Specificity of Gene Expression in Fructose Metabolism in Apilactobacillus kunkeei Isolated from Honey Bees
Abstract
1. Introduction
2. Materials and Methods
2.1. Microorganisms and Growth Conditions
2.2. Determination of D-Glucose, D-Fructose, D/L-Lactic Acid and Ethanol for D/L-Lactic Acid and Ethanol for Apb. kunkeei AG8 and AG9 Strains
2.3. Determination of Enzymatic Activities
2.4. Disintegration of Apb. kunkeei Cells
2.5. Enzymatic Assay of Fructokinase (EC 2.7.1.4)
2.6. Enzymatic Assay of D/L-Lactate Dehydrogenase (EC 1.1.1.28; 1.1.1.27)
2.7. Enzymatic Assay of Alcohol Dehydrogenase
2.8. Enzymatic Assay of Acetate Kinase (EC 2.7.2.1)
2.9. Analysis of Gene Expression of Enzymes of ABC-Transporter-Related Genes
2.10. GeXP Fragment and Data Analyses
3. Results and Discussion
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Dardir, H.A. In vitro evaluation of probiotic activities of lactic acid bacteria strains isolated from novel probiotic dairy products. Global Vet. 2012, 8, 190–196. [Google Scholar]
- Klaenhammer, T.R.; Barrangou, R.; Buck, B.L.; Azcarate-Peril, M.A.; Altermann, E. Genomic feature of lactic acid bacteria effecting bioprocessing and health. FEMS Microbiol. Rev. 2005, 29, 393–409. [Google Scholar] [CrossRef] [PubMed]
- Oprea, S.E.; Zervos, M.J. Enterococcus and Its Association with Foodborne Illness; Humana Press Inc.: Clifton, NJ, USA, 2007. [Google Scholar]
- König, H.; Unden, G.; Fröhlich, J. (Eds.) Biology of Microorganisms on Grapes, in Must and in Wine (Chapter 1); Springer: Berlin/Heidelberg, Germany, 2009; pp. 3–29. [Google Scholar]
- Silva, M.S.; Rabadzhiev, Y.; Eller, M.R.; Iliev, I.; Ivanova, I.; Santana, W.C. Microorganisms in Honey. Honey Anal. 2017, 500, 233–257. [Google Scholar] [CrossRef] [Scilit]
- Rabadjiev, Y.; Christova, P.; Iliev, I.; Ivanova, I. Identification of lactic acid bacteria flora within the honey intestinal tract of Apis millifera from different regions of Bulgaria. J. Biosci. Biotechnol. 2016, 215–224. [Google Scholar]
- Todorov, S.D.; Baretto Penna, A.L.; Venema, K.; Holzapfel, W.H.; Chikindas, M.L. Recommendations for the use of standardized abbreviations for the former Lactobacillus genera, reclassified in the year 2020. Benef. Microbes 2003, 15, 1–4. [Google Scholar] [CrossRef] [Scilit]
- Günther, M.A.; Sillero, A.; Sols, A. Fructokinase assay with a specific spectrophotometric method using 1-phosphofructokinase. Enzymol. Biol. Clin. 1967, 8, 341–352. [Google Scholar] [CrossRef] [Scilit]
- Maekawa, M. Lactate dehydrogenase isoenzymes. J. Chromatogr. 1988, 429, 373–398. [Google Scholar] [CrossRef] [Scilit]
- Fibla, J.; Gonzalez-Duarte, R. Colorimetric assay to determine alcohol dehydrogenase activity. J. Biochem. Biophys. Methods 1993, 26, 87–93. [Google Scholar] [CrossRef] [Scilit]
- Ferry, J.G. Acetate kinase and phosphotransacetylase. Meth. Enzymol. 2011, 494, 219–231. [Google Scholar] [CrossRef] [Scilit]
- Ananieva, M.; Tzenova, M.; Iliev, I.; Ivanova, I. Gene expression of enzymes involved in utilization of xylooligosaccharides by Lactobacillus strains. Biotechnol. Biotechnol. Equip. 2014, 28, 941–948. [Google Scholar] [CrossRef] [Scilit]
- Cavicchioli, V.Q.; Todorov, S.D.; Iliev, I.; Ivanova, I.; Drider, D.; Nero, L.A. Physiological and molecular insights of bacteriocin production by Enterococcus hirae ST57ACC from Brazilian artisanal cheese. Braz. J. Microbiol. 2019, 50, 369–377. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Endo, A.; Futagawa-Endo, Y.; Dicks, L.M.T. Isolation and characterization of fructophilic lactic acid bacteria from fructose-rich niches. Syst. Appl. Microbiol. 2009, 32, 593–600. [Google Scholar] [CrossRef] [Scilit]
- Nothaft, H.; Parche, S.; Kamionka, A.; Titgemeyer, F. In vivo analysis of HPr reveals a fructose-specific phosphotransferase system that confers high-affinity uptake in Streptomyces coelicolor. J. Bacteriol. 2003, 185, 929–937. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Aulkemeyer, P.; Ebner, G.; Heilenmann, K.; Jahreis, K.; Schmid, K.; Wrieden, S.; Lengeler, J.W. Molecular analysis of two fructokinases involved in sucrose metabolisms of enteric bacteria. Mol. Microbiol. 1991, 5, 2913–2922. [Google Scholar] [CrossRef] [Scilit]
- Fennington, G.J.; Hughes, T.A. The fructokinase from Rhizobium leguminosarum biovar trifolii belongs to group I fructokinase enzymes and is encoded separately from other carbohydrate metabolism enzymes. Microbiology 1996, 142 Pt 2, 321–330. [Google Scholar] [CrossRef] [Scilit]
- Jiang, S.-Y.; Chi, Y.-H.; Wang, J.-Z.; Zhou, J.-X.; Cheng, Y.-S.; Zhang, B.-L.; Ma, A.; Vanitha, J.; Ramachandran, S. Sucrose metabolism gene families and their biological functions. Sci. Rep. 2015, 5, 17583. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- de Vries, W.; Stouthamer, A.H. Pathway of glucose fermentation in relation to the taxonomy of bifidobacteria. J. Bacteriol. 1967, 93, 574–576. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Edenberg, H.J.; McClintick, J.N. Alcohol dehydrogenases, aldehyde dehydrogenases, and alcohol use disorders: A Critical Review. Alcohol. Clin. Exp. Res. 2018, 42, 2281–2297. [Google Scholar] [CrossRef] [Scilit]
- Siezen, R.J.; van Hylckama Vlieg, J.E. Genomic diversity and versatility of Lactobacillus plantarum, a natural metabolic engineer. Microb. Cell Factories 2011, 10 (Suppl. S1), S3. [Google Scholar] [CrossRef] [Scilit]
- Wong, C.N.A.; Ng, P.; Douglas, A.E. Low-diversity bacterial community in the gut of the fruitfly Drosophila melanogaster. Environ. Microbiol. 2011, 13, 1889–1900. [Google Scholar] [CrossRef] [Scilit]
- Mendes-Soares, H.; Suzuki, H.; Hickey, R.J.; Forney, L.J. Comparative functional genomics of Lactobacillus spp. reveals possible mechanisms for specialization of vaginal lactobacilli to their environment. J. Bacteriol. 2014, 196, 1458–1470. [Google Scholar] [CrossRef] [Scilit]
- Oh, P.L.; Benson, A.K.; Peterson, D.A.; Patil, P.B.; Moriyama, E.N.; Roos, S.; Walter, J. Diversification of the gut symbiont Lactobacillus reuteri as a result of host-driven evolution. ISME J. 2010, 4, 377–387. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- van de Guchte, M.; Penaud, S.; Grimaldi, C.; Barbe, V.; Bryson, K.; Nicolas, P.; Robert, C.; Oztas, S.; Mangenot, S.; Couloux, A.; et al. The complete genome sequence of Lactobacillus bulgaricus reveals extensive and ongoing reductive evolution. Proc. Natl. Acad. Sci. USA 2006, 103, 9274–9279. [Google Scholar] [CrossRef] [Scilit]
- Endo, A.; Irisawa, T.; Futagawa-Endo, Y.; Takano, K.; du Toit, M.; Okada, S.; Dicks, L.M.T. Characterization and emended description of Lactobacillus kunkeei as a fructophilic lactic acid bacterium. Int. J. Syst. Evol. Microbiol. 2012, 62, 500–504. [Google Scholar] [CrossRef] [Scilit]
- Endo, A.; Okada, S. Reclassification of the genus Leuconostoc and proposals of Fructobacillus fructosus gen. nov., comb. nov., Fructobacillus durionis comb. nov., Fructobacillus ficulneus comb. nov. and Fructobacillus pseudoficulneus comb. nov. Int. J. Syst. Evol. Microbiol. 2008, 58, 2195–2205. [Google Scholar] [CrossRef] [Scilit]
- Tamarit, D.; Ellegaard, K.M.; Wikander, J.; Olofsson, T.; Vásquez, A.; Andersson, S.G.E. Functionally structured genomes in Lactobacillus kunkeei colonizing the honey crop and food products of honeybees and stingless bees. Genome Biol. Evol. 2015, 7, 1455–1473. [Google Scholar] [CrossRef] [Scilit]
- Zaunmüller, T.; Eichert, M.; Richter, H.; Unden, G. Variations in the energy metabolism of biotechnologically relevant heterofermentative lactic acid bacteria during growth on sugars and organic acids. Appl. Microbiol. Biotechnol. 2006, 72, 421–429. [Google Scholar] [CrossRef] [Scilit]
- Edwards, C.G.; Haag, K.M.; Collins, M.D.; Hutson, R.A.; Huang, Y.C. Lactobacillus kunkeei sp. nov.: A spoilage organism associated with grape juice fermentations. J. Appl. Microbiol. 1998, 84, 698–702. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Endo, A.; Salminen, S. Honeybees and beehives are rich sources for fructophilic lactic acid bacteria. Syst. Appl. Microbiol. 2013, 36, 444–448. [Google Scholar] [CrossRef] [Scilit]
- Vojvodic, S.; Rehan, S.M.; Anderson, K.E. Microbial gut diversity of Africanized and European honey bee larval instars. PLoS ONE 2013, 8, e72106. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rangberg, A.; Mathiesen, G.; Amdam, G.V.; Diep, D.B. The paratransgenic potential of Lactobacillus kunkeei in the honey bee Apis mellifera. Benef. Microbes 2015, 6, 513–524. [Google Scholar] [CrossRef] [Scilit]
- Todorov, S.D.; Alves, M.V.; Bueno, G.C.A.; Alves, V.F.; Ivanova, I.V. Bee-associated beneficial microbes—Importance for bees and for humans. Insects 2024, 15, 430. [Google Scholar] [CrossRef] [Scilit]
- Kaplan, H.; Hutkins, R.W. Metabolism of fructooligosaccharides by Lactobacillus paracasei 1195. Appl. Environ. Microbiol. 2003, 69, 2217–2222. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Barrangou, R.; Azcarate-Perll, M.; Doung, T.; Conners, S.; Kelly, R.; Klaenhammer, T. Global analiysis of carbohydrate utilization by Lactobacillus acidophilus using cDNA microarrays. Proc. Natl. Acad. Sci. USA 2006, 103, 3816–3821. [Google Scholar] [CrossRef] [Scilit]
- Havarstein, L.S.; Diep, D.B.; Nes, I.F. A family of bacteriocin ABC transporters carry out proteolytic processing of their substrates concomitant with export. Mol. Microbiol. 1995, 16, 229–240. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dobson, A.E.; Sanozky-Dawes, R.B.; Klaenhammer, T.R. Identification of an operon and inducing peptide involved in the production of lactacin B by Lactobacillus acidophilus. J. Appl. Microbiol. 2007, 103, 1766–1778. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Diep, D.B.; Håvarstein, L.S.; Nes, I.F. Characterization of the locus responsible for the bacteriocin production in Lactobacillus plantarum C11. J. Bacteriol. 1996, 178, 4472–4483. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- de Jong, A.; van Hijum, S.A.; Bijlsma, J.J.; Kok, J.; Kuipers, O.P. BAGEL: A web-based bacteriocin genome mining tool. Nucleic Acids Res. 2006, 34, W273–W279. [Google Scholar] [CrossRef] [Scilit]
- Piccart, K.; Vásquez, A.; Piepers, S.; De Vliegher, S.; Olofsson, T.C. Short communication: Lactic acid bacteria from the honeybee inhibit the in vitro growth of mastitis pathogens. J. Dairy Sci. 2016, 99, 2940–2994. [Google Scholar] [CrossRef] [Scilit]
- Iorizzo, M.; Pannella, G.; Lombardi, S.J.; Ganassi, S.; Testa, B.; Succi, M.; Sorrentino, E.; Petrarca, S.; De Cristofaro, A.; Coppola, R.; et al. Inter- and intra-species diversity of lactic acid bacteria in Apis mellifera ligustica colonies. Microorganisms 2020, 8, 1578. [Google Scholar] [CrossRef] [Scilit]
- Zheng, H.; Steele, M.I.; Leonard, S.P.; Motta, E.V.S.; Moran, N.A. Honey bees as models for gut microbiota research. Lab. Animal. 2018, 47, 317–325. [Google Scholar] [CrossRef] [Scilit]
- Zheng, J.; Wittouck, S.; Salvetti, E.; Franz, C.M.A.P.; Harris, H.M.B.; Mattarelli, P.; O’Toole, P.W.; Pot, B.; Vandamme, P.; Walter, J.; et al. A taxonomic note on the genus Lactobacillus: Description of 23 novel genera, emended description of the genus Lactobacillus Beijerinck 1901, and union of Lactobacillaceae and Leuconostocaceae. Int. J. Syst. Evol. Microbiol. 2020, 70, 2782–2858. [Google Scholar] [CrossRef] [Scilit]
- Vásquez, A.; Forsgren, E.; Fries, I.; Paxton, R.J.; Flaberg, E.; Szekely, L.; Olofsson, T.C. Symbionts as major modulators of insect health: Lactic acid bacteria and honeybees. PLoS ONE 2012, 7, e33188. [Google Scholar] [CrossRef] [Scilit]
- Olofsson, T.C.; Vásquez, A. Detection and identification of a novel lactic acid bacterial flora within the honey stomach of the honeybee Apis mellifera. Curr. Microbiol. 2008, 57, 356–363. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vásquez, A.; Olofsson, T.C.; Sammataro, D. A scientific note on the lactic acid bacterial flora in honeybees in the USA—A comparison with bees from Sweden. Apidologie 2008, 40, 26–28. [Google Scholar] [CrossRef] [Scilit]
- Forsgren, E.; Olofsson, T.C.; Vásquez, A.; Fries, I. Novel lactic acid bacteria inhibiting Paenibacillus larvaein honey bee larvae. Apidologie 2009, 41, 99–108. [Google Scholar] [CrossRef] [Scilit]
- Olofsson, T.C.; Butler, È.; Markowicz, P.; Lindholm, C.; Larsson, L.; Vásquez, A. Lactic acid bacterial symbionts in honeybees—An unknown key to honey’s antimicrobial and therapeutic activities. Int. Wound J. 2014, 13, 668–679. [Google Scholar] [CrossRef] [Scilit]
- Martinson, V.G.; Danforth, B.N.; Minckley, R.L.; Rueppell, O.; Tingek, S.; Moran, N.A. A simple and distinctive microbiota associated with honey bees and bumble bees. Mol. Ecol. 2010, 20, 619–628. [Google Scholar] [CrossRef] [Scilit]
- Kanno, N.; Maeno, S.; Tanizawa, Y.; Arita, M.; Endo, A.; Iwasaki, W. Evolutionary pathways toward multi-level convergence of lactic acid bacteria in fructose-rich environments. Commun. Biol. 2024, 7, 902. [Google Scholar] [CrossRef] [Scilit]
- Maeno, S.; Tanizawa, Y.; Kanasaki, Y.; Kubuta, E.; Kumar, H.; Dicks, L.; Salmnien, S.; Makagawa, J.; Arita, M.; Endo, A. Genomic characterization of a fructophilic bee symbiont Lactobacillus kunkeei reveals its niche-specific adaptation. Syst. Appl. Microbiol. 2016, 39, 516–526. [Google Scholar] [CrossRef] [Scilit]
| Primers | Sequence of the Applied Primers | Biological Function of Targeted Gene | Length of the Generated PCR Product (bp) |
|---|---|---|---|
| gluc F gluc R | AGGTGACACTATAGAATATCTTTGGCGGTACTGGTGAC GTACGACTCACTATAGGGATGTTGGGCAATCGTACCGAA | Glucose-6-phosphate 1-dehydrogenase | 120 bp |
| dhL1 F dhL1 R | AGGTGACACTATAGAATATCTGCGGCAAAGTACCCAAT GCCGGATTATTCGCAAGCAGGTACGACTCACTATAGGGA | Malat/L-lactate-dehydrogenase | 151 bp |
| fruc F fruc R | AGGTGACACTATAGAATACCAGCTGCTACCCCTTCAAA GTACGACTCACTATAGGGAGAAGCGGGCGGTACTAAGTT | Fructokinase | 460 bp |
| aldeh F aldeh R | AGGTGACACTATAGAATACAATTGGCTCGGCCATTACG GTACGACTCACTATAGGGACCATTTGCTGCCGATCTTCG | Alcohol dehydrogenase | 430 bp |
| zj316_2428 F zj316_2428 R | AGGTGACACTATAGAATACGGTTCCGTCGAACCTAACA ATAAGCGGTTGTCAGGCGAAGTACGACTCACTATAGGGA | Efflux ABC transporter, ATP-binding and permease protein | 347 bp |
| lbp_cg0987 F lbp_cg0987 R | AGGTGACACTATAGAATATCAACGGCAACGAGTAGCTT TGGACCTGACCAGATTGTGCGTACGACTCACTATAGGGA | Sugar ABC transporter, ATP-binding protein | 280 bp |
| jdm1_2227 F jdm1_2227 R | AGGTGACACTATAGAATACGGTCCAAATTTGTTGCCGT TTAGGGATGGAGGCTGTGGAGTACGACTCACTATAGGGA | ABC transporter ATP-binding protein | 200 bp |
| gluc F gluc R | AGGTGACACTATAGAATATCTTTGGCGGTACTGGTGAC GTACGACTCACTATAGGGATGTTGGGCAATCGTACCGAA | Glucose-6-phosphate 1-dehydrogenase |
| Apb. kunkeei AG8 | Apb. kunkeei AG9 | ||
|---|---|---|---|
| FYP supplemented with 1% fructose | Acetate (g/L) | 1.62 ± 0.22 | 2.5 ± 0.24 |
| Lactate (g/L) | 0.54 ± 0.08 | 0.37 ± 0.06 | |
| Ratio acetate/lactate | 75%:25% | 87%:13% | |
| Ethanol (g/L) | 0 | 0 | |
| Acetatekinase (U/mg protein) | 0.78 ± 0.07 | 1.01 ± 0.08 | |
| L-lactate dehydrogenase (U/mg protein) | 0.24 ± 0.06 | 0.17 ± 0.04 | |
| Fructokinase (U/mg protein) | 0.64 ± 0.06 | 0.69 ± 0.06 | |
| Acoholdehydrogenase (U/mg protein) | 0 | 0 | |
| FYP supplemented with 10% fructose | Acetate (g/L) | 2.1 ± 0.21 | 3.2 ± 0.24 |
| Lactate (g/L) | 0.09 ± 0.01 | 0.12 ± 0.01 | |
| Ratio acetate/lactate | 96%:4% | 96%:4% | |
| Ethanol (g/L) | 0 | 0 | |
| Acetatekinase (U/mg protein) | 0.53 ± 0.05 | 1.61 ± 0.09 | |
| L-lactate dehydrogenase (U/mg protein) | 0.11 ± 0.02 | 0.13 ± 0.02 | |
| Fructokinase (U/mg protein) | 1.06 ± 0.12 | 1.09 ± 0.12 | |
| Acoholdehydrogenase (U/mg protein) | 0 | 0 | |
| FYP supplemented with 30% fructose | Acetate (g/L) | 3.22 ± 0.21 | 3.35 ± 0.23 |
| Lactate (g/L) | 0.023 ± 0.002 | 0.048 ± 0.002 | |
| Ratio acetate/lactate | 99%:1% | 99%:1% | |
| Ethanol (g/L) | 0.011 ± 0.002 | 0.049 ± 0.004 | |
| Acetatekinase (U/mg protein) | 1.81 ± 0.18 | 1.95 ± 0.16 | |
| L-lactate dehydrogenase (U/mg protein) | 0.06 ± 0.002 | 0.05 ± 0.002 | |
| Fructokinase (U/mg protein) | 1.96 ± 0.23 | 1.98 ± 0.20 | |
| Acoholdehydrogenase (U/mg protein) | 0.11 ± 0.02 | 0.25 ± 0.02 |
| The Biological Importance of the Enzyme | Apb. kunkeei AG8 | Apb. kunkeei AG9 | |||||
|---|---|---|---|---|---|---|---|
| GYP 1% Glucose | FYP 1% Fructose | FYP 30% Fructose | GYP 1% Glucose | FYP 1% Fructose | FYP 30% Fructose | ||
| Glucose-6-phosphate 1-dehydrogenase | An enzyme of the pentose phosphate pathway | +++ | +++ | +++ | +++ | +++ | +++ |
| L-lactate-dehydrogenase | Converts pyruvate into L-lactate | +++ | ++ | +++ | ++ | +++ | ++ |
| Fructokinase | Phosphorylation of fructose | + | + | - | ++ | ++ | + |
| Alcohol dehydrogenase | Oxidoreductase for transformation of alcohols to aldehyde and ketone | + | + | + | + | + | + |
| Efflux ABC transporter, ATP-binding and permease protein | Participates in the transport of sugars across the cell membrane | ++ | - | - | +++ | ++ | ++ |
| Sugar ABC transporter, ATP-binding protein | Promotes the entry of sugars into the cell, associated with ATP hydrolysis | ++ | ++ | +++ | +++ | ++ | - |
| ABC transporter ATP-binding protein | Provides the energy for the passage of substrates through the cell wall | - | ++ | - | - | ++ | ++ |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ivanova, I.V.; Rabadjiev, Y.; Ananieva, M.; Iliev, I.; Todorov, S.D. Specificity of Gene Expression in Fructose Metabolism in Apilactobacillus kunkeei Isolated from Honey Bees. Appl. Microbiol. 2025, 5, 130. https://doi.org/10.3390/applmicrobiol5040130
Ivanova IV, Rabadjiev Y, Ananieva M, Iliev I, Todorov SD. Specificity of Gene Expression in Fructose Metabolism in Apilactobacillus kunkeei Isolated from Honey Bees. Applied Microbiology. 2025; 5(4):130. https://doi.org/10.3390/applmicrobiol5040130
Chicago/Turabian StyleIvanova, Iskra Vitanova, Yavor Rabadjiev, Maria Ananieva, Ilia Iliev, and Svetoslav Dimitrov Todorov. 2025. "Specificity of Gene Expression in Fructose Metabolism in Apilactobacillus kunkeei Isolated from Honey Bees" Applied Microbiology 5, no. 4: 130. https://doi.org/10.3390/applmicrobiol5040130
APA StyleIvanova, I. V., Rabadjiev, Y., Ananieva, M., Iliev, I., & Todorov, S. D. (2025). Specificity of Gene Expression in Fructose Metabolism in Apilactobacillus kunkeei Isolated from Honey Bees. Applied Microbiology, 5(4), 130. https://doi.org/10.3390/applmicrobiol5040130

