Next Article in Journal / Special Issue
Improving Cognitive and Chemosensory Function in Caenorhabditis elegans Through Polyphenol-Rich Sugarcane Extract
Previous Article in Journal / Special Issue
Canine and Human Red Blood Cells: Biochemical Mechanisms for the Control of Heat Dissipation
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Stresses
Volume 4
Issue 4
10.3390/stresses4040053
stresses-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Nebivolol Exerts Hepatoprotective Activity During CLP-Induced Sepsis by Modulating Oxidative Stress, Liver Regeneration, and AKT/MAPK Pathways in Rats

by
Rahma Tharwat Sabra
1,
Amany Abdlrehim Bekhit
1,
Nourhan Tharwat Sabra
2,
Nadia Ahmed Abd El-Moeze
3 and
Moustafa Fathy
1,*
1
Department of Biochemistry, Faculty of Pharmacy, Minia University, Minia 61519, Egypt
2
Department of Anatomy and Embryology, Faculty of Medicine, Beni-Suef University, Beni-Suef 62514, Egypt
3
Department of Pathology, Faculty of Medicine, Beni-Suef University, Beni-Suef 62514, Egypt
*
Author to whom correspondence should be addressed.
Stresses 2024, 4(4), 800-815; https://doi.org/10.3390/stresses4040053
Submission received: 26 October 2024 / Revised: 21 November 2024 / Accepted: 28 November 2024 / Published: 2 December 2024
(This article belongs to the Collection Feature Papers in Human and Animal Stresses)
Browse Figures
Versions Notes

Abstract

:
Sepsis is a potentially catastrophic organ dysfunction arising from an infection-induced immunologic reaction leading to severe inflammation, progression of septic shock, and damage to body organs. Sepsis is marked by noticeable hepatotoxicity caused by activating oxidative stress, inflammation, and apoptotic mechanisms. Through Cecal Ligation and Puncture (CLP) in rats, our study is the first to investigate the potential preventive effect of the antihypertensive medicine “Nebivolol” on sepsis-induced hepatotoxicity at a molecular level. Six groups of sixty albino Wistar rats (male) were randomly assigned. Biochemical and oxidative stress markers of liver function were measured. Additionally, apoptosis- and inflammatory-related gene and protein expressions were examined. Finally, the liver tissues were examined for histological assessments. The hepatic architecture was considerably altered by CLP, which also resulted in marked elevations of blood aspartate aminotransferase (AST), alanine transaminase (ALT), alkaline phosphatase (ALP), total and direct bilirubin levels, and hepatic malondialdehyde (MDA). In contrast, it decreased serum albumin level, hepatic superoxide dismutase (SOD) activity, and glutathione (GSH) level. It also significantly elevated all hepatic inflammatory mediators (Interlukin-6 (IL-6), Tumor Necrosis Factor-alpha (TNF-α), and Interlukin-1 beta (IL-1β)) and alleviated Interlukin-10 (IL-10). It magnified the expression of p-AKT/t-AKT, p-JNK1/2/t-JNK1/2, and p-p38/t-p38 proteins, raised Matrix Metalloproteinase 2/9 (MMP 2/9) and nuclear factor-kappa B (NF-κB) gene transcriptions, and lessened Vascular Endothelial Growth Factor (VEGF) gene expression. In contrast, Nebivolol administration dramatically mitigated all biochemical and histological changes obtained by CLP. The present finding demonstrated that Nebivolol succeeded, for the first time, in improving the hepatic injury obtained from CLP-evoked sepsis through modulating oxidative stress, inflammatory mediators, and apoptotic pathways through targeting the crosstalk between protein kinase B (AKT), NF-κB, and mitogen-activated protein kinase (MAPK), making Nebivolol a hopeful treatment for hepatic injury.

Graphical Abstract

1. Introduction

Sepsis is an inflammatory storm induced by an immune reaction that attacks infection, trauma, or toxins, leading to multiple organ dysfunction [1]. Professionals dealing with septic patients frequently order intensive care support to preserve the deterioration of organ systems, including the lungs, heart, liver, and kidneys. Septic patients account for about 30% of intensive care unit (ICU) admittance, according to the patient population [2,3]. Whatever the cause, infection leading to sepsis remains a main ICU problem that has a primary mortality rate of about 38% [3]. Although the biology and etiology of sepsis remain vague, they are anticipated to involve a complex interplay between apoptotic pathways and inflammatory mediators [4]. A more profound comprehension of these mechanisms should offer a crucial basis for creating innovative treatments.
The liver organ is vital in the immunological balance, as it is essential for bacterial clearance and survival after critical damage caused by several diseases, including sepsis. Evidence has shown that liver malfunction, an early sepsis sign, positively contributed to the development of illness, bad prognosis, and passing away, with a rate of approximately 54–68% [5,6]. Liver dysfunction has a lower incidence rate than in other organs (kidney, lungs, neurons, and heart) due to the excessive regeneration power of the liver to injury. This power was lost in septic patients with liver failure, putting liver failure driven by sepsis as one of the primary triggers for sepsis death [7,8,9,10,11].
Sepsis pathogenesis remains unclear, but it likely triggers reactive oxygen species (ROS), secreted by endothelial cells and neutrophils, which can indiscriminately damage tumors or normal cells [12]. Excessive ROS generation triggers oxidative stress, immunosuppression, inflammation, and apoptotic pathways, along with depleting the body’s natural anti-oxidant system [12]. Moreover, interleukin-10 (IL-10) has been documented to have a critical and complex function in sepsis pathophysiology, as reduced IL-10 level was correlated with sepsis death, suggesting that it amplifies the harmful consequences of inflammatory cytokines [13,14,15,16,17]. Furthermore, sepsis-induced liver injury may be implicated in intercalating between the phosphatidylinositol 3-kinase (PI3K)/protein kinase B (AKT) and mitogen-activated protein kinase (MAPK) pathways through the induction of the activities of several mediators involved in apoptosis and inflammation [18,19,20]. Although the precise impact of PI3K/AKT on liver injury is still unclear, it is well-recognized that nuclear factor-kappa B (NF-κB), a downstream protein for PI3K/AKT, regulates the expression of several genes connected to inflammation and the innate immunological reaction [21,22,23]. Furthermore, it assists in stimulating c-Jun N-terminal kinase (JNK) and p38 MAPK, which are crucial participants for MAPKs [23,24]. All this highlights the importance of AKT/NF-κB/MAPK activities as prime targets to prevent hepatotoxicity following sepsis.
Drug repurposing and searching for novel pharmacological activities for natural phytochemicals [22] or synthetic ones [25] have attracted significant interest [26,27]. A recently developed third-generation β1-adrenergic receptor-blocking drug, Nebivolol, has a vasodilating effect on animals and humans. This vasodilating effect is mediated through nitric oxide (NO) production, making Nebivolol a good treatment for atrial hypertension and coronary heart disease [28,29,30]. It is also known for having anti-oxidant and anti-inflammatory effects by preventing superoxide formation and scavenging oxidative stress [31,32,33].
Given the lack of studies, Nebivolol’s hepatotoxicity-fighting properties against Cecal Ligation and Puncture (CLP)-evoked sepsis appear dubious. So, the goal of this project is to investigate the hepatoprotective power of Nebivolol toward CLP-stimulated rats’ hepatotoxicity for the first time and to determine the probable underlying mechanisms of action by inspecting signaling cascades that might be involved in these outcomes.

2. Results

2.1. Nebivolol Impact on Serum ALT, AST, ALP, Albumin, and Total and Direct Bilirubin Levels

In the current study, CLP surgery-stimulated hepatic damage was confirmed by a substantial decrease in albumin levels and a considerable spike in all alanine transaminase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP), and total and direct bilirubin levels contrasted with the sham. Relative to the CLP rats, the influence of hepatocellular injury was reversed in all treated groups, whether with Nebivolol at different doses or vitamin C therapy, as shown in Figure 1.

2.2. Nebivolol Impact on Hepatic Oxidative Stress (MDA, SOD, and GSH) Markers

Initiation of sepsis through a CLP operation leads to a considerable rise in the liver malondialdehyde (MDA) content. Whereas there was an extreme drop in hepatic superoxide dismutase (SOD) activity and glutathione (GSH) level when matched to the sham group, as shown in Figure 2. Conversely, compared to the CLP rats, the liver tissues of treated rats (Neb 4, Neb 10, or Vit C) displayed significantly boosted concentrations of GSH and SOD activity and a substantial decline in MDA concentration.

2.3. Nebivolol Impact on Amounts of Hepatic TNF-a, IL-1b, IL-6, and IL-10

Following the CLP operation, the hepatic tissues showed dramatically boosted levels of inflammatory mediators Tumor Necrosis Factor-alpha (TNF-α), Interlukin-1 beta (IL-1β), and Interlukin-6 (IL-6) and obviously lower levels of the anti-inflammatory marker IL-10 comparable to the sham rats. However, regardless of the dosage, all cytokine levels in hepatic tissue homogenates were markedly restored in the treated rats, even with Nebivolol or vitamin C, relative to the CLP rats, as demonstrated in Figure 3.

2.4. Nebivolol Impact on MMP2/9, VEGF, and NF-κB Gene Levels

Using qRT-PCR, we assessed Nebivolol’s repressing outcome on the inflammatory inducers (Matrix Metalloproteinase2/9 (MMP2/9) and NF-κB) and its stimulating effect on the regenerative marker (Vascular Endothelial Growth Factor (VEGF)) in hepatic tissues (Figure 4). MMP-2, MMP-9, and NF-κB mRNA expression levels were extensively superior in CLP rats than in the sham ones. On the contrary, VEGF was significantly diminished. Significant overexpression of the VEGF gene was observed in CLP-treated rats even with vitamin C or Nebivolol (4/10 mg/kg), which indicates an increase in liver regeneration, with a considerable downregulation of MMP2/9 and NF-κB gene expressions in contrast to the CLP group.

2.5. Nebivolol Impact on p-AKT, p-p38, and p-JNK1/2 Expressions in the Liver

Western blot data revealed that Nebivolol might block the AKT and MAPK pathways. Rats with CLP toxicity had notably higher levels of p-AKT/t-AKT, p-JNK1/2/t-JNK1/2, and p-p38/t-p38 protein expression in their liver tissues when put in comparison with the sham group. Quite the opposite, as illustrated in Figure 5, was the case of all targeted protein expressions in the treated groups, which were substantially less than those of CLP rats.

2.6. Nebivolol Impact on Hepatic Histopathological Changes

Hepatic specimens were examined to determine the extent of centrilobular hepatocyte necrosis, hepatocyte (ballooning) atrophy, and infiltration of inflammatory cells (Figure 6 and Table 1). The CLP group showed significantly more ballooning degeneration, hepatocyte necrosis, and infiltration of inflammatory cells than the sham rats.
Regarding the CLP group, treatment with Neb 4 reduced the infiltration of inflammatory cells, ballooning collapse, and hepatocellular necrosis. It also displayed sinusoidal congestion with little periportal inflammatory cell infiltration and moderate necrosis, central vein, and centrilobular deterioration. In contrast, the group with CLP/Neb 10 showed no necrosis or inflammation and limited centrilobular hepatocyte loss and ballooning.
Sections examined from liver tissue with CLP/vitamin C revealed minimal to mild lymphoplasmacytic inflammatory infiltrates mainly affecting portal tracts.

3. Discussion

Sepsis is a group of systemic reactions in reply to intensive and immense infection that fails to be locally controlled by the host. Sepsis affects a wide range of patients with chronic diseases or immuno-compromised ones. It is connected to being among the top ten reasons for death in ICUs in the United States [3,9]. CLP-evoked sepsis is a model where sepsis is caused by polymicrobial infection, leading to lowering blood flow to body organs and resulting in multiorgan dysfunction [25,34]. This model matches the human condition that is clinically relevant. Because of the complicated pathophysiology of sepsis, discovering novel drugs and strategies for controlling sepsis is a challenge for medical researchers. The liver is necessary for balancing immunity and metabolism in the body. Also, it plays a vital role in host survival against pathogens [5,6]. Liver failure is an early sign of sepsis and is believed to contribute to poor outcomes and poor prognosis [10].
The pathophysiology of the harmful effect of sepsis on the liver involves several pathways, including the accumulation of oxidative stress, inflammation, and immunity deterioration [35]. During sepsis, numerous pro-inflammatory and pro-apoptotic signaling networks are activated more strongly by ROS, including the activation of mitogen-activated protein kinase (TAK1), which in turn leads to stimulation of several intrinsic apoptotic pathways, such as PI3k/AKT, IκB/NF-κB, and MAPK family members (p38 MAPK and JNK1/2). The connection between these signals forms a complex signaling network comprising the NF-κB transcription factor that controls the inflammatory and apoptosis reaction through the generation of cytokines and chemokines [25,35,36,37,38,39]. By targeting these pathways, therapeutic interventions may be developed to control sepsis and improve patient outcomes.
Many natural and synthetic anti-oxidants are used in many trials to ameliorate CLP-induced hepatic injury [25,40,41]. Nebivolol, an antihypertensive drug, has been established to protect against ovarian, endoplasmic reticulum, heart, and spinal toxicity [42,43,44,45]. Recently, a potential effort has been made to investigate additional medicinal properties for novel or previously existing candidates [22,46,47]. With the evaluation of the oxidative stressinflammatory mediators, AKT/NF-κB, MAPK, and apoptotic cascades, these discoveries are the first to identify the molecular foundation that revealed the preserving impact of Nebivolol against CLP-evoked hepatotoxicity.
In our investigation, CLP-induced sepsis developed a substantial elevation in serum concentrations of ALT, AST, ALP, and total and direct bilirubin and a marked reduction in albumin level, which are interpreted as the leading indicators of hepatocyte destruction, and this is confirmed by histological examination that shows remarkable damage in hepatic architecture. According to what was reported by Koskinas et al. [48], patients with hepatotoxicity induced by sepsis have increased levels of liver function tests linked to portal inflammation and hepatocellular damage.
Fascinatingly, co-administration of Nebivolol with CLP-operated rats extensively improved all liver parameters with better liver histological adjustments, indicating its ability to preserve the hepatic membrane’s functional integrity. This prospect is believed to happen because of the anti-oxidant effect of Nebivolol and its scavenging activity on free radicals [31,32,33].
The liver is essential for eliminating ROS, usually produced through metabolism by different mechanisms within the anti-oxidant system [49,50]. After CLP surgery, ROS is created. These molecules induce extensive production in oxidative stress, which is a crucial factor in developing hepatotoxicity [40,51,52,53]. The initial phase of sepsis, the hyperdynamic phase, produces a massive amount of pro-inflammatory cytokines by macrophages and neutrophils. Also, it induces metabolic changes culminating in liver apoptosis, failure, and immunodepletion [54,55,56]. ROS-induced oxidative stress generates MDA, which is generated from lipid peroxidation. It drops the hepatic amount of GSH and the activity of the liver SOD [40,51,57]. Because of the harm that ROS and oxidative stress can induce, we discovered the importance of the anti-oxidant defense system in saving the body cells from harmful damage induced by inflammation [58].
In this current study, different doses of Nebivolol showed anti-oxidant activity, as they were able to improve the hepatic tissue damage obtained from oxidative stress by normalizing the concentrations of ALT, AST, ALP, albumin, and total and direct bilirubin in serum. Also, they strengthen the anti-oxidant defense system through the inhibition of MDA levels, parallel to improving the SOD activity and GSH level in hepatic tissue.
The anti-inflammatory defense mechanism involved in IL-10 is essential in inhibiting TNF receptors’ expression on neutrophils and TNF production, which is vital for pro-inflammatory cytokines production, including TNF-α, IL-6, and IL-1β [59]. Inflammatory cytokines and oxidative stress are parallel, motivating an imbalanced immune response and irreversible damage even by necrotic or apoptotic mechanisms [60,61,62,63,64]. It has been stated that the depletion of the anti-inflammatory defense mechanism and exaggerated inflammatory reactions typically occur together in sepsis [13,14,15,16,17]. That elucidates the reason behind the elevated levels of inflammatory cytokines, like TNF-α, IL-6, and IL-1β in this study, and reduction in IL-10 (the anti-inflammatory ones) in the tissues of liver subsequent CLP surgery, as inducing a state of inflammation and immunosuppression in sepsis [17,65]. Consequently, the anti-inflammatory mechanism of Nebivolol should be cleared as it significantly downregulated the protein levels of TNF-α, IL-6, and IL-1β, while it upregulated the level of IL-10, supposed to be the mechanism underlying Nebivolol’s ability to protect the liver from CLP-induced hepatotoxicity.
CLP-induced ROS stimulates various downstream pathways that promote apoptosis in the liver, particularly PI3K/AKT, MAPK family members, and the redox transcriptional factor (NF-κB) [38,66,67,68,69,70]. The MAPK family members, which include serine/threonine kinase proteins, JNK, and p38, together with the AKT and inflammatory transcriptional NF-κB factor, are linked to cell differentiation, growth, and survival; on the other hand, they also participate in generating inflammatory storm, apoptosis, and cell death [71,72,73,74,75]. This work detected exaggeration in AKT, JNK1/2, and p38 phosphorylation in the hepatic tissue of CLP rats. Additionally, activation of the transcriptional NF-κB factor led to a rise in the secretion of MMPs that contribute to inflammation and extracellular matrix (ECM) remodeling in profibrogenic and pro-inflammatory proteins in the liver [22,76,77,78,79,80,81,82,83]. Furthermore, overactivation of MMPs, especially MMP9, proteolytically breaks down VEGF, inhibiting bone marrow sproc recruitment and liver regeneration and thereby exaggerating liver damage [84,85,86]. These findings implied that AKT/NF-κB and MAPK signaling cascades are implicated in initiating CLP-induced hepatotoxicity. Therefore, targeting AKT, MAPK, and/or NF-κB could be a prospective way to find new therapeutic agents for controlling sepsis-induced hepatotoxicity.
All these elevated levels were found to be inhibited by Nebivolol treatment. These findings corroborate earlier research showing that Nebivolol inhibits phosphorylation of AKT, JNK1/2, p38, and NF-κB proteins and the elevated levels of MMP2/9 in the renal ischemia–reperfusion injury model [87,88], cyclophosphamide-induced nephrotoxicity [89], vascular endothelial insulin resistance [42], and in vitro study [90]. Therefore, the hepatoprotective influence of Nebivolol is mediated by controlling the inflammatory signaling pathways AKT, MAPK, and NF-κB while promoting liver regeneration through upregulation of VEGF by inhibiting the production of MMP-9.
The recent research is the first to verify Nebivolol’s hepatoprotective impact, clarifying the molecular mechanism underlying it. That could indicate a unique therapeutic strategy for lessening hepatotoxicity caused by sepsis.

4. Materials and Methods

4.1. Drugs and Chemicals

Marcyrl Pharmaceutical Industries in Egypt supplied Nebivolol hydrochloride, which was freshly prepared in distilled water with 1% tween 80. The vitamin C was freshly dissolved in regular saline after being purchased from Epico Pharmaceutical Institute in Egypt. Block ACE (KAC Co., Ltd., Tokyo, Japan). Direct-ZolTM RNA Miniprep plus kit (ZYMO research Corp., USA, #R2072). ReadyPrepTM protein extraction kit (Bio-Rad Inc., Hercules, CA, USA, #163-2086). Bradford protein assay kit (Bio Basic Inc., Markham, ON, Canada, #SK3041). The remaining commercially available chemicals utilized were the best analytical operation corporations supplied.

4.2. Experimental Model

The CLP technique was used to produce sepsis, as previously reported [91]. In brief, an intraperitoneal combination of ketamine and xylazine in a dose of 80 mg/kg and 10 mg/kg, respectively, was injected to anesthetize rats [92]. The abdominal wall of rats was snipped off and wiped with 10% of the povidone–iodine solution. A surgical opening was established in the abdomen’s bottom-left quadrant. After cecum externalization, it was ligated regularly at 75% of its length using a 0.3-mm silk medical suture. By applying an 18-gauge insertion needle, two through-and-through perforations were made to the ligated portion. After returning the cecum to the abdominal cavity, the skin was sutured, and the rat was resuscitated with a subcutaneous injection of 1 mL pre-warmed saline and placed in a heating pad until they recovered from anesthesia. The identical manipulations, excluding CLP, were administered to rats that received the sham operation.

4.3. Animals

The National Research Center in Giza, Egypt, supplied sixty male Wistar rats (seven weeks old) weighing between 180 and 200 g. The rats were raised in an animal room (temperature-controlled and free from pathogens) and given unlimited access to standard laboratory water and food seven days before the trial began, giving them time to become used to the laboratory atmosphere. The trial was authorized and executed in compliance with the standard operating procedures of the Implementing Regulations of the Law of Ethics of Research on Living Creatures in Egypt (Minia University project code: MPEC (2301202).

4.4. Experimental Design

After accommodation, this experiment was divided into six groups of ten rats, each assigned as shown in Figure 7.
Sham (Group I): rats had a single i.p. dosage of distilled water with 1% tween 80 and a single i.p. dosage of standard saline. The CLP operation was carried out without CLP after one hour [93].
Nebivolol 10 (Group II): rats had a single i.p. dosage of Nebivolol (10 mg/kg) [93,94].
CLP (Group III): rats had a single i.p. dosage of standard saline one hour prior to CLP surgery.
CLP + Nebivolol 4 (Group IV): rats had a single i.p. dosage of Nebivolol (4 mg/kg) one hour prior to CLP surgery [44,93,95,96].
CLP + Nebivolol 10 (Group V): rats had a single i.p. dosage of Nebivolol (10 mg/kg) one hour prior to CLP surgery [42,93,94,96,97].
CLP + Vitamin C (Group VI) (Positive control): rats had a single i.p. dosage of Vitamin C (200 mg/kg) one hour after CLP operation [93,98].

4.5. Sample Collection

24 h after the CLP operation, rats were put to sleep with urethane and decapitated. Blood specimens were drawn from neck vessels, and centrifugation was used to separate the serum to detect the concentrations of albumin, ALP, ALT, AST, direct, and total bilirubin. Liver organs were detached, cleaned, then dried with cold saline, followed by filter paper, and separated into four pieces. One portion was immediately placed in 10% formaldehyde for histological analysis. The other portion was used to quantify the liver’s oxidative stress indicators by homogenization in cold 1 × PBS (pH 7.4). The supernatants were obtained by centrifuging the homogenates. The third section was used for western blotting and ELISA analysis, while the last fraction was utilized for quantitative RT-PCR.

4.6. Assessment of Serum Liver Biomarkers

Through employing commercially accessible kits given by a Biodiagnostic company in Egypt with catalog numbers (#230203, #230105, #230303, #230220, #230106), ALT, AST, albumin, ALP, and total and direct bilirubin serum levels were calculated. Each measurement was performed carefully, complying with the kit’s recommendations.

4.7. Evaluation of Hepatic Oxidative Stress

Liver specimens were homogenized with 1 × PBS (0.05 M, pH 7.4) at a PBS-to-tissue weight ratio of five to one. The homogenates underwent a 10-min, 16,000× g centrifugation at four °C. For the biochemical investigation, supernatant was utilized.
Superoxide dismutase (SOD) efficiency, reduced glutathione (GSH), and malondialdehyde (MDA) concentrations were tested following the instructions of manufacture by commercial kits obtained from a Biodiagnostic company (Giza, Egypt) (#MD 1304, #SD 1019, #GR 0604), respectively.

4.8. Evaluation of Hepatic Cytokines Levels

The hepatic tissue cytokines IL-6, TNF-α, IL-1β and IL-10 were evaluated using an IL-6 ELISA kit (Cloud-Clone Corp., Houston, TX, USA, #SEA079Ra), TNF-α ELISA kit (BioLegend, USA, #438206), IL-1β ELISA kit (Bioassay Technology Laboratory, UK, #E0119Ra), and IL-10 ELISA kit (Cloud-Clone Corp., Houston, TX, USA, #SEA056Ra) following the supplier’s guidance. Through employing the ELISA Statfax 2200 plate reader (Awareness Technologies, Palm City, FL, USA), color absorbances were measured at an optical density range of 490–630 nm.

4.9. Gene Expression Estimation

As instructed by the manufacturer, hepatic tissues were treated with a Direct-zolTM RNA Miniprep Plus kit to extract total RNA. The purity of the collected RNA was evaluated by a Beckman DU-640 spectrophotometer (USA). The SuperScript IV One-Step RT-PCR kit (Thermo Fisher Scientific, Waltham, MA, USA, #12594100) was operated to run quantitative PCR with equal amounts of total RNA. The kit permits the development of c-DNA and amplification for PCR in one tube on Step One Real-Time PCR equipment (Applied Biosystems, Waltham, MA, USA). The program of amplification included one cycle of reverse transcription for 10 min at 55 °C, one cycle of reverse transcription enzyme inactivation for 2 min at 95 °C, and forty cycles of denaturing phase for 10 s at 95 °C, annealing for 10 s at 55 °C, extension for 30 s at 72 °C, and a last stage one cycle for final extension for 5 min at 72 °C. Melt curve analysis was utilized to assess the specificity of the amplification. Target genes’ cycle threshold (Ct) values were compared to the endogenous housekeeping gene β-actin. Operating the 2−∆∆Ct process, fold changes were computed by splitting each sample’s expression by the sham sample.
The primer sequences and accession numbers for VEGF, MMP-2, MMP-9, NF-κB, and β-actin genes are presented in Table 2.

4.10. Western Blot Measurement

Using the ReadyPrepTM protein extraction kit, total protein was isolated from hundred mg liver samples in accordance with the manufacturing protocol. A Bradford protein assay kit was used to ascertain each sample’s total protein concentration under supplier instructions.
Twenty μg protein of liver homogenate samples were solved using 12.5% SDS-polyacrylamide gel electrophoresis. After that, they were applied to a PVDF membrane. Block ACE was placed on membranes at room temperature for four hours. Following that, the membranes were treated overnight at four °C with these primary antibodies: total AKT (Cell Signaling Technology, Danvers, MA, USA, #9272), p-AKT (Santa Cruz Biotechnology Inc., Dallas, TX, USA, #SC-293125), total JNK (Santa Cruz Biotechnology Inc., USA, #SC-137019), p-JNK (R&D systems Bio-Techne, Minneapolis, MN, USA, #AF1205), total p38 (Cell Signaling Technology, USA, #9212), p-p38 (Cell Signaling Technology, USA, #9211), and β-actin (Santa Cruz Biotechnology, USA, #F18190). The conjugated horseradish peroxidase with secondary antibody was employed to identify the 1ry ones. The clarity TM western ECL kit (Bio-Rad Inc., USA, #170-5060) was applied to visualize the outcomes. The target proteins’ quantity was identified by ChemiDoc MP imaging system software (Bio-Rad Inc., USA) following normalization against β-actin bands (Housekeeping protein). A 1:1000 dilution of the primary and secondary antibodies was performed in 5% BSA in PBST.

4.11. Histopathology of the Liver

The liver tissue of each rat was embedded in 10% formaldehyde and treated to create paraffin blocks. As previously instructed, liver slices were deparaffinized using xylene and dyed with hematoxylin and eosin (H&E) stain [99]. The liver sections were inspected via a Leica APERIO LV1 microscope for evaluation. Histological changes were scored from 0: normal, 1: slight injury (less than 10% of hepatocytes in centrilobular area), 2: moderate injury (from 10–50% of hepatocytes in centrilobular area), and 3: severe injury (more than 50% of hepatocytes in centrilobular area) based on the degree of centrilobular hepatocyte ballooning and degeneration, centrilobular hepatocyte necrosis, and the exitance of inflammatory cell infiltration [100]. The overall histology score was calculated by adding scores for all parameters.

4.12. Statistical Analysis

In order to analyze the data, GraphPad Prism® version 9 (GraphPad Software Inc., San Diago, CA, USA) was used. The study’s findings were reported as mean ± SEM. A post hoc Tukey test following one-way ANOVA was employed to determine the significance of group variances. In cases where the probability (p) values were smaller than 0.05, the significance levels were confirmed.

5. Conclusions

Our finding proved for the first time that the treatment with Nebivolol may provide promising hepatoprotective benefits against CLP-evoked sepsis through suppressing the parameters of oxidative stress, inflammation, apoptosis, and AKT/NF-κB/MAPK signaling cascades, recommending this drug as a new strategy with high therapeutic potential to lower the possibility of sepsis following abdominal surgery. However, extra pre-clinical and clinical examination is necessary to evaluate the safety and effectiveness outcomes, increase the knowledge of other possible mechanisms of action, and assess its activity against other organ failures induced by sepsis.

Author Contributions

Methodology, R.T.S., N.T.S. and N.A.A.E.-M.; formal analysis, R.T.S. and N.T.S.; investigation and resources, R.T.S. and M.F.; software and validation, A.A.B. and M.F.; project administration, R.T.S. and M.F.; writing—original draft preparation, R.T.S., N.T.S. and N.A.A.E.-M.; conceptualization and writing—review and editing, R.T.S. and M.F.; supervision and visualization, M.F. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

The study was conducted in accordance with ARRIVE guidelines and executed in compliance with the Care and Use of Laboratory Animals standard operating procedures approved by the Research Ethics Committee, Minia University (Project code: MPEC (2301202)).

Data Availability Statement

All data are fully available and included within the manuscript.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Singer, M.; Deutschman, C.S.; Seymour, C.W.; Shankar-Hari, M.; Annane, D.; Bauer, M.; Bellomo, R.; Bernard, G.R.; Chiche, J.-D.; Coopersmith, C.M. The third international consensus definitions for sepsis and septic shock (Sepsis-3). JAMA 2016, 315, 801–810. [Google Scholar] [CrossRef] [PubMed]
  2. Bennett, S.R. Sepsis in the intensive care unit. Surgery 2015, 33, 565–571. [Google Scholar] [CrossRef] [PubMed]
  3. Martin, C.M.; Priestap, F.; Fisher, H.; Fowler, R.A.; Heyland, D.K.; Keenan, S.P.; Longo, C.J.; Morrison, T.; Bentley, D.; Antman, N.; et al. A prospective, observational registry of patients with severe sepsis: The Canadian Sepsis Treatment and Response Registry*. Crit. Care Med. 2009, 37, 81–88. [Google Scholar] [CrossRef] [PubMed]
  4. Cao, C.; Yu, M.; Chai, Y. Pathological alteration and therapeutic implications of sepsis-induced immune cell apoptosis. Cell Death Dis. 2019, 10, 782. [Google Scholar] [CrossRef]
  5. Canabal, J.M.; Kramer, D.J. Management of sepsis in patients with liver failure. Curr. Opin. Crit. Care 2008, 14, 189–197. [Google Scholar] [CrossRef]
  6. Kramer, L.; Jordan, B.; Druml, W.; Bauer, P.; Metnitz, P.G. Incidence and prognosis of early hepatic dysfunction in critically ill patients--a prospective multicenter study. Crit. Care Med. 2007, 35, 1099–1104. [Google Scholar] [CrossRef]
  7. Cheng, B.; Xie, G.; Yao, S.; Wu, X.; Guo, Q.; Gu, M.; Fang, Q.; Xu, Q.; Wang, D.; Jin, Y.; et al. Epidemiology of severe sepsis in critically ill surgical patients in ten university hospitals in China. Crit. Care Med. 2007, 35, 2538–2546. [Google Scholar] [CrossRef]
  8. Brun-Buisson, C.; Meshaka, P.; Pinton, P.; Vallet, B. EPISEPSIS: A reappraisal of the epidemiology and outcome of severe sepsis in French intensive care units. Intensive Care Med. 2004, 30, 580–588. [Google Scholar] [CrossRef]
  9. Angus, D.C.; Linde-Zwirble, W.T.; Lidicker, J.; Clermont, G.; Carcillo, J.; Pinsky, M.R. Epidemiology of severe sepsis in the United States: Analysis of incidence, outcome, and associated costs of care. Crit. Care Med. 2001, 29, 1303–1310. [Google Scholar] [CrossRef]
  10. Beyer, D.; Hoff, J.; Sommerfeld, O.; Zipprich, A.; Gaßler, N.; Press, A.T. The liver in sepsis: Molecular mechanism of liver failure and their potential for clinical translation. Mol. Med. 2022, 28, 84. [Google Scholar] [CrossRef]
  11. Yan, J.; Li, S.; Li, S. The role of the liver in sepsis. Int. Rev. Immunol. 2014, 33, 498–510. [Google Scholar] [CrossRef] [PubMed]
  12. Lopes-Pires, M.E.; Frade-Guanaes, J.O.; Quinlan, G.J. Clotting Dysfunction in Sepsis: A Role for ROS and Potential for Therapeutic Intervention. Antioxidants 2022, 11, 88. [Google Scholar] [CrossRef] [PubMed]
  13. Pang, Q.; Dou, L.; Pan, X.; Zeng, S.; He, J.; Xu, W.; Zeng, Y. Methylene chloride protects against cecal ligation and puncture-induced acute lung injury by modulating inflammatory mediators. Int. Immunopharmacol. 2010, 10, 929–932. [Google Scholar] [CrossRef] [PubMed]
  14. Song, G.Y.; Chung, C.S.; Chaudry, I.H.; Ayala, A. What is the role of interleukin 10 in polymicrobial sepsis: Anti-inflammatory agent or immunosuppressant? Surgery 1999, 126, 378–383. [Google Scholar] [CrossRef]
  15. Ruiz, S.; Vardon-Bounes, F.; Merlet-Dupuy, V.; Conil, J.-M.; Buléon, M.; Fourcade, O.; Tack, I.; Minville, V. Sepsis modeling in mice: Ligation length is a major severity factor in cecal ligation and puncture. Intensive Care Med. Exp. 2016, 4, 22. [Google Scholar] [CrossRef]
  16. Chavali, S.R.; Utsunomiya, T.; Forse, R.A. Increased survival after cecal ligation and puncture in mice consuming diets enriched with sesame seed oil. Crit. Care Med. 2001, 29, 140–143. [Google Scholar] [CrossRef]
  17. Wang, F.; Lei, X.; Zhao, Y.; Yu, Q.; Li, Q.; Zhao, H.; Pei, Z. Protective role of thymoquinone in sepsis-induced liver injury in BALB/c mice. Exp. Ther. Med. 2019, 18, 1985–1992. [Google Scholar] [CrossRef] [PubMed]
  18. Luo, K.; Long, H.; Xu, B.; Luo, Y. Apelin attenuates postburn sepsis via a phosphatidylinositol 3-kinase/protein kinase B dependent mechanism: A randomized animal study. Int. J. Surg. 2015, 21, 22–27. [Google Scholar] [CrossRef]
  19. Sun, N.; Wang, H.; Ma, L.; Lei, P.; Zhang, Q. Ghrelin attenuates brain injury in septic mice via PI3K/Akt signaling activation. Brain Res. Bull. 2016, 124, 278–285. [Google Scholar] [CrossRef]
  20. Liu, Y.; Shanley, T.P. MAP Kinase Phosphatase-1 and Septic Shock. J. Organ. Dysfunct. 2009, 5, 68–78. [Google Scholar] [CrossRef]
  21. Park, M.H.; Hong, J.T. Roles of NF-κB in Cancer and Inflammatory Diseases and Their Therapeutic Approaches. Cells 2016, 5, 15. [Google Scholar] [CrossRef] [PubMed]
  22. Sabra, R.T.; Abdellatef, A.A.; Abdel-Sattar, E.; Fathy, M.; Meselhy, M.R.; Hayakawa, Y. Russelioside A, a Pregnane Glycoside from Caralluma tuberculate, Inhibits Cell-Intrinsic NF-κB Activity and Metastatic Ability of Breast Cancer Cells. Biol. Pharm. Bull. 2022, 45, 1564–1571. [Google Scholar] [CrossRef] [PubMed]
  23. Alaaeldin, R.; Bakkar, S.M.; Mohyeldin, R.H.; Ali, F.E.M.; Abdel-Maqsoud, N.M.R.; Fathy, M. Azilsartan Modulates HMGB1/NF-κB/p38/ERK1/2/JNK and Apoptosis Pathways during Renal Ischemia Reperfusion Injury. Cells 2023, 12, 185. [Google Scholar] [CrossRef] [PubMed]
  24. Fawzy, M.A.; Maher, S.A.; El-Rehany, M.A.; Welson, N.N.; Albezrah, N.K.A.; Batiha, G.E.; Fathy, M. Vincamine Modulates the Effect of Pantoprazole in Renal Ischemia/Reperfusion Injury by Attenuating MAPK and Apoptosis Signaling Pathways. Molecules 2022, 27, 1383. [Google Scholar] [CrossRef] [PubMed]
  25. Mohyeldin, R.H.; Alaaeldin, R.; Sharata, E.E.; Attya, M.E.; Elhamadany, E.Y.; Fathy, M. LCZ696 attenuates sepsis-induced liver dysfunction in rats; the role of oxidative stress, apoptosis, and JNK1/2-P38 signaling pathways. Life Sci. 2023, 334, 122210. [Google Scholar] [CrossRef] [PubMed]
  26. Nazmy, M.H.; Abu-baih, D.H.; Elrehany, M.A.; Mustafa, M.; Aly, O.M.; El-Sheikh, A.A.K.; Fathy, M. Assessing the Antiproliferative Potential of a Novel Combretastatin A4 Derivative via Modulating Apoptosis, MAPK/ERK and PI3K/AKT Pathways in Human Breast Cancer Cells. FBL 2023, 28, 185. [Google Scholar] [CrossRef]
  27. Alaaeldin, R.; Hassan, H.A.; Abdel-Rahman, I.M.; Mohyeldin, R.H.; Youssef, N.; Allam, A.E.; Abdelwahab, S.F.; Zhao, Q.-L.; Fathy, M. A New EGFR Inhibitor from Ficus benghalensis Exerted Potential Anti-Inflammatory Activity via Akt/PI3K Pathway Inhibition. Curr. Issues Mol. Biol. 2022, 44, 2967–2981. [Google Scholar] [CrossRef] [PubMed]
  28. Toblli, J.E.; DiGennaro, F.; Giani, J.F.; Dominici, F.P. Nebivolol: Impact on cardiac and endothelial function and clinical utility. Vasc. Health Risk Manag. 2012, 8, 151–160. [Google Scholar] [CrossRef]
  29. Maffei, A.; Lembo, G. Nitric oxide mechanisms of nebivolol. Ther. Adv. Cardiovasc. Dis. 2009, 3, 317–327. [Google Scholar] [CrossRef]
  30. Gupta, S.; Wright, H.M. Nebivolol: A highly selective beta1-adrenergic receptor blocker that causes vasodilation by increasing nitric oxide. Cardiovasc. Ther. 2008, 26, 189–202. [Google Scholar] [CrossRef]
  31. Oelze, M.; Daiber, A.; Brandes, R.P.; Hortmann, M.; Wenzel, P.; Hink, U.; Schulz, E.; Mollnau, H.; von Sandersleben, A.; Kleschyov, A.L.; et al. Nebivolol inhibits superoxide formation by NADPH oxidase and endothelial dysfunction in angiotensin II-treated rats. Hypertension 2006, 48, 677–684. [Google Scholar] [CrossRef] [PubMed]
  32. Mason, R.P.; Kalinowski, L.; Jacob, R.F.; Jacoby, A.M.; Malinski, T. Nebivolol reduces nitroxidative stress and restores nitric oxide bioavailability in endothelium of black Americans. Circulation 2005, 112, 3795–3801. [Google Scholar] [CrossRef] [PubMed]
  33. Münzel, T.; Gori, T. Nebivolol: The somewhat-different beta-adrenergic receptor blocker. J. Am. Coll. Cardiol. 2009, 54, 1491–1499. [Google Scholar] [CrossRef] [PubMed]
  34. Dejager, L.; Pinheiro, I.; Dejonckheere, E.; Libert, C. Cecal ligation and puncture: The gold standard model for polymicrobial sepsis? Trends Microbiol. 2011, 19, 198–208. [Google Scholar] [CrossRef]
  35. Abdelnaser, M.; Alaaeldin, R.; Attya, M.E.; Fathy, M. Hepatoprotective potential of gabapentin in cecal ligation and puncture-induced sepsis; targeting oxidative stress, apoptosis, and NF-kB/MAPK signaling pathways. Life Sci. 2023, 320, 121562. [Google Scholar] [CrossRef]
  36. Biswal, S.; Remick, D.G. Sepsis: Redox mechanisms and therapeutic opportunities. Antioxid. Redox Signal 2007, 9, 1959–1961. [Google Scholar] [CrossRef]
  37. Son, Y.; Cheong, Y.K.; Kim, N.H.; Chung, H.T.; Kang, D.G.; Pae, H.O. Mitogen-Activated Protein Kinases and Reactive Oxygen Species: How Can ROS Activate MAPK Pathways? J. Signal Transduct. 2011, 2011, 792639. [Google Scholar] [CrossRef]
  38. Fattahi, F.; Kalbitz, M.; Malan, E.A.; Abe, E.; Jajou, L.; Huber-Lang, M.S.; Bosmann, M.; Russell, M.W.; Zetoune, F.S.; Ward, P.A. Complement-induced activation of MAPKs and Akt during sepsis: Role in cardiac dysfunction. Faseb J. 2017, 31, 4129–4139. [Google Scholar] [CrossRef]
  39. Alaaeldin, R.; Eisa, Y.A.; El-Rehany, M.A.; Fathy, M. Vincamine alleviates intrahepatic cholestasis in rats through modulation of NF-kB/PDGF/klf6/PPARγ and PI3K/Akt pathways. Naunyn-Schmiedeberg’s Arch. Pharmacol. 2024, 397, 7981–7994. [Google Scholar] [CrossRef] [PubMed]
  40. Makled, M.N.; El-Awady, M.S.; Abdelaziz, R.R.; Atwan, N.; Guns, E.T.; Gameil, N.M.; Shehab El-Din, A.B.; Ammar, E.M. Pomegranate protects liver against cecal ligation and puncture-induced oxidative stress and inflammation in rats through TLR4/NF-κB pathway inhibition. Environ. Toxicol. Pharmacol. 2016, 43, 182–192. [Google Scholar] [CrossRef]
  41. Aboyoussef, A.M.; Mohammad, M.K.; Abo-Saif, A.A.; Messiha, B.A.S. Granisetron attenuates liver injury and inflammation in a rat model of cecal ligation and puncture-induced sepsis. J. Pharmacol. Sci. 2021, 147, 358–366. [Google Scholar] [CrossRef] [PubMed]
  42. Li, X.; Li, Q.; Wu, L.; Wang, Y. Nebivolol Alleviates Vascular Endothelial Insulin Resistance by Inhibiting Endoplasmic Reticulum Stress. Int. Heart J. 2023, 64, 283–293. [Google Scholar] [CrossRef] [PubMed]
  43. Colak, S.; Gurlek, B.; Topcu, A.; Tumkaya, L.; Mercantepe, T.; Yilmaz, A. Protective effects of nebivolol on ovarian ischemia-reperfusion injury in rat. J. Obstet. Gynaecol. Res. 2020, 46, 2407–2416. [Google Scholar] [CrossRef] [PubMed]
  44. Mohamed, E.A.; Kassem, H.H. Protective effect of nebivolol on doxorubicin-induced cardiotoxicity in rats. Arch. Med. Sci. 2018, 14, 1450–1458. [Google Scholar] [CrossRef] [PubMed]
  45. Seren, M.; Budak, B.; Turan, N.; Parlar, A.I.; Akar, F.; Ulus, A.T. Collaborative therapy with nebivalol and L-NAME for spinal cord ischemia/reperfusion injury. Ann. Vasc. Surg. 2008, 22, 425–431. [Google Scholar] [CrossRef]
  46. Ozawa, T.; Tani, H.; Anraku, Y.; Kita, S.; Igarashi, E.; Saga, Y.; Inasaki, N.; Kawasuji, H.; Yamada, H.; Sasaki, s.-I.; et al. Novel super-neutralizing antibody UT28K is capable of protecting against infection from a wide variety of SARS-CoV-2 variants. mAbs 2022, 14, 2072455. [Google Scholar] [CrossRef]
  47. Alaaeldin, R.; Abdel-Rahman, I.M.; Ali, F.E.M.; Bekhit, A.A.; Elhamadany, E.Y.; Zhao, Q.L.; Cui, Z.G.; Fathy, M. Dual Topoisomerase I/II Inhibition-Induced Apoptosis and Necro-Apoptosis in Cancer Cells by a Novel Ciprofloxacin Derivative via RIPK1/RIPK3/MLKL Activation. Molecules 2022, 27, 7993. [Google Scholar] [CrossRef]
  48. Koskinas, J.; Gomatos, I.P.; Tiniakos, D.G.; Memos, N.; Boutsikou, M.; Garatzioti, A.; Archimandritis, A.; Betrosian, A. Liver histology in ICU patients dying from sepsis: A clinico-pathological study. World J. Gastroenterol. 2008, 14, 1389–1393. [Google Scholar] [CrossRef]
  49. Capcha, J.M.C.; Moreira, R.S.; Rodrigues, C.E.; Silveira, M.A.D.; Andrade, L.; Gomes, S.A. Using the Cecal Ligation and Puncture Model of Sepsis to Induce Rats to Multiple Organ Dysfunction. Bio Protoc. 2021, 11, e3979. [Google Scholar] [CrossRef]
  50. Vandewalle, J.; Steeland, S.; Van Ryckeghem, S.; Eggermont, M.; Van Wonterghem, E.; Vandenbroucke, R.E.; Libert, C. A Study of Cecal Ligation and Puncture-Induced Sepsis in Tissue-Specific Tumor Necrosis Factor Receptor 1-Deficient Mice. Front. Immunol. 2019, 10, 2574. [Google Scholar] [CrossRef]
  51. Bi, J.; Cui, R.; Li, Z.; Liu, C.; Zhang, J. Astaxanthin alleviated acute lung injury by inhibiting oxidative/nitrative stress and the inflammatory response in mice. Biomed. Pharmacother. 2017, 95, 974–982. [Google Scholar] [CrossRef] [PubMed]
  52. Hopkins, B.L.; Neumann, C.A. Redoxins as gatekeepers of the transcriptional oxidative stress response. Redox Biol. 2019, 21, 101104. [Google Scholar] [CrossRef] [PubMed]
  53. Di Meo, S.; Reed, T.T.; Venditti, P.; Victor, V.M. Role of ROS and RNS Sources in Physiological and Pathological Conditions. Oxid. Med. Cell Longev. 2016, 2016, 1245049. [Google Scholar] [CrossRef]
  54. Toscano, M.G.; Ganea, D.; Gamero, A.M. Cecal ligation puncture procedure. J. Vis. Exp. 2011, 7, 2860. [Google Scholar] [CrossRef]
  55. Zhu, W.; Bao, R.; Fan, X.; Tao, T.; Zhu, J.; Wang, J.; Li, J.; Bo, L.; Deng, X. PD-L1 blockade attenuated sepsis-induced liver injury in a mouse cecal ligation and puncture model. Mediat. Inflamm. 2013, 2013, 361501. [Google Scholar] [CrossRef]
  56. Bauer, M.; Press, A.T.; Trauner, M. The liver in sepsis: Patterns of response and injury. Curr. Opin. Crit. Care 2013, 19, 123–127. [Google Scholar] [CrossRef]
  57. Till, G.O.; Hatherill, J.R.; Tourtellotte, W.W.; Lutz, M.J.; Ward, P.A. Lipid peroxidation and acute lung injury after thermal trauma to skin. Evidence of a role for hydroxyl radical. Am. J. Pathol. 1985, 119, 376–384. [Google Scholar]
  58. Maleki, E.; Sheibani, M.; Nezamoleslami, S.; Dehpour, A.R.; Takzaree, N.; Shafaroodi, H. Glatiramer acetate treatment inhibits inflammatory responses and improves survival in a mice model of cecal ligation and puncture-induced sepsis. J. Basic. Clin. Physiol. Pharmacol. 2021, 33, 317–326. [Google Scholar] [CrossRef] [PubMed]
  59. Iyer, S.S.; Cheng, G. Role of interleukin 10 transcriptional regulation in inflammation and autoimmune disease. Crit. Rev. Immunol. 2012, 32, 23–63. [Google Scholar] [CrossRef]
  60. Wójcik, P.; Gęgotek, A.; Žarković, N.; Skrzydlewska, E. Oxidative Stress and Lipid Mediators Modulate Immune Cell Functions in Autoimmune Diseases. Int. J. Mol. Sci. 2021, 22, 723. [Google Scholar] [CrossRef]
  61. Crapo, J.D. Oxidative stress as an initiator of cytokine release and cell damage. Eur. Respir. J. 2003, 22, 4s–6s. [Google Scholar] [CrossRef] [PubMed]
  62. Colitti, M.; Stefanon, B.; Gabai, G.; Gelain, M.E.; Bonsembiante, F. Oxidative Stress and Nutraceuticals in the Modulation of the Immune Function: Current Knowledge in Animals of Veterinary Interest. Antioxidants 2019, 8, 28. [Google Scholar] [CrossRef] [PubMed]
  63. Allameh, A.; Niayesh-Mehr, R.; Aliarab, A.; Sebastiani, G.; Pantopoulos, K. Oxidative Stress in Liver Pathophysiology and Disease. Antioxidants 2023, 12, 1653. [Google Scholar] [CrossRef]
  64. Cichoż-Lach, H.; Michalak, A. Oxidative stress as a crucial factor in liver diseases. World J. Gastroenterol. 2014, 20, 8082–8091. [Google Scholar] [CrossRef] [PubMed]
  65. Zhu, J.; Lin, X.; Yan, C.; Yang, S.; Xu, Z. Tocilizumab attenuates acute lung injury in rats with sepsis by regulating S100A12/NLRP3. Am. J. Transl. Res. 2023, 15, 99–113. [Google Scholar]
  66. Gao, M.; Ha, T.; Zhang, X.; Wang, X.; Liu, L.; Kalbfleisch, J.; Singh, K.; Williams, D.; Li, C. The Toll-like Receptor 9 Ligand, CpG Oligodeoxynucleotide, Attenuates Cardiac Dysfunction in Polymicrobial Sepsis, Involving Activation of Both Phosphoinositide 3 Kinase/Akt and Extracellular-Signal-Related Kinase Signaling. J. Infect. Dis. 2013, 207, 1471–1479. [Google Scholar] [CrossRef]
  67. Yin, D.; Lin, D.; Xie, Y.; Gong, A.; Jiang, P.; Wu, J. Neuregulin-1β Alleviates Sepsis-Induced Skeletal Muscle Atrophy by Inhibiting Autophagy via AKT/mTOR Signaling Pathway in Rats. Shock 2022, 57, 397–407. [Google Scholar] [CrossRef]
  68. Kirtonia, A.; Sethi, G.; Garg, M. The multifaceted role of reactive oxygen species in tumorigenesis. Cell Mol. Life Sci. 2020, 77, 4459–4483. [Google Scholar] [CrossRef]
  69. Lingappan, K. NF-κB in Oxidative Stress. Curr. Opin. Toxicol. 2018, 7, 81–86. [Google Scholar] [CrossRef]
  70. Li, H.; Han, W.; Polosukhin, V.; Yull, F.E.; Segal, B.H.; Xie, C.M.; Blackwell, T.S. NF-κB inhibition after cecal ligation and puncture reduces sepsis-associated lung injury without altering bacterial host defense. Mediat. Inflamm. 2013, 2013, 503213. [Google Scholar] [CrossRef]
  71. Yue, J.; López, J.M. Understanding MAPK Signaling Pathways in Apoptosis. Int. J. Mol. Sci. 2020, 21, 2346. [Google Scholar] [CrossRef] [PubMed]
  72. Chagpar, R.B.; Links, P.H.; Pastor, M.C.; Furber, L.A.; Hawrysh, A.D.; Chamberlain, M.D.; Anderson, D.H. Direct positive regulation of PTEN by the p85 subunit of phosphatidylinositol 3-kinase. Proc. Natl. Acad. Sci. USA 2010, 107, 5471–5476. [Google Scholar] [CrossRef]
  73. López-Carballo, G.; Moreno, L.; Masiá, S.; Pérez, P.; Barettino, D. Activation of the phosphatidylinositol 3-kinase/Akt signaling pathway by retinoic acid is required for neural differentiation of SH-SY5Y human neuroblastoma cells. J. Biol. Chem. 2002, 277, 25297–25304. [Google Scholar] [CrossRef] [PubMed]
  74. Tang, B.; Tang, F.; Wang, Z.; Qi, G.; Liang, X.; Li, B.; Yuan, S.; Liu, J.; Yu, S.; He, S. Upregulation of Akt/NF-κB-regulated inflammation and Akt/Bad-related apoptosis signaling pathway involved in hepatic carcinoma process: Suppression by carnosic acid nanoparticle. Int. J. Nanomed. 2016, 11, 6401–6420. [Google Scholar] [CrossRef] [PubMed]
  75. Jayakumar, T.; Lin, K.C.; Chang, C.C.; Hsia, C.W.; Manubolu, M.; Huang, W.C.; Sheu, J.R.; Hsia, C.H. Targeting MAPK/NF-κB Pathways in Anti-Inflammatory Potential of Rutaecarpine: Impact on Src/FAK-Mediated Macrophage Migration. Int. J. Mol. Sci. 2021, 23, 92. [Google Scholar] [CrossRef]
  76. Kim, I.; Moon, S.O.; Kim, S.H.; Kim, H.J.; Koh, Y.S.; Koh, G.Y. Vascular endothelial growth factor expression of intercellular adhesion molecule 1 (ICAM-1), vascular cell adhesion molecule 1 (VCAM-1), and E-selectin through nuclear factor-kappa B activation in endothelial cells. J. Biol. Chem. 2001, 276, 7614–7620. [Google Scholar] [CrossRef]
  77. Reinders, M.E.; Sho, M.; Izawa, A.; Wang, P.; Mukhopadhyay, D.; Koss, K.E.; Geehan, C.S.; Luster, A.D.; Sayegh, M.H.; Briscoe, D.M. Proinflammatory functions of vascular endothelial growth factor in alloimmunity. J. Clin. Investig. 2003, 112, 1655–1665. [Google Scholar] [CrossRef]
  78. Taha, Y.; Raab, Y.; Larsson, A.; Carlson, M.; Lööf, L.; Gerdin, B.; Thörn, M. Vascular endothelial growth factor (VEGF)--a possible mediator of inflammation and mucosal permeability in patients with collagenous colitis. Dig. Dis. Sci. 2004, 49, 109–115. [Google Scholar] [CrossRef] [PubMed]
  79. van der Flier, M.; van Leeuwen, H.J.; van Kessel, K.P.; Kimpen, J.L.; Hoepelman, A.I.; Geelen, S.P. Plasma vascular endothelial growth factor in severe sepsis. Shock 2005, 23, 35–38. [Google Scholar] [CrossRef]
  80. Pickkers, P.; Sprong, T.; Eijk, L.; Hoeven, H.; Smits, P.; Deuren, M. Vascular endothelial growth factor is increased during the first 48 h of human septic shock and correlates with vascular permeability. Shock 2005, 24, 508–512. [Google Scholar] [CrossRef]
  81. Roderfeld, M. Matrix metalloproteinase functions in hepatic injury and fibrosis. Matrix Biol. 2018, 68-69, 452–462. [Google Scholar] [CrossRef] [PubMed]
  82. Bedossa, P.; Paradis, V. Liver extracellular matrix in health and disease. J. Pathol. 2003, 200, 504–515. [Google Scholar] [CrossRef]
  83. Lee, H.S.; Kim, W.J. The Role of Matrix Metalloproteinase in Inflammation with a Focus on Infectious Diseases. Int. J. Mol. Sci. 2022, 23, 10546. [Google Scholar] [CrossRef] [PubMed]
  84. DeLeve, L.D.; Wang, X.; Wang, L. VEGF-sdf1 recruitment of CXCR7+ bone marrow progenitors of liver sinusoidal endothelial cells promotes rat liver regeneration. Am. J. Physiol. Gastrointest. Liver Physiol. 2016, 310, G739–G746. [Google Scholar] [CrossRef]
  85. Wang, L.; Wang, X.; Wang, L.; Chiu, J.D.; van de Ven, G.; Gaarde, W.A.; Deleve, L.D. Hepatic vascular endothelial growth factor regulates recruitment of rat liver sinusoidal endothelial cell progenitor cells. Gastroenterology 2012, 143, 1555–1563.e2. [Google Scholar] [CrossRef] [PubMed]
  86. Wang, X.; Maretti-Mira, A.C.; Wang, L.; DeLeve, L.D. Liver-Selective MMP-9 Inhibition in the Rat Eliminates Ischemia-Reperfusion Injury and Accelerates Liver Regeneration. Hepatology 2019, 69, 314–328. [Google Scholar] [CrossRef]
  87. Ersan, S.; Tanrısev, M.; Cavdar, Z.; Celık, A.; Unlu, M.; Kocak, A.; Kose, T. Pretreatment with nebivolol attenuates level and expression of matrix metalloproteinases in a rat model of renal ischaemia-reperfusion injury. Nephrology 2017, 22, 1023–1029. [Google Scholar] [CrossRef]
  88. Cavdar, Z.; Kocak, A.; Ural, C.; Afagh, A.; Ersan, S.; Ozbal, S.; Tatli, M.; Celik, A.; Arslan, S.; Cavdar, C. Role of p38 MAPK, Akt and NFκB in renoprotective effects of nebivolol on renal ischemia-reperfusion injury in rats. Biotech. Histochem. 2023, 98, 401–411. [Google Scholar] [CrossRef]
  89. Wanas, H.; El-Shabrawy, M.; Mishriki, A.; Attia, H.; Emam, M.; Aboulhoda, B.E. Nebivolol protects against cyclophosphamide-induced nephrotoxicity through modulation of oxidative stress, inflammation, and apoptosis. Clin. Exp. Pharmacol. Physiol. 2021, 48, 811–819. [Google Scholar] [CrossRef]
  90. Kim, Y.J.; Jang, S.K.; Kim, G.; Hong, S.E.; Park, C.S.; Seong, M.K.; Kim, H.A.; Kim, K.S.; Kim, C.H.; Park, K.S.; et al. Nebivolol Sensitizes BT-474 Breast Cancer Cells to FGFR Inhibitors. Anticancer. Res. 2023, 43, 1973–1980. [Google Scholar] [CrossRef]
  91. Fink, M.P. Animal models of sepsis. Virulence 2014, 5, 143–153. [Google Scholar] [CrossRef] [PubMed]
  92. Bhatia, A.; Saikia, P.P.; Dkhar, B.; Pyngrope, H. Anesthesia protocol for ear surgery in Wistar rats (animal research). Anim. Model. Exp. Med. 2022, 5, 183–188. [Google Scholar] [CrossRef]
  93. Sabra, R.T.; Bekhit, A.A.; Sabra, N.T.; Abd El-Moeze, N.A.; Fathy, M. Nebivolol ameliorates sepsis-evoked kidney dysfunction by targeting oxidative stress and TGF-β/Smad/p53 pathway. Sci. Rep. 2024, 14, 14735. [Google Scholar] [CrossRef]
  94. Nasr, A.M.; Rezq, S.; Shaheen, A.; Elshazly, S.M. Renal protective effect of nebivolol in rat models of acute renal injury: Role of sodium glucose co-transporter 2. Pharmacol. Rep. 2020, 72, 956–968. [Google Scholar] [CrossRef]
  95. Said, E.S.; Mohammed, A.H.; Ali, H.M.; Babiker, A.Y.; Alnughaymishi, R.; Althaqeel, N.Z.; Ahmed, A.S. Evaluation of hepatoprotective effect of Nebivolol and sodium copper Chlorophyllin on CCL4-induced hepatotoxicity in mice. Eur. Rev. Med. Pharmacol. Sci. 2022, 26, 1717–1728. [Google Scholar] [CrossRef] [PubMed]
  96. Sanaee, F.; Valente Neves, D.; Lanchote, V.L.; Jamali, F. Pharmacokinetics of nebivolol in the rat: Low oral absorption, loss in the gut and systemic stereoselectivity. Biopharm. Drug Dispos. 2013, 34, 312–320. [Google Scholar] [CrossRef]
  97. Naeem, A.G.; El-Naga, R.N.; Michel, H.E. Nebivolol elicits a neuroprotective effect in the cuprizone model of multiple sclerosis in mice: Emphasis on M1/M2 polarization and inhibition of NLRP3 inflammasome activation. Inflammopharmacology 2022, 30, 2197–2209. [Google Scholar] [CrossRef] [PubMed]
  98. Zhang, N.; Zhao, W.; Hu, Z.J.; Ge, S.M.; Huo, Y.; Liu, L.X.; Gao, B.L. Protective effects and mechanisms of high-dose vitamin C on sepsis-associated cognitive impairment in rats. Sci. Rep. 2021, 11, 14511. [Google Scholar] [CrossRef]
  99. Bancroft, J.D.; Gamble, M. Theory and Practice of Histological Techniques; Elsevier Health Sciences: Amsterdam, The Netherlands, 2008. [Google Scholar]
  100. Naiki-Ito, A.; Asamoto, M.; Naiki, T.; Ogawa, K.; Takahashi, S.; Sato, S.; Shirai, T. Gap junction dysfunction reduces acetaminophen hepatotoxicity with impact on apoptotic signaling and connexin 43 protein induction in rat. Toxicol. Pathol. 2010, 38, 280–286. [Google Scholar] [CrossRef]
Stresses 04 00053 g001
Figure 1. Impact of Nebivolol on hepatic biochemical indicators in serum, (a) ALT, (b) AST, (c) ALP, (d) albumin, (e) direct bilirubin, and (f) total bilirubin after induction of CLP in rats. Data are exemplified as mean ± SEM. Following a one-way ANOVA test, the significant divisions among groups were analyzed using the Tukey–Kramar test, where ### p< 0.001, contrasted with controlling sham control; ** p < 0.01 and *** p < 0.001, contrasted with CLP group.
Figure 1. Impact of Nebivolol on hepatic biochemical indicators in serum, (a) ALT, (b) AST, (c) ALP, (d) albumin, (e) direct bilirubin, and (f) total bilirubin after induction of CLP in rats. Data are exemplified as mean ± SEM. Following a one-way ANOVA test, the significant divisions among groups were analyzed using the Tukey–Kramar test, where ### p< 0.001, contrasted with controlling sham control; ** p < 0.01 and *** p < 0.001, contrasted with CLP group.
Stresses 04 00053 g001
Stresses 04 00053 g002
Figure 2. Influence of Nebivolol on oxidative status of liver tissue. (a) MDA content, (b) SOD activity, and (c) GSH level. Data are exemplified as mean ± SEM. Following a one-way ANOVA test, the significant divisions among groups were analyzed using the Tukey–Kramar test, where ### p < 0.001, contrasted with sham control; *** p < 0.001, contrasted with CLP group; $ p < 0.05 and $$ p < 0.01, contrasted with CLP + Neb4 group.
Figure 2. Influence of Nebivolol on oxidative status of liver tissue. (a) MDA content, (b) SOD activity, and (c) GSH level. Data are exemplified as mean ± SEM. Following a one-way ANOVA test, the significant divisions among groups were analyzed using the Tukey–Kramar test, where ### p < 0.001, contrasted with sham control; *** p < 0.001, contrasted with CLP group; $ p < 0.05 and $$ p < 0.01, contrasted with CLP + Neb4 group.
Stresses 04 00053 g002
Stresses 04 00053 g003
Figure 3. Impact of Nebivolol on (a) TNF-α, (b) IL-β, (c) IL-6, and (d) IL-10 cytokines in hepatic tissues. Data are exemplified as mean ± SEM. Following a one-way ANOVA test, the significant divisions among groups were analyzed using the Tukey–Kramar test, where ### p< 0.001, contrasted with sham control; ** p < 0.01 and *** p < 0.001, contrasted with CLP group; $ p < 0.05, $$ p < 0.01, and $$$ p < 0.001, contrasted with CLP + Neb4 group.
Figure 3. Impact of Nebivolol on (a) TNF-α, (b) IL-β, (c) IL-6, and (d) IL-10 cytokines in hepatic tissues. Data are exemplified as mean ± SEM. Following a one-way ANOVA test, the significant divisions among groups were analyzed using the Tukey–Kramar test, where ### p< 0.001, contrasted with sham control; ** p < 0.01 and *** p < 0.001, contrasted with CLP group; $ p < 0.05, $$ p < 0.01, and $$$ p < 0.001, contrasted with CLP + Neb4 group.
Stresses 04 00053 g003
Stresses 04 00053 g004
Figure 4. Effect of Nebivolol on (a) MMP-2, (b) MMP-9, (c) VEGF, and (d) NF-κB mRNA expression levels in liver samples. Data are exemplified as mean ± SEM. Following a one-way ANOVA test, the significant divisions among groups were analyzed using the Tukey–Kramar test, where ### p < 0.001, contrasted with sham control; * p < 0.05, ** p < 0.01, and *** p < 0.001, contrasted with CLP group; $ p < 0.05 and $$ p < 0.01, contrasted with CLP + Neb4 group.
Figure 4. Effect of Nebivolol on (a) MMP-2, (b) MMP-9, (c) VEGF, and (d) NF-κB mRNA expression levels in liver samples. Data are exemplified as mean ± SEM. Following a one-way ANOVA test, the significant divisions among groups were analyzed using the Tukey–Kramar test, where ### p < 0.001, contrasted with sham control; * p < 0.05, ** p < 0.01, and *** p < 0.001, contrasted with CLP group; $ p < 0.05 and $$ p < 0.01, contrasted with CLP + Neb4 group.
Stresses 04 00053 g004
Stresses 04 00053 g005
Figure 5. Effect of Nebivolol on p-AKT, p-JNK1/2, and p-p38 protein expressions. (a) Representative western blot membranes of t-AKT, p-AKT, t-JNK1/2, p-JNK1/2, t-p38, p-p38, and b-actin proteins for all studied groups; (b–d) expressions of p-AKT/t-AKT, p-JNK1/2/t-JNK1/2, and p-p38/t-p38 proteins were expressed densitometrically using bands in (a). Data are exemplified as mean ± SEM. Following a one-way ANOVA test, the significant divisions among groups were analyzed using the Tukey–Kramar test, where ### p< 0.001, contrasted with sham control; ** p < 0.01 and *** p < 0.001, contrasted with CLP group; $$ p < 0.01, contrasted with CLP + Neb4 group.
Figure 5. Effect of Nebivolol on p-AKT, p-JNK1/2, and p-p38 protein expressions. (a) Representative western blot membranes of t-AKT, p-AKT, t-JNK1/2, p-JNK1/2, t-p38, p-p38, and b-actin proteins for all studied groups; (b–d) expressions of p-AKT/t-AKT, p-JNK1/2/t-JNK1/2, and p-p38/t-p38 proteins were expressed densitometrically using bands in (a). Data are exemplified as mean ± SEM. Following a one-way ANOVA test, the significant divisions among groups were analyzed using the Tukey–Kramar test, where ### p< 0.001, contrasted with sham control; ** p < 0.01 and *** p < 0.001, contrasted with CLP group; $$ p < 0.01, contrasted with CLP + Neb4 group.
Stresses 04 00053 g005
Stresses 04 00053 g006
Figure 6. Impact of Nebivolol on liver histological alterations. The figure demonstrates photographs of rat liver (H&E staining, 400×). (a) Sham specimens depict a standard hepatic architecture, with hepatocytes organized in cords extending from the central vein (black arrow) and portal tract (blue arrow). (b) Nebivolol 10 group with the same structure as a sham group. (c1) CLP group showing hepatocyte necrosis, ballooning, and inflammatory cell infiltration (in the circle) with a higher magnification photomicrograph in (c2) (600×) showing binuclear cells (red arrow) with area of necrosis (brown arrow). (d) CLP/Nebivolol 4 showing decreased the inflammatory cell infiltration, ballooning deterioration, and hepatocyte necrosis (in the circle). (e) CLP/Nebivolol 10 improves the hepatic integrity with minimal inflammatory cells, slight centrilobular hepatocyte deterioration and ballooning with no necrosis. (f) CLP/vitamin C showing mild portal tract inflammation.
Figure 6. Impact of Nebivolol on liver histological alterations. The figure demonstrates photographs of rat liver (H&E staining, 400×). (a) Sham specimens depict a standard hepatic architecture, with hepatocytes organized in cords extending from the central vein (black arrow) and portal tract (blue arrow). (b) Nebivolol 10 group with the same structure as a sham group. (c1) CLP group showing hepatocyte necrosis, ballooning, and inflammatory cell infiltration (in the circle) with a higher magnification photomicrograph in (c2) (600×) showing binuclear cells (red arrow) with area of necrosis (brown arrow). (d) CLP/Nebivolol 4 showing decreased the inflammatory cell infiltration, ballooning deterioration, and hepatocyte necrosis (in the circle). (e) CLP/Nebivolol 10 improves the hepatic integrity with minimal inflammatory cells, slight centrilobular hepatocyte deterioration and ballooning with no necrosis. (f) CLP/vitamin C showing mild portal tract inflammation.
Stresses 04 00053 g006
Stresses 04 00053 g007
Figure 7. Schematic illustration of the research design.
Figure 7. Schematic illustration of the research design.
Stresses 04 00053 g007
Table 1. The various groups’ liver tissues were scored histopathologically.
Table 1. The various groups’ liver tissues were scored histopathologically.
GroupsShamNeb 10CLPCLP/Neb 4CLP/Neb 10CLP/Vit C
Hepatocyte necrosis003200
Vascular degeneration002100
Inflammation (inflammatory cell infiltrations)002111
Total scoring007 ###4 **1 ***1 ***
(0 indicates no alteration; 1 indicates slight alteration; 2 indicates moderate alteration; and 3 indicates severe alteration). Significant differences were analyzed by one-way ANOVA, where ### p< 0.001, contrasted with sham control; ** p < 0.01, and *** p < 0.001, contrasted with CLP group.
Table 2. Sequences of primers employed in qRT-PCR with their accession numbers.
Table 2. Sequences of primers employed in qRT-PCR with their accession numbers.
Genes Primer Sequence (5′-3′)Accession Number
VEGFForward
Reverse		GCCGTCCTGTGTGCCCCTAATG GTTCTATCTTTCTTTGGTCTGCXM_032900650.1
MMP-2Forward
Reverse		AGCTCCCGGAAAAGATTGAT CCAGAACTTGTCCCCAGAAANM_031054.2
MMP-9Forward
Reverse		TCACTTTCCCTTCACCTTCG AGTTGCCCCCAGTTACAGTGNM_031055.2
NF-κBForward
Reverse		GTCTCAAACCAAACAGCCTCAC
CAGTGTCTTCCTCGACATGGAT		NM_199267.2
β-actinForward
Reverse		TGTCACCAACTGGGACGATA
ACCCTCATAGATGGGCACAG		XM_039089807.1
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Sabra, R.T.; Bekhit, A.A.; Sabra, N.T.; Abd El-Moeze, N.A.; Fathy, M. Nebivolol Exerts Hepatoprotective Activity During CLP-Induced Sepsis by Modulating Oxidative Stress, Liver Regeneration, and AKT/MAPK Pathways in Rats. Stresses 2024, 4, 800-815. https://doi.org/10.3390/stresses4040053

AMA Style

Sabra RT, Bekhit AA, Sabra NT, Abd El-Moeze NA, Fathy M. Nebivolol Exerts Hepatoprotective Activity During CLP-Induced Sepsis by Modulating Oxidative Stress, Liver Regeneration, and AKT/MAPK Pathways in Rats. Stresses. 2024; 4(4):800-815. https://doi.org/10.3390/stresses4040053

Chicago/Turabian Style

Sabra, Rahma Tharwat, Amany Abdlrehim Bekhit, Nourhan Tharwat Sabra, Nadia Ahmed Abd El-Moeze, and Moustafa Fathy. 2024. "Nebivolol Exerts Hepatoprotective Activity During CLP-Induced Sepsis by Modulating Oxidative Stress, Liver Regeneration, and AKT/MAPK Pathways in Rats" Stresses 4, no. 4: 800-815. https://doi.org/10.3390/stresses4040053

APA Style

Sabra, R. T., Bekhit, A. A., Sabra, N. T., Abd El-Moeze, N. A., & Fathy, M. (2024). Nebivolol Exerts Hepatoprotective Activity During CLP-Induced Sepsis by Modulating Oxidative Stress, Liver Regeneration, and AKT/MAPK Pathways in Rats. Stresses, 4(4), 800-815. https://doi.org/10.3390/stresses4040053

Article Metrics

Back to TopTop