Methylation Profile of DAPK-1 Between Oral Potentially Malignant Disorders and Oral Squamous Cell Carcinoma

Abstract

Background/Objectives: DAPK-1 plays a crucial role among molecules that may be affected by DNA hypermethylation. The aim of this study is to investigate the DNA methylation of DAPK-1 gene in oral potentially malignant disorders (OPMDs) and oral squamous cell carcinoma (OSCC) compared to normal oral epithelium and to evaluate the possible role of methylated DAPK-1 as an indicator of the early onset of malignant transformation of oral potentially malignant disorders. Methods: The paraffin embedded tissue samples were retrieved from the archives of the Department of Oral Medicine/Pathology, School of Dentistry, Aristotle University of Thessaloniki, Greece and St Lukas Hospital of Thessaloniki, Greece during the period of 2014–2019. The tissue samples included 83 OPMDs samples, 39 OSCC samples and 12 samples of normal oral epithelium. The PCR process followed, targeting four different DAPK-1 gene primers. Results: Regarding OSCC, it was found that all 39 OSCCs samples were methylated in DAPK-1 promoter region, whereas only 2 out of 12 normal tissues samples showed DAPK-1 promoter hypermethylation (p < 0.001 Fisher’s exact test). A total of 17 out of 83 OPMDs were DAPK-1 methylated (five erosive oral lichen planus samples, three non-dysplastic oral leukoplakias, eight mildly dysplastic oral leukoplakias and one sample belonging to the group of moderately and severely dysplastic oral leukoplakia). Conclusions: Since epigenetic changes occur early in carcinogenesis and are potentially reversible, they could be used as disease biomarkers for diagnosis, prognosis and prediction, as well as therapeutic targets. DAPK-1 methylation is mostly present in the early stages of dysplasia as well as in all cases of oral cancer.

1. Introduction

Oral squamous cell carcinoma (OSCC) is among the most frequent cancers worldwide. OSCC represents a major public health problem because of its relatively high mortality rates. Despite the many advances in the field of prevention and management of the disease, the 5-year survival rate of OSCC patients remains as low as 50% [1,2,3,4]. OSCC may arise de novo or as a natural progression of Oral Potential Malignant Disorders (OPMDs) [5].

OPMDs are defined as “any oral mucosal abnormality that is associated with a statistically increased risk of developing oral cancer” [5]. Among the various types of disorders that are included within the term of OPMDs, the most common is Oral Leukoplakia (OL). Besides OL, Oral Lichen Planus (OLP) and especially its erosive and atrophic form claims its place among the OPMDS presenting a certain potential for malignant transformation [6]. Smoking, alcohol consumption, the localization of the lesions (tongue lesions are the most prone to malignancy), chronic inflammation, HPV infection, as well as genetic and epigenetic changes seem to play a critical role in the process of malignant transformation [2,3,7].

Our study focuses on the potential role of epigenetics in oral carcinogenesis. Epigenetics encompass modifications in gene expression without alterations of the DNA sequences [8,9]. They are more frequent than gene mutations and are potentially reversible. They may persist in the entire cell circle or even be inherited to the next generations [8,9]. There are three types of epigenetic changes: DNA hypermethylation, histone modifications and altered expressions of micro RNAs [10]. DNA hypermethylation is the most common of all epigenetics and refers to the covalent transfer of a methyl group to the C-5 position of the cytosine ring of DNA [11]. This is mediated by a group of enzymes, called DNA methyltransferases [12]. DNA methylation plays an important role in normal cell processes such as genomic imprinting and X-chromosome inactivation. But when it is dysregulated, it can lead to diseases including cancer [13]. In many types of human cancer, there is hypermethylation of CpG islands that are localized at the promoter region of tumor suppressor genes. This epigenetic mechanism may lead to the transcriptional silencing of those genes, and it may play a key role in the initiation and progression of OSCC [10,14,15,16].

Among molecules that may be affected by DNA hypermethylation, DAPK-1 plays a crucial role. DAPK-1 (death associated protein kinase 1) is a serine /threonine kinase located in human chromosome 9 [17]. DAPK-1 participates in processes such as apoptosis or autophagy in response to endoplasmic reticulum stress [18]. DAPK-1 plays a crucial role both in inflammatory and anti-inflammatory processes by producing IL-1b. At the same time, it downregulates inflammation in pathologies such as ulcerative colitis [19]. Among others, the most important function of DAPK-1 is its tumor suppressing ability to inhibit many types of cancer including OSCC. Mutations in DAPK-1 are very rare. The mutation N1347S constitutes an exception, which leads to apoptosis inhibition [20]. On the contrary DAPK-1 is often silenced by hypermethylation of its promoter which is detected very often in OSCC [21].

The aim of this study is to investigate the DNA methylation of DAPK-1 gene in OLP, OL and OSCC compared to normal oral epithelium, in order to evaluate the possible role of methylated DAPK-1 as an indicator of the early onset of malignant transformation of OPMDs and the relation between methylation and the degree of OSCC differentiation.

2. Materials and Methods

The paraffin embedded tissue samples were retrieved from the archives of the Department of Oral Medicine/Pathology, School of Dentistry, Aristotle University of Thessaloniki, Greece and St Lukas Hospital of Thessaloniki, Greece during the period of 2014–2019. The experiment took place in the Laboratory of Molecular Biology of Bioiatriki S.A. The study was conducted in accordance with the Research and Ethics Committee guidelines of Aristotle University, School of Dentistry, and the Helsinki II declaration. Approval for the present study was granted by the Ethics Committee of the School of Dentistry, Aristotle University of Thessaloniki, Greece, during its meeting on 21 November 2018, under protocol number 29/21 November 2018.

The tissue samples included the following:

21 OLP samples (subdivided in 11 reticular OLP and 10 erosive OLP samples), 62 OL samples (subdivided in 21 samples of non-dysplastic OL, 22 samples of mildly dysplastic OL and 19 samples of moderately or severely dysplastic OL), 39 OSCC samples, (subdivided in 5 samples of well differentiated, 32 samples of moderately differentiated and 2 samples of poorly differentiated), as well as 12 samples of normal oral epithelium.

2.1. DNA Extraction

DNA was obtained from paraffin embedded tissue slides of 5 μm, using the FFPE Tissue LEV DNA purification kit (Promega, Madison, WI, USA), starting with an overnight pretreatment with 20 μL Proteinase K and 180 μL deparaffinization buffer at 70 °C and 1000 rpm thermomixer (Eppendorf, Hamburg, Germany) according to the manufacturer’s instructions. The extraction procedure is completed the next day by adding 400 μL Lysis buffer (Promega, Madison, WI, USA) and placing the mixture into the Maxwell 16LEV cartridge rack for the automated extraction process by Maxwell 16 Extraction Instrument (Promega, Madison, WI, USA).

2.2. Bisulfide Treatment

A total of 200–500 ng extracted genomic DNA treated by CT Conversio Reagent according to the manufacturer’s protocol instructions of EZ DNA Methylation Gold kit (ZymoResearch, Orange, CA, USA), in a thermocycler C1000 (Biorad, Hercules, CA, USA) setting an incubation program of 98 °C/10 min, 64 °C/2.5 h, 4 °C/20 h. After the end of the incubation, the bisulfide treated DNA uploaded in a Zymo Spin IC filter centrifuge column were desalted for two rounds using the M wash buffer of EZ DNA Methylation Gold kit (ZymoResearch, Orange, CA, USA). The bisulfide modified genomic DNA was resuspended in 100 μL water and stored in −80 °C.

2.3. Methylation Specific PCR

The bisulfide treated genomic DNA was used as template for the methylation specific PCR of DAPK genes. Two pairs of primers for each gene were designed (used), one pair for modified and methylated and the other pair for modified and unmethylated. The primer sets are listed in the following table (

Table 1. The gene primers, primer sequences and PCR products by size are displayed.

Gene Primers	Primer Sequence	PCR Product by Size
DAPK-1 Uf	GGAGGATAGTTGGATTGAGTTAATGTT	108 bp
DAPK-1 Ur	CAAATCCCTCCCAAACACCAA
DAPK-1 Mf	GGATAGTCGGATCGAGTTAACGTC	98 bp
DAPK-1 Mr	CCCTCCCAAACGCCG

Statistical analysis was performed through the SPSS 2017. The frequencies of DAPK-1 methylation in OL, OLP, OSCC and normal were evaluated comparatively using Pearson’s chi-square test or Fisher’s exact test depending on the sample size. The level of statistical significance was set at p-value < 0.05.

).

2.4. Electrophoresis

The electrophoresis process was carried out in the genetic analyzer ABI 3500 (Thermo Fisher Scientific, Waltham, MA, USA) and the STR (short tandem repeat) analysis was performed by the program Gene Mapper 5.0/Fragment analysis. The PCR products were labeled with the FAM staining (blue color).

3. Results

The localization of the samples as well as the gender and age of the patients from whom they derived are summarized in

Table 2. Epidemiological characteristics of the samples.

Samples	Localization	Gender	Age
Reticular OLP	Tongue	Male	77
Reticular OLP	Tongue	Male	57
Reticular OLP	Tongue	Female	21
Reticular OLP	Tongue	Female	50
Reticular OLP	Tongue	Female	57
Reticular OLP	Tongue	Male	57
Reticular OLP	Buccal mucosa	Female	72
Reticular OLP	Tongue	Female	38
Reticular OLP	Buccal mucosa	Male	73
Reticular OLP	Buccal mucosa	Female	48
Reticular OLP	Buccal mucosa	Female	42
Erosive OLP	Gingiva	Female	77
Erosive OLP	Buccal mucosa	Female	48
Erosive OLP	Buccal mucosa	Female	77
Erosive OLP	Tongue	Female	59
Erosive OLP	Buccal mucosa	Female	54
Erosive OLP	Palate	Female	55
Erosive OLP	Buccal mucosa	Female	49
Erosive OLP	Buccal mucosa	Female	68
Erosive OLP	Buccal mucosa	Female	48
Erosive OLP	Buccal mucosa	Female	42
Non-Dysplastic OL	Tongue	Female	71
Non-Dysplastic OL	Tongue	Female	45
Non-Dysplastic OL	Tongue	Male	67
Non-Dysplastic OL	Tongue	Male	51
Non-Dysplastic OL	Gingiva	Female	63
Non-Dysplastic OL	Buccal mucosa	Female	60
Non-Dysplastic OL	Tongue	Female	68
Non-Dysplastic OL	Tongue	Female	22
Non-Dysplastic OL	Palate	Female	77
Non-Dysplastic OL	Tongue	Male	69
Non-Dysplastic OL	Tongue	Female	68
Non-Dysplastic OL	Tongue	Female	71
Non-Dysplastic OL	Tongue	Male	53
Non-Dysplastic OL	Tongue	Male	48
Non-Dysplastic OL	Buccal mucosa	Male	59
Non-Dysplastic OL	Buccal mucosa	Female	58
Non-Dysplastic OL	Buccal mucosa	Female	55
Non-Dysplastic OL	Buccal mucosa	Female	61
Non-Dysplastic OL	Tongue	Female	56
Non-Dysplastic OL	Palate	Male	39
Non-Dysplastic OL	Tongue	Female	81
Mildly Dysplastic OL	Buccal mucosa	Female	44
Mildly Dysplastic OL	Tongue	Male	24
Mildly Dysplastic OL	Tongue	Male	56
Mildly Dysplastic OL	Tongue	Female	61
Mildly Dysplastic OL	Tongue	Female	33
Mildly Dysplastic OL	Tongue	Male	37
Mildly Dysplastic OL	Tongue	Male	74
Mildly Dysplastic OL	Tongue	Male	34
Mildly Dysplastic OL	Buccal mucosa	Female	51
Mildly Dysplastic OL	Buccal mucosa	Male	53
Mildly Dysplastic OL	Gingiva	Male	69
Mildly Dysplastic OL	Tongue	Male	62
Mildly Dysplastic OL	Mouth Floor	Female	38
Mildly Dysplastic OL	Tongue	Female	52
Mildly Dysplastic OL	Tongue	Female	72
Mildly Dysplastic OL	Lips	Female	38
Mildly Dysplastic OL	Buccal mucosa	Female	70
Mildly Dysplastic OL	Tongue	Male	46
Mildly Dysplastic OL	Tongue	Male	24
Mildly Dysplastic OL	Gingiva	Female	12
Mildly Dysplastic OL	Lips	Female	59
Mildly Dysplastic OL	Buccal mucosa	Female	70
Moderately and Severely Dysplastic OL	Tongue	Female	67
Moderately and Severely Dysplastic OL	Tongue	Female	52
Moderately and Severely Dysplastic OL	Tongue	Female	60
Moderately and Severely Dysplastic OL	Tongue	Male	58
Moderately and Severely Dysplastic OL	Tongue	Female	67
Moderately and Severely Dysplastic OL	Tongue	Female	62
Moderately and Severely Dysplastic OL	Buccal mucosa	Male	67
Moderately and Severely Dysplastic OL	Gingivobuccal area	Female	60
Moderately and Severely Dysplastic OL	Tongue	Male	43
Moderately and Severely Dysplastic OL	Gingivobuccal area	Female	60
Moderately and Severely Dysplastic OL	Tongue	Male	50
Moderately and Severely Dysplastic OL	Gingivobuccal area	Female	59
Moderately and Severely Dysplastic OL	Tongue	Male	75
Moderately and Severely Dysplastic OL	Tongue	Male	71
Moderately and Severely Dysplastic OL	Tongue	Female	57
Moderately and Severely Dysplastic OL	Tongue	Female	85
Moderately and Severely Dysplastic OL	Tongue	Male	45
Moderately and Severely Dysplastic OL	Palate	Male	72
Moderately and Severely Dysplastic OL	Tongue	Female	65
Well differentiated OSCC	Tongue	Female	56
Well differentiated OSCC	Buccogingival sulcus	Female	79
Well differentiated OSCC	Tongue	Male	69
Well differentiated OSCC	Tongue	Male	68
Well differentiated OSCC	Alveolar ridge	Female	72
Moderately differentiated OSCC	Alveolar ridge	Male	83
Moderately differentiated OSCC	Tongue	Female	44
Moderately differentiated OSCC	Tongue	Female	43
Moderately differentiated OSCC	Tongue	Female	73
Moderately differentiated OSCC	Tongue	Female	57
Moderately differentiated OSCC	Tongue	Female	60
Moderately differentiated OSCC	Tongue	Male	38
Moderately differentiated OSCC	Tongue	Female	45
Moderately differentiated OSCC	Tongue	Male	56
Moderately differentiated OSCC	Buccal mucosa	Male	50
Moderately differentiated OSCC	Tongue	Female	43
Moderately differentiated OSCC	Tongue	Male	72
Moderately differentiated OSCC	Gingiva	Male	57
Moderately differentiated OSCC	Tongue	Male	39
Moderately differentiated OSCC	Buccal mucosa	Male	60
Moderately differentiated OSCC	Tongue	Female	41
Moderately differentiated OSCC	Retromolar triangle	Male	32
Moderately differentiated OSCC	Tongue	Male	51
Moderately differentiated OSCC	Buccal mucosa	Male	62
Moderately differentiated OSCC	Alveolar ridge	Female	56
Moderately differentiated OSCC	Gingiva	Female	78
Moderately differentiated OSCC	Alveolar ridge	Female	85
Moderately differentiated OSCC	Alveolar ridge	Female	59
Moderately differentiated OSCC	Tongue	Female	85
Moderately differentiated OSCC	Tongue	Female	67
Moderately differentiated OSCC	Alveolar ridge	Female	75
Moderately differentiated OSCC	Tongue	Female	65
Moderately differentiated OSCC	Tongue	Female	79
Moderately differentiated OSCC	Lips	Female	77
Moderately differentiated OSCC	Mouth floor	Male	46
Moderately differentiated OSCC	Alveolar ridge	Male	72
Moderately differentiated OSCC	Tongue	Female	42
Poorly differentiated OSCC	Alveolar ridge	Male	57
Poorly differentiated OSCC	Alveolar ridge	Male	80

.

Out of the 21 OLP samples, 4 were observed in men (19.04%) and the remaining 17 (80.96%) in women. The mean age of the patients was 55.6 years with an age range of 56 (21–77) years and a variance of 14.94 years. The average age of the men was 69 years with a range of 20 years (57–77), and a variance of 10.58 years, while women had a mean age of 53.23, with a range of 56 (21–77), and a variance of 14.54 years, respectively.

Out of the 62 OL samples, 26 (41.27%) were identified in men and the remaining 37 (58.73%) in women. The mean age of the patients was 56.38 years with an age range of 73 (12–85) years and a variance of 14.98 years. The mean age of the men was 53.92 years with a range of 51 (24–75) years and a variance of 14.69 years. Accordingly, the average age of the women was 58.10 years with an age range of 73 (12–85) years and a variation of 15.15 years.

Out of the 39 OSCC samples, 17 (43.59%) were identified in men and the remaining 22 (56.41%) in women. The mean age of the patients was 60.84 years with an age range of 53 (32–85) years and a variance of 14.90 years. The mean age of the men was 58.35 years with a range of 51 (32–83) years and a variance of 14.66 years. Accordingly, the average age of women was 62.77 years with an age range of 44 (41–85) years and a variance of 15.14 years.

The DNA hypermethylation pattern of the promoter region of DAPK-1 gene was detected by PCR of bisulfite-treated DNA using methylation-specific and unmethylation-specific primers in 21 samples of OLP (11 of reticular and 10 of erosive form), 62 specimens of OL of various degrees of dysplasia (no dysplasia (21 samples), mild (22 samples) and moderated/severe dysplasia (19 samples)), 39 samples of OSCCs of all degrees of differentiation, and 12 samples of normal oral tissues. DAPK-1 methylation was observed in 60 out of 134 patients (29 of them were women and 31 men).

An image of the electrophoresis process follows (Figure 1).

As far as it concerns the association of the methylation with the demographic characteristics (age, gender and topography of the lesions) of the 134 patients studied there was no statistical significance that could relate the presence of methylation with the gender or the age of the patients. In total, DAPK-1 methylation was more common in lesions located in the tongue, alveolar ridge and buccal mucosa (8/56) (

Table 3. Correlation of DAPK-1 methylation and lesion localization.

Lesion Localization		Tongue	Floor of the Mouth	Retr.Triangle	Gingiva	Buccogingival Sulcus	Buccal Mucosa	Palate	Alveolar Ridge	Lips	Total
DAPK-1(+) METHYLATION	OLP reticular	0	0	0	0	0	0	0	0	0	0
	OLP erosive	1	0	0	1	0	2	1	0	0	5
	Non dysplastic OL	2	0	0	0	0	1	0	0	0	3
	Mildly dysplastic OL	2	1	0	2	0	2	0	0	1	8
	Moderately/severely dysplastic OL	1	0	0	0	0	0	0	0	0	1
	OSCC	21	1	1	2	1	3	0	9	1	39
	Total	27	2	1	5	1	8	1	9	2	56

).

The methylation was present in the 16.66% (2/12) of the normal tissue samples, in no case (0/11) of OLP of the reticular form and in half the cases of OLP of the erosive form (5/10). In OLs it was observed that in the lesions without dysplasia, with mild and with moderate and severe dysplasia, the corresponding percentages reached up to 14.28% (3/21), 36.36% (8/22) and 5.26% (1/19), respectively. It is noteworthy that DAPK-1 was hypermethylated in the whole sum of OSCC lesions DAPK-1 (39/39) (

Table 4. Presence of DAPK-1 methylation in the various lesions.

		DAPK-1	Methylation	Total
		-	+
Diagnosis	Normal	10	2	12
	OLP reticular	11	0	11
	OLP erosive	5	5	10
	OL no dysplasia	18	3	21
	OL mild dysplasia	14	8	22
	OL moderate/severe dysplasia	18	1	19
	OSCC	0	39	39
Total		76	58	134

) (Figure 2)

Regarding OSCC, it was found that all 39 OSCCs samples (100%) were methylated in DAPK-1 promoter region, whereas only 2 out of 12 normal tissues samples (17%) showed DAPK-1 promoter hypermethylation and there was a significant statistical difference (p < 0.001 Fisher’s exact test). Regarding Ols, it was noticed that 12 out of 62 OL samples (19%) were DAPK-1 methylated with a significant statistical difference between OSCC (39/100%) and OLs (p < 0.001 Chi-square test). Moreover, DAPK-1 promoter hypermethylation was observed in 1 out of 19 OL samples with moderated and severe dysplasia and there was a statistically significant difference in OL with mild dysplasia (increased in mild) (p = 0.026 Fisher’s exact test). Comparing DAPK-1 methylation in OSCC and OLs with various degrees of dysplasia, it was observed that there was a statistical significance between OSCC (increased), and OL with no dysplasia (p < 0.001 Fisher’s exact test), OL with mild dysplasia (p < 0.001 Fisher’s exact test) and OL with moderated/severe dysplasia (p < 0.001 Chi-square test).

No other statistically significant difference was confirmed between normal oral epithelium and OLs with no dysplasia (p > 0.999 Fisher’s exact test), with mild dysplasia (p = 0.432 Fisher’s exact test) or moderate to severe dysplasia (p = 0.630 Fisher’s exact test).

No statistical difference concerning DAPK-1 methylation was confirmed between normal tissue and OLP lesions (p > 0.999 Fisher’s exact test) as well. However, a great increase in the presence of methylation was found in OSCC in comparison to OLP samples as a whole (p < 0.001 chi-square test). Since the methylation of DAPK-1 was detected only in the erosive OLP samples, the statistical difference between erosive and reticular OLP was significant (p = 0.007 Fisher’s exact test). No significant difference was revealed between OLPs and OLs with no dysplasia (p = 0.697 Fisher’s exact test), with mild (p = 0.370 Chi-square test) or moderate and severe dysplasia (p = 0.186 Fisher’s exact test).

In an effort to draw the DAPK-1 methylation profile in the lesions being included in the present study, the whole picture revealed a varied degree of methylation which increases as the degree of dysplasia is increased in OLs with mild dysplasia, even though there is no statistical difference between OL with no and OL with mild dysplasia (p = 0.097 Chi-square test), then methylation weakens in OL with moderate and severe dysplasia compared to mild, and even disappears in certain samples. After that, methylation of DAPK-1 shows an abrupt increase in cancerous lesions. In addition, it shows no presence in tissue samples that have no malignant transformation potential (reticular OLP lesions) whereas it manifested increased presence in the type of lesions that are characterized by a greater danger of transforming into a malignancy (erosive OLP lesions).

4. Discussion

Epigenetics, and particularly DNA methylation, represent a new and very promising chapter in the field of early detection of malignancies but also provide new therapeutic strategies. Many studies have shown that DNA hypermethylation may occur in the early stages of tumorigenesis of various types of cancer, including OSCCs [22,23,24]. The fact that epigenetics is more frequent than gene mutations and are potentially reversible renders them ideal as biomarkers and therapeutic targets [10,12].

DAPK-1 participates in a variety of biological processes including autophagy and apoptosis [18] in response to stress conditions of the endoplasmic reticulum of epithelial cells. It also contributes to the inhibition of necrosis through its connection with p38 MAPK-2 (p38 mitogen-activated protein kinase) which it activates [18]. In addition it promotes inflammatory processes through its participation in signaling activated by pro-inflammatory molecules such as interferon-γ (IFN-γ-interferone-γ), tumor necrosis factor (TNF-a—Tumor necrosis factor-a) or the transforming growth factor (TGF-b—transforming growth factor-b), etc., as well as in processes that lead to the production of cytokines such as interleukin 1b and 18 (IL-1b-interleukin-1b, IL-18-interleukin 18). Its crucial role in promoting these processes is responsible for its tumor suppressing action, which is inactivated by various mechanisms including epigenetic changes such as hypermethylation. Towards this direction, many studies tried to explain the behavior of methylated DAPK-1 which is the first described member of a large family of serine/threonine kinases [25].

The present study gave rise to an integrated effort to visualize the methylation patterns of DAPK-1 in OLP of reticular and erosive type, OLs of all degrees of dysplasia as well as OSCCs in comparison to normal tissues. To the best of our knowledge there is no literature on the methylation of DAPK-1 in OLP lesions. This underlines the possible utility of the present study according to which in OLP lesions, a significant difference was observed regarding the methylation of the promoter of the DAPK-1 gene between the OLP samples (reticular and erosive form) and the corresponding OSCCs, which all showed methylation. DAPK-1 methylation has also been investigated in cases of genital lichen sclerosus in an earlier study by Aide et al. in 2012 in 23 patients [26]. In this study, only 17% (four patients) showed promoter methylation of the gene, while at the same time, p16 methylation was detected in 35% of the sample, while no methylation was detected in the control group consisting of normal tissue samples [26].

As mentioned above, in the present study a difference was observed in the methylation of DAPK-1 between the samples of reticular and erosive forms of OLP. In particular, it was found that kinase gene promoter methylation was present in half of the erosive samples in contrast to the reticular lesions in which no DAPK-1 methylation was detected. This fact reinforces the belief that the erosive form is more prone to malignant transformation. The inhibition of DAPK-1 through methylation, which in addition to its tumor suppressor role is also a promoter of apoptosis, undermines the process of apoptosis, establishing in this way certain conditions of disruption of the cell cycle, and thus abnormal proliferation with increased likelihood of genetic abnormalities which in turn promote carcinogenesis. At the same time, the detection of methylation of DAPK-1 in cells that do not show cancerous characteristics could be translated as an early sign of malignant transformation [27]. In our study DAPK-1 methylation was present in all the OSCCs whereas in other studies the percentages range from 7 to 77% [28,29,30]. A correlation between DAPK-1 methylation and parameters such as age, gender or localization was not established. In contrast, the findings from Noorlag et al. showed that the level of DAPK-1 hypermethylation was higher in lesions excised from the floor of the mouth in comparison to others [31]. Our findings are in accordance with the findings of Liu et al. that did not observe any gender predilection regarding DAPK-1 methylation [32]. The overall profile of the DAPK-1 methylation in our study contradicts Liu M et al. who did not find out any significant difference in DAPK-1 methylation expression between OSCCs and OLs with dysplasia [33]. In order to detect the individual changes in methylation status among several steps of carcinogenesis, analysis came up to a very interesting and probably unique picture of DAPK-1 methylation. It is increasing as the degree of dysplasia is growing from its absence up to mild dysplasia. After that, methylation showed a blasting overexpression in OSCCs. This pattern of methylation is different from that which appeared in another study of Liu Y et al. in 2012 that confirmed the gradual increase in methylation expression as the degree of dysplasia worsened. However, in the same study the levels of DAPK-1 methylation were significantly lower in overall OLs compared to OSCCs [32]. The controversial data about DAPK-1 methylation expression in precancerous and cancerous lesions of the oral cavity, can be explained by the hypothesis that the transition from no dysplasia to mild dysplasia might be the triggering level point of the pre-malignant alteration of normal oral tissue. Immediately before this point an oncogenetic push up signal is released which enhances early carcinogenic procedure including methylation. This oncogenetic signal seems to disappear when its information has already been reclaimed. This means that DAPK-1 methylation might be just a propulsive starting point for carcinogenesis and then disappears until worsening of dysplasia leads finally to carcinoma in which it has been proven that methylation is aberrant and uncontrolled.

Another hypothesis is based on the fact that once triggered by a mutation, a benign lesion can accumulate consecutive methylation events at an on growing rate over time. However, despite the increase in methylation there is no detectable change in histopathological appearance of the lesions. After a certain threshold a tumor suppressor gene is inactivated by methylation and dysplasia rises. This hypothesis was confirmed by the study of Obrien et al. in 2015 about the methylation of the tumor suppressor gene MLH1 in sessile serrated colorectal adenomas (SSAs) in which 20–30% of them turned to colorectal malignancy [34]. However, the study of Liu C et al. in 2018 showed that over the age of 60 a great number of SSAs (almost 70%) were hypermethylated, but the vast majority of them did not develop any dysplasia [35]. Probably this study raises a new field of concern about several other parameters that could affect the expression of methylation such as age or inflammation or tissue-specific differences. It seems that DNA methylation is important in the regulation of inflammatory genes. DAPK-1 has both pro and anti-inflammatory functions. It enhances production and secretion of interleukin (IL)-1 in macrophages while it inhibits inflammation in purified human T cells [36]. For example, it was proved that promoter hypermethylation of DAPK-1 enhanced the inflammatory infiltrate in areas of the colon in patients with ulcerative colitis [37]. As it is understood, inflammation may regulate DNA methylation of several genes which are involved in procedures such as carcinogenesis, and so they must be taken into account when examining the methylation of genes such as DAPK-1.

5. Conclusions

Taking into consideration our aforementioned findings, it becomes well understood that epigenetics represents a new and very exciting field. Since epigenetic changes occur early in carcinogenesis and are potentially reversible, they could be used as disease biomarkers for diagnosis, prognosis and prediction, as well as therapeutic targets in human cancer with reference to OLP, OLs and OSCCs. In fact, inhibitors of DNA methyltransferases have already been used successfully in the treatment of various malignancies including those located in the head and neck region. Biomarkers such as DAPK-1 may be proven very useful in this direction. It is not long until these approaches will be used in everyday clinical practice and will help to reduce oral cancer morbidity and mortality, but further investigation is necessary for this purpose.