [Google Scholar] [CrossRef]
- Tini, F.; Covarelli, L.; Ricci, G.; Balducci, E.; Orfei, M.; Beccari, G. Management of Pyrenophora Teres f. Teres, the Causal Agent of Net Form Net Blotch of Barley, in A Two-Year Field Experiment in Central Italy. Pathogens 2022, 11, 291. [Google Scholar] [CrossRef] [PubMed]
- Alqudah, A.M.; Schnurbusch, T. Heading Date Is Not Flowering Time in Spring Barley. Front. Plant Sci. 2017, 8, 896. [Google Scholar] [CrossRef] [PubMed]
- Weise, S.; Lohwasser, U.; Oppermann, M. Document or Lose It—On the Importance of Information Management for Genetic Resources Conservation in Genebanks. Plants 2020, 9, 1050. [Google Scholar] [CrossRef] [PubMed]
- González, M.Y.; Philipp, N.; Schulthess, A.W.; Weise, S.; Zhao, Y.; Börner, A.; Oppermann, M.; Graner, A.; Reif, J.C. Unlocking Historical Phenotypic Data from an Ex Situ Collection to Enhance the Informed Utilization of Genetic Resources of Barley (Hordeum Sp.). Theor. Appl. Genet. 2018, 131, 2009–2019. [Google Scholar] [CrossRef]
- Amezrou, R.; Gyawali, S.; Belqadi, L.; Chao, S.; Arbaoui, M.; Mamidi, S.; Rehman, S.; Sreedasyam, A.; Verma, R.P.S. Molecular and Phenotypic Diversity of ICARDA Spring Barley (Hordeum vulgare L.) Collection. Genet. Resour. Crop Evol. 2018, 65, 255–269. [Google Scholar] [CrossRef]
- Czembor, J.H.; Czembor, E.; Suchecki, R.; Watson-haigh, N.S. Genome-Wide Association Study for Powdery Mildew and Rusts Adult Plant Resistance in European Spring Barley from Polish Gene Bank. Agronomy 2022, 12, 7. [Google Scholar] [CrossRef]
- Czembor, J.H. Genome-Wide Association Study of Agronomic Traits in European Spring Barley from Polish Gene Bank. Agronomy 2022, 12, 2135. [Google Scholar] [CrossRef]
- Alqudah, A.M.; Sallam, A.; Stephen Baenziger, P.; Börner, A. GWAS: Fast-Forwarding Gene Identification and Characterization in Temperate Cereals: Lessons from Barley—A Review. J. Adv. Res. 2020, 22, 119–135. [Google Scholar] [CrossRef]
- Singh, D.; Ziems, L.A.; Dracatos, P.M.; Pourkheirandish, M.; Tshewang, S.; Czembor, P.; German, S.; Fowler, R.A.; Snyman, L.; Platz, G.J.; et al. Genome-Wide Association Studies Provide Insights on Genetic Architecture of Resistance to Leaf Rust in a Worldwide Barley Collection. Mol. Breed. 2018, 38, 43. [Google Scholar] [CrossRef]
- Monteagudo, A.; Casas, A.M.; Cantalapiedra, C.P.; Contreras-Moreira, B.; Gracia, M.P.; Igartua, E. Harnessing Novel Diversity from Landraces to Improve an Elite Barley Variety. Front. Plant Sci. 2019, 10, 434. [Google Scholar] [CrossRef]
- Marone, D.; Russo, M.A.; Mores, A.; Ficco, D.B.M.; Laidò, G.; Mastrangelo, A.M.; Borrelli, G.M. Importance of Landraces in Cereal Breeding for Stress Tolerance. Plants 2021, 10, 1267. [Google Scholar] [CrossRef] [PubMed]
- Riaz, A.; Kanwal, F.; Börner, A.; Pillen, K.; Dai, F.; Alqudah, A.M. Advances in Genomics-Based Breeding of Barley: Molecular Tools and Genomic Databases. Agronomy 2021, 11, 894. [Google Scholar] [CrossRef]
- Friesen, T.L.; Faris, J.D.; Lai, Z.; Steffenson, B.J. Identification and Chromosomal Location of Major Genes for Resistance to Pyrenophora Teres in a Doubled-Haploid Barley Population. Genome 2006, 49, 855–859. [Google Scholar] [CrossRef] [PubMed]
- Grewal, T.S.; Rossnagel, B.G.; Scoles, G.J. Mapping of Quantitative Trait Loci Associated with Resistance to Net Blotch [Pyreuophora Teres] in Barley. Can. J. Plant Pathol. Can. Phytopathol. 2007, 29, 219. [Google Scholar]
- Grewal, T.S.; Rossnagel, B.G.; Pozniak, C.J.; Scoles, G.J. Mapping Quantitative Trait Loci Associated with Barley Net Blotch Resistance. Theor. Appl. Genet. 2008, 116, 529–539. [Google Scholar] [CrossRef]
- Pierre, S.S.; Gustus, C.; Steffenson, B.; Dill-Macky, R.; Smith, K.P. Mapping Net Form Net Blotch and Septoria Speckled Leaf Blotch Resistance Loci in Barley. Phytopathology 2010, 100, 80–84. [Google Scholar] [CrossRef] [PubMed]
- Ma, Z.; Lapitan, N.L.V.; Steffenson, B. QTL Mapping of Net Blotch Resistance Genes in a Doubled-Haploid Population of Six-Rowed Barley. Euphytica 2004, 137, 291–296. [Google Scholar] [CrossRef]
- Rozanova, I.V.; Lashina, N.M.; Mustafin, Z.S.; Gorobets, S.A.; Efimov, V.M.; Afanasenko, O.S.; Khlestkina, E.K. SNPs Associated with Barley Resistance to Isolates of Pyrenophora Teres f. Teres. BMC Genom. 2019, 20, 292. [Google Scholar] [CrossRef]
- Adhikari, A.; Smith, M.J.; Dill-Macky, R. Association Mapping for Net Blotch Resistance in Barley and a Study of Barley/Cereal Yellow Dwarf Virus in Minnesota. Ph.D. Thesis, University of Minnesota, Minneapolis, MN, USA, 2017. [Google Scholar]
- Amezrou, R.; Verma, R.P.S.; Chao, S.; Brueggeman, R.S.; Belqadi, L.; Arbaoui, M.; Rehman, S.; Gyawali, S. Genome-Wide Association Studies of Net Form of Net Blotch Resistance at Seedling and Adult Plant Stages in Spring Barley Collection. Mol. Breed. 2018, 38, 58. [Google Scholar] [CrossRef]
- Adhikari, A.; Steffenson, B.J.; Smith, M.J.; Dill-Macky, R. Genome-Wide Association Mapping of Seedling Net Form Net Blotch Resistance in an Ethiopian and Eritrean Barley Collection. Crop Sci. 2019, 59, 1625–1638. [Google Scholar] [CrossRef]
- Daba, S.D.; Horsley, R.; Brueggeman, R.; Chao, S.; Mohammadi, M. Genome-Wide Association Studies and Candidate Gene Identification for Leaf Scald and Net Blotch in Barley (Hordeum vulgare L.). Plant Dis. 2019, 103, 880–889. [Google Scholar] [CrossRef] [PubMed]
- Adhikari, A.; Steffenson, B.J.; Smith, K.P.; Smith, M.; Dill-Macky, R. Identification of Quantitative Trait Loci for Net Form Net Blotch Resistance in Contemporary Barley Breeding Germplasm from the USA Using Genome-Wide Association Mapping. Theor. Appl. Genet. 2020, 133, 1019–1037. [Google Scholar] [CrossRef] [PubMed]
- Mascher, M.; Gundlach, H.; Himmelbach, A.; Beier, S.; Twardziok, S.O.; Wicker, T.; Radchuk, V.; Dockter, C.; Hedley, P.E.; Russell, J.; et al. A Chromosome Conformation Capture Ordered Sequence of the Barley Genome. Nature 2017, 544, 427–433. [Google Scholar] [CrossRef] [PubMed]
- Paradis, E. Pegas: An R Package for Population Genetics with an Integrated-Modular Approach. Bioinformatics 2010, 26, 419–420. [Google Scholar] [CrossRef] [PubMed]
- Huang, M.; Liu, X.; Zhou, Y.; Summers, R.M.; Zhang, Z. BLINK: A Package for the next Level of Genome-Wide Association Studies with Both Individuals and Markers in the Millions. Gigascience 2018, 8, giy154. [Google Scholar] [CrossRef]
- Gruber, B.; Unmack, P.J.; Berry, O.F.; Georges, A. Dartr: An r Package to Facilitate Analysis of SNP Data Generated from Reduced Representation Genome Sequencing. Mol. Ecol. Resour. 2018, 18, 691–699. [Google Scholar] [CrossRef]
- Richards, J.K.; Friesen, T.L.; Brueggeman, R.S. Association Mapping Utilizing Diverse Barley Lines Reveals Net Form Net Blotch Seedling Resistance/Susceptibility Loci. Theor. Appl. Genet. 2017, 130, 915–927. [Google Scholar] [CrossRef]
- Wonneberger, R.; Ficke, A.; Lillemo, M. Identification of Quantitative Trait Loci Associated with Resistance to Net Form Net Blotch in a Collection of Nordic Barley Germplasm. Theor. Appl. Genet. 2017, 130, 2025–2043. [Google Scholar] [CrossRef]


| Chromo-Some | SNP Position | SNP ID | Adj p-Value | Ref | Alt | Flanking Sequence |
|---|---|---|---|---|---|---|
| 1H | 555 850 679 | 3665728-48-G/C | 0.0039 | G | C | TGCAGCTCCAGCAAACGCAGGCGCCGCTCATGCCAAGCAGGTTCATGT[G>C]CTCCCGCCAGCTCTCCGAGA |
| 1H | 525 028 066 | 4185419-21-T/G | 0.0039 | T | G | TGCAGCACTGGCCGTGCTAGT[T>G]CATAGTACACACACCACAACAAGCGCTGCTGCGGGGGGGAGCACCAC |
| 3H | 10 806 146 | 3922813-26-C/T | 0.0000 | C | T | TGCAGAGCTTGCAGGTAGCAGCGCAG[C>T]TGTCGACCACGTCCTCGCAGGTGCACGCCG |
| 3H | 644 804 966 | 3666438-26-G/A | 0.0039 | G | A | TGCAGGTGCAGCCACGAGAGCTGGCC[G>A]CTAACGAGGAGTCGTCGTTCAGGCCCGTGCCTCCG |
| 5H | 503 899 956 | 3665444-43-T/G | 0.0039 | T | G | TGCAGCTGTTTGCCAAGTTGGACGGAGATGTCCCTGTTTTAGT[T>G]GTGTCGACGCTGAATTCCCCCAAGA |
| 5H | 17 105 715 | 3255282-16-G/A | 0.0109 | G | A | TGCAGGGAGATTACTG[G>A]TTTCAGTCTGCCTTAAATCCAGAGTCTCCAGATAGCGCAATCCCCTGATTTC |
| 6H | 388 486 233 | 3432352-13-G/T | 0.0000 | G | T | TGCAGCATTCCTT[G>T]TACTGATACAGTGATGACATGACGGTTGGGCCG |
| 6H | 210 765 795 | 4414028-24-G/C | 0.0039 | G | C | TGCAGCTTGAGCTCGTTGTCCATG[G>C]CCTTGAATGCATTGGTGCAGGCCTCCGTCCACTCCTCCAGCATC |
| 7H | 207 567 692 | 7223598-17-C/G | 0.0000 | C | G | TGCAGCTCTTCATCTGG[C>G]AGACGTAGCTGCGCCG |
| Un | 103 707 884 | 6272935-22-T/C | 0.0041 | T | C | TGCAGTAGTTTCTTCTCTCTTT[T>C]TAGTGTATTTTCTACTGCTAGAACCG |
| Chromo-Some | SNP Position | SNP ID | Adj p-Value | Ref | Alt | Flanking Sequence |
|---|---|---|---|---|---|---|
| 1H | 198 280 215 | 6272702-14-A/C | 0.0096 | A | C | TGCAGCGGGGCGCT[A>C]GCAGCTGTTTCATGGGCCG |
| 2H | 112 361 626 | 4184432-64-C/A | 0.0000 | C | A | TGCAGAGGTTGCGGGTAGGTCATCAGTACCTTGGCCTTGGGGATGACCTTGACGGCGACGGCGT[C>A]CCCC |
| 2H | 729 416 254 | 6281659-7-T/G | 0.0096 | T | G | TGCAGGG[T>G]CGTACACAGCCAGCGTCCGCTTGGAGCCTGCGTGGCGCGGCGCCGTCGTAGGAAGGATGGT |
| 5H | 511 856 641 | 3665720-51-G/A | 0.0001 | G | A | TGCAGGCCAAGAAACGGCGAATTCAGTCCCCTGCCGGCGCCGCCGAAGAGG[G>A]AAAACAGAGCACTGCAC |
| 6H | 574 992 201 | 7243457-40-T/C | 0.0000 | T | C | TGCAGGTCGGCGAGCAGGGCCTGGACCGCGGCGGCGTCGG[T>C]GGCCCG |
| 7H | 6 256 505 | 3913074-18-G/C | 0.0000 | G | C | TGCAGAATCAGAGAATTT[G>C]ATGGGAGCAAAGCAAACCG |
| 7H | 143 890 318 | 3919123-42-C/G | 0.0096 | G | C | TGCAGGAGTCAGCATACGTGATGGCTGCATACTATCGCTTCG[C>C]TCTCGTCATCGGTCTTTAGGGGGAAA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Czembor, J.H.; Czembor, E. Barley Sources of Resistance to the Net Form of Net Blotch (Pyrenophora teres f. teres). Biol. Life Sci. Forum 2023, 27, 9. https://doi.org/10.3390/IECAG2023-15517
Czembor JH, Czembor E. Barley Sources of Resistance to the Net Form of Net Blotch (Pyrenophora teres f. teres). Biology and Life Sciences Forum. 2023; 27(1):9. https://doi.org/10.3390/IECAG2023-15517
Chicago/Turabian StyleCzembor, Jerzy H., and Elzbieta Czembor. 2023. "Barley Sources of Resistance to the Net Form of Net Blotch (Pyrenophora teres f. teres)" Biology and Life Sciences Forum 27, no. 1: 9. https://doi.org/10.3390/IECAG2023-15517
APA StyleCzembor, J. H., & Czembor, E. (2023). Barley Sources of Resistance to the Net Form of Net Blotch (Pyrenophora teres f. teres). Biology and Life Sciences Forum, 27(1), 9. https://doi.org/10.3390/IECAG2023-15517
