Molecular Characterization and Antimicrobial Resistance of Salmonella from Chicken Meat and Water in Retail Markets of Chitwan, Nepal

Abstract

Salmonella is a zoonotic foodborne pathogen that affects poultry health and reaches consumers through the food chain via contaminated products. A cross-sectional study was conducted to isolate and identify Salmonella and to detect antibiotic resistance genes in Salmonella isolates from retail meat shops in Chitwan, Nepal. The antimicrobial susceptibility test was carried out using the Kirby–Bauer disc diffusion method. Antibiotic resistance genes were detected by using multiplex polymerase chain reaction (PCR). A total of 216 samples, chicken meat (108) and water (108), were tested for the presence of Salmonella. Out of the 216 samples tested, 38 samples were positive, giving an overall prevalence of 17.59%. A higher prevalence of Salmonella was found in meat samples, 29.62% (32/108), compared with the water samples, 5.55% (6/108), which was statistically significant (p < 0.05). The antibiogram profile showed maximum resistance to doxycycline (88%), followed by tetracycline (86%), erythromycin (79%), ampicillin + sulbactam (76%), ceftriaxone (22%), levofloxacin (21%), gentamicin (18%), chloramphenicol (13%), and amikacin (15%). The prevalence of the tetB gene and ere(A) gene was 23.68% (9/38) and 18.42% (7/38), respectively, and the association was statistically non-significant (p > 0.05). However, mcr1, catA1, and blaTEM genes were not detected. The study recommends integrated surveillance encompassing human health, food safety, and animal health under the ‘One Health’ approach, highlighting the need for effective strategies involving poultry farms, retail meat shops, and consumers to minimize contamination and reduce the transmission of Salmonella along the food chain from primary production to consumption on a global scale.

1. Introduction

Chicken is widely accepted across nearly all ethnic groups in Nepal and serves as an affordable source of protein that is low in fat and rich in unsaturated fatty acids [1]. The number of meat shops is rapidly growing in Nepal and most people purchase chicken from small, local shops that often lack proper sanitation, hygienic handling practices, and cold storage [2]. These conditions promote the growth of microorganisms and increase the risk of microbial transmission to consumers. According to the World Health Organization, nearly 1 in 10 people fall ill and approximately 420,000 die each year due to consuming contaminated food [3]. In developing countries, poor handling of raw meat is a major contributor to cross-contamination and foodborne illnesses. Retail shops can serve as sources of bacterial contamination, as live poultry sold at these locations may shed Salmonella and other bacteria in their droppings, contaminating their feathers, beaks, and the surrounding environment [4]. Improper handling and lack of hygiene at these points of sale can facilitate the indirect transmission of the Salmonella pathogen to humans. In most retail meat shops, chickens are slaughtered on-site in a small slaughtering room typically located at the back of the shop. However, in some cases, pre-slaughtered chickens are transported to the shops from small-scale local processing units. This variability in local slaughtering logistics may contribute to differences in hygienic conditions and potential cross-contamination risks during processing and retail. In addition to improper handling practices at retail stores, the quality of water used during meat processing and cleaning can also influence contamination, potentially serving as a vehicle for the spread of Salmonella and other pathogens. Most of the meat sellers in Chitwan, where access to groundwater is more abundant, use tap water and well water for slaughtering, processing the meat, as well as cleaning. However, water coming from these sources may fail to meet the microbiological safety standards, increasing the risk of contaminating the meat with harmful pathogens such as Salmonella, E. coli, Campylobacter, and Listeria, etc. [5]. Leboa et al. [6] reported the prevalence of Salmonella Typhi and Salmonella Paratyphi in various household drinking water sources in Nepal, including municipal supplies, company jugs, surface water, and wells, highlighting the potential of water as a transmission route for Salmonella. Similarly, Karkey et al. [7] observed deteriorated microbiological quality in the municipal water of Kathmandu with fecal matter, serving as a major vehicle for the spread of Salmonella Typhi and Salmonella Paratyphi A, with their DNA detected in 77% and 70% of water samples, respectively.

Salmonella is a gram-negative, rod-shaped, non-spore-forming, mostly motile, non-capsulated, facultatively anaerobic bacterium that measures around 2–3 × 0.4–0.6 μm in size and belongs to the Enterobacteriaceae family [8]. Salmonella is a significant zoonotic bacterial pathogen responsible for bacteremia, enteric fever (typhoid), localized infection, and gastroenteritis in both people and animals [9]. Due to the possibility of the antibiotic resistance determinants spreading to other bacteria with human or societal significance, food contamination by antibiotic-resistant bacteria can pose a serious risk to public health. Salmonella develops resistance either by acquiring hybrid plasmids carrying multiple resistance genes or through chromosomal mutations that alter antibiotic targets [10]. Between decades, there has been an increase in the frequency of antibiotic resistance among foodborne diseases [11].

In food-producing animals and poultry, the prophylactic use of antibiotics has been a significant contributor to the establishment of strains that are resistant to specific antibiotics [12]. The high prevalence of infectious diseases, improper use of antibiotics in therapy, use of antibiotics as growth promoters, and a lack of or ineffective implementation of antimicrobial resistance legislation are the main causes of antimicrobial resistance in underdeveloped nations [13]. The rise and spread of antimicrobial-resistant Salmonella, particularly MDR strains, has been one of the main public health problems over the past 20 years [14]. Consuming contaminated foods of animal origin causes the bulk of MDR Salmonella infections [15]. This study was conducted to assess the prevalence, antimicrobial resistance pattern (ARP), and molecular characteristics of Salmonella isolated from chicken meat and water in retail markets of Chitwan, Nepal, to better understand the public health risks and guide effective control strategies.

2. Materials and Methods

2.1. Collection and Preparation of Samples

This cross-sectional study was conducted during a period of 8 months (July 2021 to February 2022) to detect the presence of antibiotic-resistant genes from Salmonella isolated from meat and water samples of retail meat shops of Chitwan district located in the southwest part of Bagmati Province, Nepal (Latitude 27°36′21.60″ North, Longitude 84°22′47.28″ East). The protocol was based on ISO 6579:2002 for the detection of Salmonella spp. in food and animal feeding stuffs, with minor adjustments to sample volumes and incubation conditions [16]. A total of 216 samples were collected from retail meat shops of Chitwan, including 108 chicken meat samples (30 g each) and 108 water samples (1 L each) aseptically in sterilized sample collecting plastic zip-lock bags and sample bottles, respectively. From each retail meat shop, two chicken meat samples and two source water samples were taken. The primary water sources used by the meat shops for dressing and processing included tap water, tube well water, and dug well water, depending on the availability and infrastructure at each location. The collected meat and water samples were transported on a cold chain box with ice packs immediately to the Microbiology Laboratory of the Faculty of Animal Science, Veterinary and Fisheries, Agriculture and Forestry University. The samples were processed on the same day within 2–3 h of collection. The chicken meat samples were then homogenized using a sterilized mortar and pestle.

2.2. Isolation and Identification of Salmonella spp.

Samples (3–4.5 g of meat or equivalent volume of water) were subjected to non-selective pre-enrichment by adding to buffered peptone water (BPW) at a 1:10 ratio and incubated at 37 °C for 24 h. For selective enrichment, 0.1 mL of the pre-enriched culture was transferred to 10 mL of Rappaport Vassiliadis R10 (RVR10) broth and incubated at 42 °C for 24 h [17]. The enriched broth was streaked onto XLD agar using a sterile loop and incubated at 37 °C for 24 h. Colonies exhibiting black centers, typical of Salmonella species, were identified as presumptive and subjected to confirmatory testing by biochemical tests, including Triple Sugar Iron (TSI) agar, Motility–Indole–Ornithine (MIO) test, Simmons citrate agar, oxidase test, catalase test, and IMViC tests (Indole, Methyl Red, Voges–Proskauer, and Citrate utilization) [18]. These methods allowed for the accurate identification of Salmonella spp. from meat and water samples.

2.3. Preservation of Salmonella Isolates

The positive colonies were inoculated into the nutrient broth and incubated for 6 h at 37 °C. Then, 0.5 mL of inoculated broth was mixed with an equal volume of 40% glycerin, and the final concentration was adjusted to 20% glycerin in Eppendorf tubes. The Eppendorf tubes were then kept at −20 °C for preservation after covering the tubes with paraffin.

2.4. Antibiotic Sensitivity Test

The isolates of Salmonella were tested for their sensitivity and resistance to seven different commonly used antibiotics by the Kirby–Bauer method following the Clinical and Laboratory Standards Institute (CLSI) guidelines M100, 28th edition (CLSI, 2018) [19]. Antibiotic discs containing amikacin (30 mcg), ampicillin + sulbactam (10/10 mcg), ceftriaxone (30 mcg), levofloxacin (5 mcg), gentamycin (10 mcg), chloramphenicol (30 mcg), doxycycline (30 mcg), and erythromycin (15 mcg) were used. The selection of antibiotics for the susceptibility test was based on their common usage in both clinical and veterinary settings in Nepal. Tetracyclines (doxycycline, tetracycline), macrolides (erythromycin), and aminoglycosides (gentamicin, amikacin) are frequently used in poultry farming for therapeutic and prophylactic purposes [20]. Additionally, drugs such as ceftriaxone, levofloxacin, and ampicillin + sulbactam are widely used in clinical practice to treat human salmonellosis and other infections. The antibiotic discs were obtained from HiMedia, India. The preserved bacteria were cultured onto nutrient agar in Petri plates and pure colonies were obtained. Five pure colonies were inoculated into 5 mL of Brian Heart Infusion (BHI) broth (M210, HiMedia, India). The broth was incubated at 37 °C for 6 h and was observed for turbidity and evaluated against the standard of 0.50 McFarland [21].

The suitable turbidity of the broth (i.e., similar to 0.50 McFarland) was obtained either by diluting or incubating further. When the suitable turbidity of the broth was achieved, 100 µL of the broth was spread over the surface of Mueller Hinton Agar (MHA) (M173, HiMedia, India) in a Petri plate with the help of a spreader. The antibiotic discs were kept over the MHA with proper spacing between the antibiotic discs. The plates were incubated at 37 °C for 24 h, and the diameters of the zone of inhibition were measured with the help of the antibiotic zone scale (HiMedia, India). The resistance breakpoints used are those defined by CLSI for the classification of isolates as sensitive (S), intermediately sensitive (I), and resistant (R) [19]. Each Salmonella isolate was tested once for antibiotic susceptibility using the disc diffusion method. Due to financial constraints, technical replicates were not performed; thus, the zone diameter measurements represent single observations per isolate.

2.5. DNA Extraction and Quantification

The rapid boiling method was performed according to De Medici et al. [22] with slight modification. One milliliter of Luria–Bertani broth was added to an Eppendorf tube. Four to five colonies of Salmonella spp. were picked and dissolved in the Eppendorf tube, followed by incubation at 37 °C. Then the overnight bacterial culture was cooled at 4 °C for 10 min and centrifuged at 13,000 rpm for 5 min. The supernatant was carefully removed and the pellet was suspended in 300 µL nuclease-free water (NFW). The sample was then boiled for 15 min in a water bath at 100 °C and immediately cooled at −20 °C for 10 min before centrifugation at 13,000 rpm for 5 min. Finally, the supernatant containing genomic DNA was transferred to a new tube and it was used for subsequent PCR amplification and quantification.

Quantification of DNA extracted from Salmonella culture was carried out spectrophotometrically at 260 nm and 280 nm using a µdrop spectrophotometer (Thermo Scientific Multiskan SkyHigh Microplate Spectrophotometer, Thermo Fisher Scientific, Waltham, MA, USA) for determination of sample concentration and purity [23]. To determine the quantity of DNA, 4 µL of the DNA sample was loaded in the µdrop Spectrophotometer. With the help of the SCAN IT RE 6.0.2 software, the quantity and purity of DNA were calculated and displayed on the monitor of a computer. Quantified DNA was stored at −20 °C in the refrigerator.

2.6. Detection of Antibiotic Resistance Genes by Multiplex PCR

The presence of antibiotic-resistant genes in Salmonella spp. was detected by using multiplex PCR. Five groups of antibiotic-resistant genes were studied by using the sets of primers as shown in

Table 1. Salmonella spp. antibiotic resistance genes and the primer sequence used for PCR identification.

Antimicrobial Agent	Target Gene	Amplicon Size (bp)	Primer Sequence	Reference
Beta-lactams	blaTEM	857	F: GAGTATTCAACATTTTCGT	[24]
			R: ACCAATGCTTAATCAGTGA
Tetracycline	tetB	670	F: CCTCAGCTTCTCAACGCGTG	[25]
			R: GCACCTTGCTGATGACTCTT
Chloramphenicol	catA1	547	F: AGTTGCTCAATGTACCTATAACC	[24]
			R: TTGTAATTCATTAAGCATTCTGCC
Erythromycin	ere(A)	419	F: GCCGGTGCTCATGAACTTGAG	[24]
			R: CGACTCTATTCGATCAGAGGC
Polymyxin	mcr1	309	F: CGGTCAGTCCGTTTGTTC	[26]
			R: CTTGGTCGGTCTGTAGGG

Note: F = forward primer, R = reverse primer.

. The primers were diluted with NFW in a ratio of 1:9.

2.7. Multiplex PCR Amplification and Thermal Cycling Conditions

The PCR mixture for amplification of antibiotic resistance genes (blaTEM, tet(B), catA1, ere(A), and mcr1) was prepared in a final volume of 24 µL, containing 12 µL of Invitrogen™ Platinum™ Green Hot Start PCR Master Mix (2X), 2 µL of genomic DNA (100 ng/µL), and 1 µL each of forward and reverse primers for each gene. Template DNA was added last. The mixing was performed in a biosafety cabinet at low temperature using cold PCR tube racks to prevent contamination. In each batch of the PCR run, a positive control tube containing the PCR positive control provided by the manufacturer and a no-template control (NTC) tube containing sterile distilled water were included as internal controls to validate the assay performance. The ATCC Salmonella enterica strain (ATCC 35664) served as the positive control to ensure the accuracy of amplification. PCR was performed using a Bio-Rad T100™ Thermal Cycler (Bio-Rad, Hercules, CA, USA) under the following conditions: initial denaturation at 95 °C for 5 min, followed by 35 cycles of denaturation at 94 °C for 30 s, annealing at 58 °C for 30 s, and elongation at 72 °C for 1 min [27]. Repeat step 2 for 35 cycles. After a final extension step at 72 °C for 10 min, the sample was stored at 4 °C until further analysis. Multiplex PCR was performed to amplify five antibiotic-resistant genes: blaTEM, tet(B), catA1, ere(A), and mcr1.

The amplified PCR products were resolved by electrophoresis at 90 V, 90 A for 90 min in a 2% agarose gel, which was prepared in 1X Tris-acetate-EDTA (TAE) buffer. In the beginning, a 2% agarose gel was prepared by adding 1.80 g agarose in 90 mL 1X TAE (Tris-Acetate-EDTA) along with 2 µL Ethidium Bromide. The mixture was heated in the microwave till the agarose was completely dissolved. The gel was then cast on a casting tray after cooling down to around 60 °C. The wells were made by inserting a comb into the slots on a tray and kept still to set. After 30 min, the comb was removed from the gel and put in the electrophoresis tank (MultiSUB Electrophoresis Systems, Biorad Power Pac Basic (Bio-Rad, Hercules, CA, USA). DNA ladder of 1 µL 6X Loading Dye and 5 µL ladder of 100 bp were added in the first and 8 µL PCR products were added in the remaining wells. The gel electrophoresis was run and set at 90 V and 90 A for 90 min. The gel was taken from the tray and visualized under a UV transilluminator (Platinum Q9, Uvitech Cambridge, Cambridge, UK).

2.8. Statistical Analysis

The data were entered into MS Excel 2016 and analyzed for descriptive statistics using STATA, version 12. The sample size was calculated by using the Daniel formula (1999). Accordingly, the sample size was calculated to be 138. The illustration for the calculation of sample size is shown below:

$$n={\displaystyle \frac{Z^{2}p \left(1-p\right)}{d^2}}$$

n = sample size

z = 1.96 is the Z statistic corresponding to a 95% confidence level

p = 0.10 is the expected prevalence based on a previous study [28]

d = 0.05 is the precision

Therefore, sample size (n) = 138 for this study.

The chi-square (χ²) test was used to determine statistical associations, including the comparison of Salmonella prevalence between sample types (meat and water), the association between sample type and the presence of antibiotic resistance genes, and the relationship between the presence of genes among the isolates. A p-value of less than 0.05 was considered statistically significant.

3. Results

3.1. Overall Prevalence of Salmonella

Of the total 216 samples cultured, 38 were positive for the presence of Salmonella, giving an overall prevalence of 17.59% (38/216). Out of the total samples, 29.62% (32/108) and 5.5% (06/108) were positive for meat and water samples, respectively (Figure 1). A chi-square test revealed a statistically significant association between sample type and Salmonella presence (χ² = 21.58, p < 0.001), indicating that meat samples were significantly more likely to be contaminated than water samples. Out of the 54 retail meat shops sampled, chicken meat samples from 24 shops (44.4%) tested positive for Salmonella, while water samples from 4 shops (7.4%) were positive.

3.2. Antibiotic Susceptibility Profile of Salmonella Isolates

The resistance profile of Salmonella isolates, grouped by antibiotic class, revealed the highest resistance to tetracyclines (TET), with 87% of isolates showing resistance and 6% intermediate susceptibility. This was followed by macrolides (MACs) and penicillin/beta-lactamase inhibitors (PEN/BLIs), with resistance rates of 79% and 76%, respectively. Cephalosporins (CEPHs) showed a moderate resistance level of 22%, with 8% intermediate. Aminoglycosides (AGs) exhibited 16.5% resistance and 13% intermediate susceptibility. Chloramphenicol (CHL) had 13% resistance but a high intermediate rate of 40%, suggesting possible emerging resistance. The lowest resistance was observed against fluoroquinolones (FQs), with only 4% resistance and 12% intermediate susceptibility (Figure 2).

3.3. ARPs in Salmonella Isolates

A total of seven ARPs were observed among the Salmonella isolates. Among the antibiotics, the most prevalent resistance pattern was A/S-DO-ER-T (21.05%, n = 8), followed by pattern A/S-DO-T and CTR-DO-ER-T (7.89%, n = 3) of the isolates (

Table 2. Antibiotic-resistant patterns (ARPs) in Salmonella isolates.

Number of Antibiotic-Resistant Pattern	Antibiotic-Resistant Pattern (ARP)	ARP Frequency
0	-	0
1	DO	1
2	DO-ER	1
	DO-GEN	1
3	A/S-DO-T	3
	A/S-ER-GEN	1
	A/S-ER-T	2
	CTR-ER-T	1
	A/S-DO-ER	1
4	A/S-DO-ER-T	8
	CTR-DO-ER-T	3
	A/S-DO-LE-T	2
	A/S-DO-GEN-T	1
	C-DO-ER-T	1
	DO-ER-GEN-T	1
5	A/S-DO-ER-L-T	1
	A/S-DO-ER-GEN-T	1
	A/S-CTR-DO-ER-T	1
	A/S-DO-ER-LE-T	1
6	AK-A/S-C-D0-ER-T	1
	AK-A/S-DO-ER-LE-T	1
	A/S-CTR-DO-ER-LE-T	1
	A/S-C-DO-ER-LE-T	1
7	AK-A/S-CTR-DO-ER-GEN-T	1
	A/S-C-CTR-DO-ER-GEN-T	1
	AK-A/S-C-DO-ER-GEN-LE	1

The antimicrobial resistance patterns were described using the following antibiotic abbreviations: AK (amikacin), A/S (ampicillin + sulbactam), C (chloramphenicol), CTR (ceftriaxone), DO (doxycycline), ER (erythromycin), GEN (gentamicin), LE (levofloxacin), and T (tetracycline).

).

3.4. PCR Detection of Antibiotic-Resistant Genes

Out of 42 isolates of Salmonella confirmed by biochemical tests, only 38 isolates were revived during culture on nutrient Agar and were subjected to the multiplex PCR technique for the detection of antibiotic resistance genes. tetB and ere(A) genes were detected in nine (23.68%) and seven (18.42%) isolates, respectively. However, mcr-1, catA1, and blaTEM genes were not detected (Figure 3 and Figure 4).

4. Discussion

The observed prevalence of Salmonella in this study aligns with findings reported in similar settings across various regions. The findings are similar to the overall prevalence of Xu et al. [29] (16.67%) in the years 2009–2016 in China. Salmonella was detected in 131 out of 942 chicken meat samples, yielding a prevalence of 13.91%. These samples were collected over five time periods (2009–2016) from both supermarkets and open markets in Guangxi, China. The annual prevalence in chicken varied across the study years, ranging from 11.68% to 19.21%, indicating moderate but persistent contamination in retail chicken meat. Comparable results were also reported by Waghamare et al. [30] with a 19.04% prevalence in retail meat shops in Mumbai, India, and by Garedew et al. [31] (17.3%) in chicken meat and environment samples of butcher shops in Gondar town, Ethiopia. The elevated prevalence in chicken meat may be attributed to the initial presence of Salmonella in birds at the farm level. When multiple animals are slaughtered or processed in the same retail or slaughterhouse setting, especially using shared tools, equipment, and surfaces, there is a significant risk of cross-contamination. This risk increases when hygienic practices are not strictly followed or when large numbers of animals are processed in succession without adequate cleaning and disinfection between batches. Such practices can facilitate the spread of pathogens like Salmonella from one carcass to another, compromising meat safety [32]. Additionally, contributing factors to the elevated contamination levels likely include the use of water during processing, along with poor hygiene practices during storage, handling, and transportation [33]. Salmonella is commonly found in aquatic environments, particularly in fecally contaminated drinking water. In many developing countries, such contaminated water sources are frequently used for washing and processing meat, including poultry carcasses [34]. When birds are sold by local farmers or commercial farms to retail outlets, the use of such water during slaughter and dressing can facilitate the transfer of Salmonella to the meat [35]. Additionally, in our study, some retail shops had live birds in close proximity to the processing area, further increasing the potential for cross-contamination during handling and processing.

The overall prevalence is lower than the findings of Bhandari et al. [36] (46.2%) in broiler chicken meat from retail meat shops in Chitwan; Nelson et al. [37] (79%) in Chitwan [23]; Elghany et al. [38] (34%) in Egypt; Yildirim et al. [39] (34%) in central Anatolia, Turkey; Fallah et al. [40] (44%) in Iran; White et al. [41] (35%) in Washington, DC. In the study in Sichuan Province, the overall prevalence of Salmonella was found to be 28.3% in the chicken market; no Salmonella was isolated from the samples of chickens from the farms and abattoirs [42]. The prevalence of 33.33% and 60% Salmonella was observed in chicken meat and water samples used for washing chicken, knives, tables, and hands from slaughter places, respectively, in the local retail markets in Tamil Nādu, India [43]. The prevalence of Salmonella was found to be 60% in the water samples used for dressing in Bangladesh [44].

This is higher than the findings of Maharjan et al. [2] (11.4%) in Kathmandu Valley; Dhakal et al. [28] (10%) in Pokhara Valley, Nepal; and Thapa et al. [45] (10%) in Bharatpur, Chitwan. This apparent increase over time in Chitwan may be attributed to several factors. Chitwan, being the poultry hub of Nepal, has undergone significant intensification in poultry farming, which may elevate contamination risks if biosecurity practices are not equally strengthened [46]. Additionally, poor water quality, misuse of antibiotics, and the common practice of self-prescription by farmers without proper veterinary oversight may further contribute to higher Salmonella prevalence. The prevalence of Salmonella was found to be 8.57% in water samples used for rinsing in Northern India [47]. The difference in the prevalence of Salmonella in chicken meat and water samples might be due to several factors, like differences in the origin of the samples [48], the collection process or procedure, and processing, the contamination level of meat, and the husbandry and management practices of poultry [49] and the meat shops, slaughterhouse hygiene, cross-contamination of products at different levels of chicken dressing, and the methods and procedures applied to isolate and identify the bacteria [50]. The chicken meat available at the retail shops comes through a long chain of production, transportation, and slaughtering, where each step of the process may risk microbial or bacterial contamination [51]. The sanitary conditions of meat shops, abattoirs, and their surrounding environment, and the water used during processing are the major factors that contribute to the bacterial contamination of meat [32]. Meat is the most perishable of all important foods since it contains sufficient nutrients needed to support the growth of bacteria [52], so infected birds at the farm level or contaminated meats, mainly from avian species, may contribute to more prevalence of Salmonella in chicken meat at retail meat shops.

The antibiogram profile showed maximum resistance to doxycycline (88%), followed by tetracycline (86%), erythromycin (79%), ceftriaxone (22%), levofloxacin (21%), gentamicin (18%), and amikacin (15%). As expected, resistance to erythromycin, tetracycline, and doxycycline was almost universal, and high resistance rates were evident for most of the antimicrobials tested, which is consistent with the literature. The sensitivity and resistance pattern of this study was quite similar to the study of abd-Elghany et al. [38] who found higher resistance to erythromycin (100%), tetracycline (89.2%), and ampicillin (91%) in Egypt; Yildirim et al. [39] found erythromycin (89.7%) and tetracycline (67.6%); Cardoso et al. [53] found erythromycin and tetracycline (100%) in Brazil; Fallah et al. [40] found tetracycline (100%); Naik et al. [54] found erythromycin (100%) and tetracycline (42%); Sharma et al. [47] found erythromycin and tetracycline (100%), ampicillin (95.71%), and third generation cephalosporins (51.43%) in northern India.

In this study, a small percentage of Salmonella spp. isolates demonstrated resistance to gentamicin (18%), chloramphenicol (13%), levofloxacin (21%), and amikacin (15%), which is similar to the findings of Yildirim et al. [39] who found resistance to gentamicin (14.7%), chloramphenicol (10.2%), and amikacin (2.9%); Cardoso et al. [53] in Brazil did not find any Salmonella isolates resistant to gentamicin and levofloxacin. The MDR in Salmonella is very high [55], which indicates an enormous challenge to the treatment of Salmonella infections in humans and animals. Antimicrobial resistance is driven by the high incidence of bacterial diseases, inappropriate use of antibiotics in treatment, and use of antibiotics as growth promoters in foods of animal origin. The higher sensitivity of amikacin and ceftriaxone in this study might be due to the low use and availability in the field or farm conditions [56] in the meat-producing broiler birds. They are not easily available in water-soluble or oral form on the market. The differences in the incidence of resistance among Salmonella isolates are mainly attributed to the exchange of resistance genes [57] efficiently among bacterial populations, and even passed to mammalian cells and a limited extent, by management conditions of farms. In this study, tetB and ere(A) genes were detected in 23.68% (9/38) and 18.42% (7/38) isolates, respectively. However, mcr-1, catA1, and blaTEM genes were not detected in PCR. The result of this study was in contrast with Sharma et al. [47] in northern India, who found the prevalence of blaTEM (25.37%), tetA (100%), and tetB (0%); Xu et al. [29] found tetB (15.66%, 8.11%, 18.67%), catA1 (6.63%, 0%, 0%), and blaTEM (0%, 45%, 53.01%) in the years 2010–2012, 2014–2015, and 2015–2016, respectively, in southern China.

Our study highlights the potential role of local processing practices—such as the reuse of water and shared equipment—in contributing to Salmonella contamination. Although direct observation data were not collected, field visits suggested poor hygiene practices in many retail shops. Moreover, while national-level antimicrobial usage (AMU) data in Nepal are limited, studies and reports indicate unregulated antibiotic use in poultry production, often without veterinary oversight. This may explain the presence of resistance genes and supports the need for stricter quarantine procedures for the meat before it goes into the markets, and maintaining hygiene during slaughter and processing, enforcing HACCP systems rigorously [44], and regulating AMU in the poultry sector, and improving consumer awareness of food safety. Food safety has become a major public concern and addressing this issue is both urgent and essential. Salmonella contamination is most likely to occur during essential processing steps, including pre-slaughter procedures, defeathering, and evisceration [58].

5. Conclusions

This study explored the prevalence and antimicrobial resistance of Salmonella isolated from chicken meat and water samples collected from retail shops. The findings reveal significant levels of antimicrobial resistance, including the presence of multidrug-resistant strains, implying inadequate hygiene and antibiotic usage practices across the poultry production system. Antibiotic susceptibility testing showed widespread multidrug resistance, particularly to tetracyclines and macrolides. The detection of resistance genes tetB and ere(A) provides insights into the presence of genetic factors related to resistance. However, future studies should further explore the relationship between phenotypic and genotypic resistance to understand the underlying mechanisms.