Next Article in Journal
Heptophylla gongshana Bezděk & Král, n. sp. from China (Yunnan) and a Checklist of the Tribe Heptophyllini (Scarabaeidae: Melolonthinae)
Previous Article in Journal
Taxonomic Synopsis of Mascagnia (Malpighiaceae) of Brazil
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

A Revised Checklist and Identification Key for Acotylean Flatworms (Rhabditophora: Polycladida: Acotylea) from the Caribbean Coast of Colombia

by
Jorge I. Merchán-Mayorga
1,*,
D. Marcela Bolaños
2,
Lyda R. Castro
1,3,4 and
Sigmer Quiroga
1,4,*
1
Grupo de Investigación en Manejo y Conservación de Fauna, Flora y Ecosistemas Estratégicos Neotropicales MIKU, Universidad del Magdalena, Santa Marta, Colombia
2
Department of Organismic and Evolutionary Biology, Museum of Comparative Zoology, Harvard University, Cambridge, MA 02138, USA
3
Sistemática y Ecología Molecular, Grupo de Investigación Evolución, Centro de Genética y Biología Molecular, Universidad del Magdalena, Santa Marta, Colombia
4
Universidad del Magdalena, Santa Marta, Colombia
*
Authors to whom correspondence should be addressed.
Taxonomy 2025, 5(3), 51; https://doi.org/10.3390/taxonomy5030051
Submission received: 16 August 2025 / Revised: 5 September 2025 / Accepted: 10 September 2025 / Published: 19 September 2025

Abstract

The Order Polycladida comprises a diverse yet understudied group of free-living flatworms, traditionally divided into Cotylea and Acotylea based on the presence or absence of a ventral adhesive organ known as a cotyl. Species identification, particularly within Acotylea, is often challenging due to the need for histological examination of reproductive structures and the scarcity of molecular data. The Tropical Western Atlantic, especially the Caribbean Sea, hosts high polyclad diversity but remains poorly surveyed. This study updates the checklist of Acotylea from the Colombian Caribbean, combining new collections from Santa Marta with the literature records. Field work yielded 22 acotylean species from 14 genera and 10 families, with DNA sequences (28S rDNA and/or COI mtDNA) obtained for 20 species. 11 species are new records for Colombia, and five for the Caribbean Sea: Latocestus brasiliensis Hyman, 1953, Notocomplana martae (Marcus, 1948), Interplana evelinae (Marcus, 1952), Triadomma curvum Marcus, 1949, and Adenoplana evelinae Marcus, 1950. In total, 29 species are now documented from the region. We provide photographs of live specimens, whole mounts, and histological sections; DNA barcodes for most species; and the first dichotomous key for Colombian Caribbean acotyleans, based primarily on external traits, providing a practical tool to support further taxonomic, ecological, and biodiversity research.

1. Introduction

The order Polycladida comprises a diverse group of free-living flatworms, currently represented by approximately 1000 described species [1]. Traditionally, polyclads are divided into two suborders, Cotylea and Acotylea, based on the presence or absence of an adhesive organ known as “cotyl” [2]. Species within Cotylea possess this organ along the body midline, posterior to the female gonopore, whereas it is absent in members of Acotylea. Historically, the classification of Polycladida has primarily relied on the arrangement and morphology of the reproductive structures, particularly those of the male system. However, in recent years, molecular phylogenetic analyses have led to significant revisions at both the superfamily and family levels. As a result, the current taxonomic classification recognizes three superfamilies within Acotylea: Discoceloidea Dittman, Cuadrado, Aguado, Noreña and Egger, 2019; Leptoplanoidea Faubel, 1984; Stylochoidea Poche, 1926 [3,4]. Despite these advances, considerable taxonomic uncertainty remains, especially at the family level. This is mainly due to the limited availability of morphological and molecular data for several families, genera and type species. Improving the sampling coverage, both in terms of geographic range and taxonomic diversity, remains a key priority to resolve these issues [4,5].
The Tropical Western Atlantic harbors approximately 125 known species of polyclad flatworms, ranging from the Lesser Antilles up to the coast of North Carolina [6]. Specifically, within the Caribbean Sea, about 67 species have been recorded to date [6,7]. Nevertheless, the continuous description of new species and distribution records [8,9] highlights how understudied this tropical region remains in terms of polyclad diversity. One of the main challenges in studying polyclads is their fragile body structure, which complicates both field collection and subsequent taxonomic identification [6,10].
To address the historical lack of studies on polyclads in Colombia, Quiroga et al. [11] conducted the first comprehensive survey of polyclad flatworms along the Caribbean coast of Santa Marta. Their work documented 25 species, including 13 acotyleans, significantly expanding the known distribution of the group in the Caribbean region. Notably, six of these acotylean species were recorded for the first time in the Caribbean Sea, and a new species was subsequently described [12], reinforcing the idea that Colombia harbors a particularly rich polyclad fauna. More recently, an additional acotylean species was reported for the Colombian Caribbean by Merchán-Mayorga et al. [13], highlighting the need for continued sampling and taxonomic research in this area.
The accurate identification of polyclad species continues to rely heavily on morphological taxonomic keys, particularly those developed by Faubel [14,15] for genera, and to a lesser extent by Prudhoe [16]. However, these tools are often insufficient for identification at the species level, which typically requires consulting the original descriptions and, more critically, histological analysis of the reproductive systems. Because many diagnostic characters are internal, such as the arrangement of the male and female copulatory organs, identification often demands labor and time, sectioning nearly every specimen collected.
The difficulty of identifying polyclads hinders not only taxonomic work but also ecological and biodiversity studies, environmental monitoring, and consulting work, all of which require accessible and reliable methods of species identification. One way to overcome this obstacle is through the development of regional keys based on more readily observable external features. Once a relatively complete inventory of the local fauna is established, it becomes possible to develop practical identification keys that enable faster, non-invasive recognition of species in the field or under the dissecting microscope. Building on this foundation, the present study offers an updated checklist of acotylean polyclads from the Colombian Caribbean. We include photographs of live and histologically sectioned specimens, as well as DNA barcodes to expand the sequences available in public databases. Notably, we also present the first dichotomous key for acotylean polyclad species recorded in the Colombian Caribbean, incorporating diagnostic characters that can be observed without histological procedures whenever possible. Our findings highlight the taxonomic richness of polyclads in Colombia and provide researchers with practical tools to advance the study of this understudied invertebrate group.

2. Materials and Methods

2.1. Study Area

Field work was conducted along the littoral zone of the Santa Marta region, located on the Caribbean coast of northern Colombia. This area comprises a diverse range of shallow marine habitats, including rocky intertidal shores, coral reefs, sandy beaches, and seagrass beds [17,18]. The climate in the Colombian Caribbean is dictated mainly by the movement of the Inter-Tropical Convergence Zone, the oceanic currents, and the climate phenomena (e.g., ENSO) which regulate two climatic seasons determined by the precipitation rate: a dry season from December to March and a rainy season from April to November, with a transition time between June and July produced by the southeast trade winds [19,20]. We carried out 17 field trips along the Santa Marta coast, mainly on rocky shores, reefs and seagrass mats in four sampling sites: Inca Inca Bay (11.209, −74.233), Taganga Bay (11.265, −74.194), Bahía Concha (11.301, −74.147), and Neguanje Bay (11.328, −74.078) (Figure 1) between December 2022 to December 2023 and from November 2024 to May 2025.

2.2. Collection Methods

Polyclads were collected using soft paintbrushes from under rocks, coral rubble, crevices, and algae in rocky shores, seagrass beds and coral reefs and kept in plastic containers filled with seawater. Live specimens were photographed and measured with a Nikon D7000 camera equipped with an AF-S DX Micro Nikkor 60 mm macro lens and a Godox TT600 speedlight. A small section of the body margin was cut and stored in absolute ethanol for molecular analysis. Flatworms were anesthetized with 7.5% MgCl2, fixed in frozen 10% formalin, and preserved in 70% ethanol [10,11]. From mature specimens, the portion of the body containing the reproductive structures was dissected for histological analysis, while the rest was used for whole mounts.

2.3. Taxonomic Identification and Checklist

Tissue samples containing the reproductive structures were embedded in paraffin, sagittally sectioned at 5–7 μm and stained with hematoxylin and eosin. For whole mounts, entire specimens or remaining portions after dissection were rehydrated, stained with hematoxylin, dehydrated, and cleared using methyl salicylate. High-definition photographs of sectioned and mounted specimens were obtained with a Zeiss AxioCam 208 color camera mounted on a Zeiss AxioLab 5 microscope or a Zeiss Axiocam Erc5s camera mounted on a Zeiss SteREO Discovery.V8 dissecting microscope (Oberkochen, Germany) with the software ZEN BLUE (v. 3.4) from Zeiss (Oberkochen, Germany). Taxonomic identifications at the genus level were primarily based on the work by Faubel [14,15]. For species identification, the available literature on polyclads from the Tropical Western Atlantic and parts of Brazil was reviewed. This included the contributions of du Bois-Reymond Marcus and Marcus [21,22,23,24,25] and Hyman [26,27,28,29,30], which focused on specimens from the Antilles, the Gulf of Mexico and the eastern coast of North America. Polyclad collections from the Smithsonian National Museum of Natural History, American Museum of Natural History and Centro de Colecciones Científicas de la Universidad del Magdalena were consulted, as well as the specimens deposited by Quiroga et al. [11] at the Museo de Historia Natural Marina de Colombia Makuriwa. Nomenclature and classification were standardized following the Turbellarian Taxonomic Database [1] and the World Register of Marine Species (WoRMS) [31]. All collected material was deposited in the Centro de Colecciones Científicas de la Universidad del Magdalena (Catalogue CBUMAG:PLA). Structures are labeled according to the abbreviations from Faubel [14]; some additional abbreviations were added when needed from Bahia and Schrödl’s work [32]. Photographs were edited in Adobe Photoshop 2022 (v. 23.5.0); in all figures detailing morphological structures, the anterior part of the specimens is oriented to the left.

2.4. DNA Barcodes

When possible, we generated DNA barcodes to corroborate species identity or to provide newly generated sequences for specimens. We chose two genetic markers, the D1-D2 section of the 28S rDNA and the cytochrome c oxidase I gene (COI). The genomic DNA was extracted from the tissue samples, including additional samples from Merchán-Mayorga et al. [13], using the E.Z.N.A. Tissue DNA Kit (Omega Bio-Tek, Norcross, GA, USA) following the manufacturer’s protocol. The 28S and COI genes were amplified by polymerase chain reaction (PCR). Each reaction contained 3 μL of DNA template, 2.5 μL of 10× reaction buffer, 0.5 μL 2 mM dNTPs, 1 μL of each primer 10 pmol and 0.5 μL MyTaq DNA polymerase (Meridian Bioscience, Cincinnati, OH, USA), and finally deionized water up to reach 25 μL as final volume. The primer pair LSU_fw1 (5′ AGCGGAGGAAAAGAAACTA 3′) and LSU_rev2 (5′ AGCATCGATTTGCACGTCAG 3′) was used to amplify the 28S rDNA gene [33], and the primer pair Acotylea_COI_F (5′ ACTTTATTCTACTAATCATAAGGATATAGG 3′) and Acotylea_COI_R (5′ CTTTCCTCTATAAAATGTTACTATTTGAGA 3′) was used for the COI gene [4]. The PCR amplification conditions were 95 °C for 5 min; 35 cycles of 95 °C for 30 s, 50 °C (COI) or 55 °C (28S) for 30 s, and 72 °C for 60 s; and 72 °C for 5 min. PCR products were then sent to GenCore (Universidad de los Andes, Bogotá, Colombia) or MacroGen (Seoul, South Korea) for purification and Sanger sequencing. Finally, sequences were analyzed and edited with 4Peaks (v. 1.8) [34], assembled on AliView (v. 1.28) [35], and verified by comparison with those deposited in GenBank using the NCBI BLAST tool (v. 2.17.0) (www.ncbi.nlm.nih.gov). All sequences were deposited in GenBank (see Section 3.1).

3. Results

A total of 29 acotylean species are now recorded for Colombia, including those reported prior to this study and those newly collected in our survey. Along the coast of Santa Marta, we sampled 22 species of acotylean flatworms, belonging to 14 genera and 10 families. For 20 of these, at least one DNA sequence was obtained for the 28S rDNA and/or COI mtDNA gene. Among the species examined, 11 represent new records for Colombia, and five are new records for the Caribbean Sea: Latocestus brasiliensis Hyman, 1955; Notocomplana martae (Marcus, 1948); Interplana evelinae (Marcus, 1952); Triadomma curvum Marcus, 1949; Adenoplana evelinae Marcus, 1950 (see Table 1). For 25 species, high-definition photographs of live specimens and corresponding histological sections are provided (see Taxonomic Account in Section 3.2). The checklist of all acotylean species recorded to date from the Colombian Caribbean is presented in the following section.

3.1. Checklist for Acotylean Flatworms of the Colombian Caribbean

The checklist of all acotylean species recorded to date from the Colombian Caribbean is presented in the Table 1.
Table 1. Species of acotylean flatworms found on the Caribbean coast of Colombia, sampling sites where they were found, general distribution of the species, and accession numbers for the COI and 28S DNA genes. Sampling sites: I: Inca Inca Bay; T: Taganga Bay; B: Bahía Concha; N: Neguanje Bay. Country abbreviations: AG: Antigua and Barbuda; AW: Aruba; BB: Barbados; BS: Bahamas; BQ: Bonaire; BR: Brazil; CA: Canada; CO: Colombia; CV: Cabo Verde; CU: Cuba; CW: Curaçao; GD: Grenada; JM: Jamaica; MX: México; PR: Puerto Rico; SX: Saint Martin; TT: Trinidad and Tobago; US: United States; VE: Venezuela; VI: Virgin Islands (US). ** = First record for the Caribbean Sea; * = First record for Colombia.
Table 1. Species of acotylean flatworms found on the Caribbean coast of Colombia, sampling sites where they were found, general distribution of the species, and accession numbers for the COI and 28S DNA genes. Sampling sites: I: Inca Inca Bay; T: Taganga Bay; B: Bahía Concha; N: Neguanje Bay. Country abbreviations: AG: Antigua and Barbuda; AW: Aruba; BB: Barbados; BS: Bahamas; BQ: Bonaire; BR: Brazil; CA: Canada; CO: Colombia; CV: Cabo Verde; CU: Cuba; CW: Curaçao; GD: Grenada; JM: Jamaica; MX: México; PR: Puerto Rico; SX: Saint Martin; TT: Trinidad and Tobago; US: United States; VE: Venezuela; VI: Virgin Islands (US). ** = First record for the Caribbean Sea; * = First record for Colombia.
SpeciesSampling SiteDistributionCOI28S
Hoploplana cf. divae Marcus, 1950TBR, CO, CW, MX--
Idioplana atlantica (Bock, 1913) *-CO, CU, MX, VI--
Latocestus brasiliensis Hyman, 1955 **B, N, TBR, COPX243317PX093734
Latocestus sp.B, I, NCOPX243318PX093735
PX093736
Latocestidae sp.BBR, COPX243319PX093737
Stylochus sp. *I, N, TCOPX243320PX093738
PX093739
Chatziplana grubei (Graff, 1892)-CA, CO, MX, US, VIPX243321 PX243322PX093740
Gnesioceros sargassicola (Mertens, 1833)B, I, N, TBS, CV, MX, USPX243323
PX243324
PX093741
PX093742
PX093743
Styloplanocera fasciata (Schmarda, 1859)B, I, N, TAW, BQ, BB, CO, CU, CW, JM, PR, VIPX243325
PX243326
PX093744
PX093745
Amyris hummelincki Marcus and Marcus, 1968 *B, NBQ, CO, CW-PX093746
PX093747
Notoplana queruca Marcus and Marcus, 1968-CO, CW, SX--
Notoplana insularis Hyman, 1939-CO, PR, TT, US, VI--
Notoplana cf. tipuca (Marcus and Marcus, 1968)B, NCO, CWPX250279PX093748
PX093749
Notocomplana ferruginea (Schmarda, 1859)B, I, N, TBQ, BH, CO, CW, JM, MX, PRPX250280
PX250281
PX250282
PX093752
PX093753
PX093754
Notocomplana martae (Marcus, 1948) **TBR, COPX250283PX093755
Notocomplana sp.B, NCO--
Armatoplana divae (Marcus, 1947)B, I, N, TBR, COPX250284
PX250285
PX093756
PX093757
Armatoplana colombiana Bolaños, Quiroga and Litvaitis, 2006I, TCOPX250286PX093758
PX093759
Armatoplana leptalea (Marcus, 1947) *B, I, N, TAG, BR, CO, CW, USPX250287
PX250288
PX250289
PX093760 PX093761
PX093762
Interplana evelinae (Marcus, 1952) **NBR, CO--
Phaenoplana longipenis (Hyman, 1953)-CO, MX, US--
Phaenocelis medvedica Marcus, 1952B, I, N, TBR, CO, MXPX244713
PX244714
PX093763
Phaenocelis peleca Marcus and Marcus, 1968 *B, NCO, CW, MXPX244715PX093764
PX093765
Phaenocelis cf. purpurea (Schmarda, 1859)NCO, CW, JM, USPX244716PX093766
PX093767
Triadomma curvum Marcus, 1949 **N, TBR, COPX244717PX093768
PX093769
Adenoplana evelinae Marcus, 1950 **B, I, TBR, COPX244814
PX244815
PX093770 PX093771 PX093772
PX093773
Adenoplana obovata (Schmarda, 1859)-CO, JM--
Ilyella yrsa (Marcus and Marcus, 1968) *B, I, TAG, AW, BQ, CO, CW, GD, VEPX244816PX093750
PX093751

3.2. Taxonomic Account

Phylum Platyhelminthes Minot, 1985
Subphylum Rhabditophora Ehlers, 1985
Order Polycladida Lang, 1884
Suborder Acotylea Lang, 1884
Superfamily Stylochoidea Poche, 1926
Family Hoploplanidae Stummer-Traunfels, 1933
Genus Hoploplana Laidlaw, 1902
Hoploplana cf. divae Marcus, 1950
Material examined: CBUMAG:PLA:00152, a single specimen preserved in 70% EtOH, immature, 2.2 mm × 1.27 mm.
Distribution: Originally described from São Paulo, Brazil [23], this species was later recorded in Curaçao [25], as well as in northeastern and southeastern Brazil [32,36], and the Gulf of Mexico [9]. This is the first record for Colombia.
Remarks: Only a single juvenile specimen was found beneath rocks. Although this species is typically associated with bryozoans, no individuals were found among the bryozoan colonies inspected during our study. Its presence in multiple regions could suggest that it may be widely distributed across the Tropical Atlantic. The specimen collected exhibited the characteristic dorsal papillae, eyespot arrangement, and coloration previously described for H. divae (Figure 2). However, given that it was an immature specimen, no molecular sequences were obtained, and the genus Hoploplana includes 15 species with similar morphological traits, 6 having dorsal papillae [14,31,37], we consider that the presence of H. divae on the Caribbean Coast of Colombia still requires further confirmation.
Figure 2. Hoploplana cf. divae Marcus, 1950. (A) Photograph of live specimen; (B) Detail of tentacles and eyespot organization; (C) Detail of the dorsal papillae. ce: cerebral eyespots; pa: papillae; te: tentacles; ten: tentacular eyespots.
Figure 2. Hoploplana cf. divae Marcus, 1950. (A) Photograph of live specimen; (B) Detail of tentacles and eyespot organization; (C) Detail of the dorsal papillae. ce: cerebral eyespots; pa: papillae; te: tentacles; ten: tentacular eyespots.
Taxonomy 05 00051 g002
Family Idioplanidae Dittman, Cuadrado, Aguado, Noreña and Egger, 2019
Genus Idioplana Woodworth, 1898
Idioplana atlantica (Bock, 1913)
Synonyms:
Idioplanoides atlantica (Bock, 1913)
Idioplanoides atlanticum Bock, 1913
Woodworthia atlantica Bock, 1913
Distribution: Described from St. Thomas, US Virgin Islands [38]. It has also been reported from Cuba [8] and the Yucatán Peninsula, Mexico [9]. This is the first formal record for Colombia.
Remarks: This species was not collected during the present study, but it was previously identified as Acotylea sp. 2 from Playa Cristal in Neguanje Bay, Santa Marta by Quiroga et al. [11]. It exhibits a rounded body shape, short nuchal tentacles, and a distinctive dorsal pattern of brown rings on a white or cream background (Figure 3). Only three species have been described within this genus [31], and this is the only one in the region known to display such a unique color pattern. Although the specimen collected by Quiroga et al. [11] was immature, additional photographs provided by the authors were used to support the identification (Figure 3).
Figure 3. Idioplana atlantica (Bock, 1913). (A) Photograph of live specimen; (B) Detail of tentacles and eyespot organization. ce: cerebral eyespots; me: marginal eyespots; te: tentacles; ten: tentacular eyespots.
Figure 3. Idioplana atlantica (Bock, 1913). (A) Photograph of live specimen; (B) Detail of tentacles and eyespot organization. ce: cerebral eyespots; me: marginal eyespots; te: tentacles; ten: tentacular eyespots.
Taxonomy 05 00051 g003
Family Latocestidae Laidlaw, 1903
Genus Latocestus Plehn, 1896
Latocestus brasiliensis Hyman, 1955
Material examined: CBUMAG:PLA:00104, mature specimen as sagittal sections and a whole mount, 17 mm × 2 mm. CBUMAG:PLA:00082, mature specimen as a whole mount, only anterior part of the body, 19 mm × 2 mm. AMNH 682, one specimen as a whole mount.
Distribution: Described from São Francisco do Sul Island in southeastern Brazil [39,40], and later recorded from northeastern Brazil [40]. This is the first record for Colombia and the Caribbean Sea.
Remarks: The reproductive morphology seen in our histological sections corresponds with the original description and illustration provided by Hyman [39] and the sections published by Bahia et al. [40], by having a broad penis papilla, slightly muscular spermiducal bulbs, and a vagina running anteriorly a short distance and then to the posterior, ending in an oval Lang’s vesicle. Hyman [39] described the species based on fixed material and therefore did not report the coloration of live specimens. Bahia et al. [40] described their specimens as “greyish beige”, while those collected in the present study have a whitish translucent body with a central green or yellow region, likely due to the gut content (Figure 4A). The posteriorly positioned pharynx is pink, as also noted in the photograph published by Bahia et al. (2015) [40]. Additionally, the arrangement of the eyespots from our specimens matches (Figure 4B) that of the paratype (AMNH 682). We provide the first 28S rDNA and COI mtDNA sequences for the species (Table 1). Although we could not confirm the species identity through molecular comparison due to the absence of previously available sequences for this species, BLAST analysis of the 28S sequences showed high similarity (>97%) with other latocestid sequences deposited in GenBank. To date, no COI sequences have been published for any member of this family.
Figure 4. Latocestus brasiliensis Hyman, 1955. (A) Photograph of live specimen; (B) Detail of the eyespot arrangement from whole mount (CBUMAG:PLA:00104); (C) Detail of the far posterior, ventral view; (D,E) sagittal sections of reproductive structures (CBUMAG:PLA:00104); am: male atrium; b: brain; ce: cerebral eyespots; fe: frontal eyespots; fp: female pore; i: intestine; lv: Lang’s vesicle; m: mouth; me: marginal eyespots; mp: male pore; ov: oviduct; ph: pharynx; pv: prostatic vesicle; spb: spermiducal bulb; v: vagina.
Figure 4. Latocestus brasiliensis Hyman, 1955. (A) Photograph of live specimen; (B) Detail of the eyespot arrangement from whole mount (CBUMAG:PLA:00104); (C) Detail of the far posterior, ventral view; (D,E) sagittal sections of reproductive structures (CBUMAG:PLA:00104); am: male atrium; b: brain; ce: cerebral eyespots; fe: frontal eyespots; fp: female pore; i: intestine; lv: Lang’s vesicle; m: mouth; me: marginal eyespots; mp: male pore; ov: oviduct; ph: pharynx; pv: prostatic vesicle; spb: spermiducal bulb; v: vagina.
Taxonomy 05 00051 g004
Latocestus sp.
Material examined: CBUMAG:PLA:00083, immature specimen as a whole mount, far posterior damaged, 30 mm × 4 mm. CBUMAG:PLA:00173, mature specimen as sagittal sections and a whole mount, 20 mm × 2.5 mm. CBUMAG:PLA:00223, mature specimen as sagittal sections and a whole mount, 30 mm × 3.74 mm. CBUMAG:PLA:00268, mature specimen preserved in 70% EtOH.
Distribution: Collected in the present study from Bahía Concha, Inca Inca Bay and Neguanje Bay.
Remarks: The dorsal surface is covered with brown to orange dots, resembling Enchiridium evelinae Marcus, 1949; however, the pigment is concentrated towards the posterior and less noticeable anteriorly (Figure 5A). This pattern is preserved after fixation and clearing, although it becomes much less noticeable compared to live specimens. Marginal eyes are more densely distributed in the anterior region, becoming fewer and smaller posterior to the level of the brain. The region between the brain and the anterior margin is filled with eyespots organized in a fan-like pattern (Figure 5B). The pharynx is located at the far posterior portion of the body (Figure 5C), as typical of Latocestidae [14]. Additionally, we observed what appears to be a sclerotized structure similar to bristle worms’ chaetae inside the intestine in the slides of one of the specimens (Figure 5E). According to Faubel [14], the genera within the family can be distinguished based on the interior lining in the prostatic vesicle. Our specimens exhibit a ridged prostatic lining, well-developed spermiducal bulbs, and an oval Lang’s vesicle, which are diagnostic characters of the genus Latocestus (Figure 5D,E). We provide the 28S rDNA and COI mtDNA sequences for this morphospecies (Table 1). The BLAST analysis shows high similarity with Latocestus sp. (MH700317 = 98.9%; MH700318 = 99.1%); however, the reproductive morphology of this species is not available. Due to the lack of documentation on the live coloration of species within the genus and the scarcity of DNA sequences available for the family, we assigned our specimens only to the generic level until additional morphological and molecular data become available.
Figure 5. Latocestus sp. (A) Photograph of live specimen; (B) Detail of the eyespot arrangement from whole mount (CBUMAG:PLA:00083); (C) Detail of the far posterior, ventral view; (D,E) sagittal sections of reproductive structures (CBUMAG:PLA:00223). am: male atrium; b: brain; ce: cerebral eyespots; fe: frontal eyespots; fp: female pore; i: intestine; lv: Lang’s vesicle; m: mouth; me: marginal eyespots; mp: male pore; ov: oviduct; ph: pharynx; pv: prostatic vesicle; spb: spermiducal bulb; v: vagina.
Figure 5. Latocestus sp. (A) Photograph of live specimen; (B) Detail of the eyespot arrangement from whole mount (CBUMAG:PLA:00083); (C) Detail of the far posterior, ventral view; (D,E) sagittal sections of reproductive structures (CBUMAG:PLA:00223). am: male atrium; b: brain; ce: cerebral eyespots; fe: frontal eyespots; fp: female pore; i: intestine; lv: Lang’s vesicle; m: mouth; me: marginal eyespots; mp: male pore; ov: oviduct; ph: pharynx; pv: prostatic vesicle; spb: spermiducal bulb; v: vagina.
Taxonomy 05 00051 g005
Latocestidae sp.
Material examined: CBUMAG:PLA:00130, mature specimen as sagittal sections and an anterior mount, 26 mm × 7.9 mm.
Distribution: Found in the present study only in Bahía Concha.
Figure 6. Latocestidae sp. (A) Photograph of live specimen; (B) Detail of the eyespot arrangement from whole mount; (C) Detail of the far posterior, ventral view; (D,E) sagittal sections of reproductive structures. am: male atrium; b: brain; ce: cerebral eyespots; fe: frontal eyespots; gp: gonopores; lv: Lang’s vesicle; m: mouth; me: marginal eyespots; mp: male pore; ph: pharynx; pp: penis papilla; pv: prostatic vesicle; spb: spermiducal bulbs; v: vagina.
Figure 6. Latocestidae sp. (A) Photograph of live specimen; (B) Detail of the eyespot arrangement from whole mount; (C) Detail of the far posterior, ventral view; (D,E) sagittal sections of reproductive structures. am: male atrium; b: brain; ce: cerebral eyespots; fe: frontal eyespots; gp: gonopores; lv: Lang’s vesicle; m: mouth; me: marginal eyespots; mp: male pore; ph: pharynx; pp: penis papilla; pv: prostatic vesicle; spb: spermiducal bulbs; v: vagina.
Taxonomy 05 00051 g006
Remarks: The external appearance and the organization of the male apparatus place it in the family Latocestidae (Figure 6). The reproductive system corresponds to that of the genus Latocestus (Figure 6D,E); however, our specimens present a distinctive broad band of marginal eyes around the entire body. This type of marginal eye arrangement has so far only been reported in the genus Nonatona Marcus, 1952, which possesses a typical Latocestus reproductive system, except for the presence of a ductus vaginalis [24]. Our specimen external appearance and reproductive anatomy agree with the characters of Nonatona, which only has the species Nonatona euscopa Marcus, 1952; however, while our specimen has the broad marginal band of eyes, these are not that densely grouped, nor is the band that broad, as mentioned by Marcus for N. euscopa [24]. Additionally, our specimen also differs by having a more pronounced conical penis papilla than N. euscopa (Figure 6E). Furthermore, due to our only specimen posterior not being in good shape after the histology, we were not able to clearly distinguish the existence of a ductus vaginalis or a female pore (Figure 6D,E). Finally, we believe that, while similar to the only member of Nonatona, more material is needed to accurately place this morphospecies inside the family Latocestidae. We provide a 28S rDNA sequence for the morphospecies, which shows high similarity with other Latocestid sequences in GenBank (Latocestus sp. MH700318 = 97.2%; Latocestus sp. MK299377 = 97.4%), and a COI mtDNA sequence (Table 1).
Family Stylochidae Stimpson, 1857
Genus Stylochus Ehrenberg, 1831
Stylochus sp.
Material examined: CBUMAG:PLA:00134, mature specimen as a whole mount, 20.6 mm × 13 mm. CBUMAG:PLA:00293, mature specimen as sagittal sections and a whole mount, 20 mm × 14 mm. CBUMAG:PLA:00316, mature specimen preserved in 70% EtOH, 27.8 mm × 17.3 mm.
Distribution: Inca Inca Bay, Taganga Bay, and Neguanje Bay. This represents the first record of the genus Stylochus and family Stylochidae in Colombia.
Remarks: Specimens were found beneath rocks, and one was collected in the swash zone of a cliff. Specimens exhibited a relatively large body size and firm consistency. Cream coloration with orange/pinkish dots on the dorsal surface, a pattern shared with several stylochids (Figure 7A). Our specimens possess a tripartite, anchor-shaped seminal vesicle and a prostatic vesicle with extravesicular polyglandular glands, features typical of several Stylochus species [14] (Figure 7D,E). In terms of body shape, coloration, and reproductive anatomy, our specimens resemble Stylochus oculifera (Girard, 1853) as described by Hyman [28], Marcus and Marcus [25], and later from Bulnes et al. [41]. However, our 28S rDNA sequences do not closely match those available in GenBank for this species (HQ6590007 = 94.9%; MH700311 = 93.94%), having a higher similarity with a sequence identified as Imogine sp. (=Stylochus sp.) (MH700312 = 99.47%). This discrepancy suggests that the specimens may represent a different species. Therefore, we assign them to the genus Stylochus only. It is important to note that the reference sequences in GenBank lack associated detailed morphological descriptions, which limits the ability to make definitive comparisons. We provide both 28S rDNA and COI mtDNA sequences for our species (Table 1).
Family Stylochocestidae Bock, 1913
Genus Chatziplana Faubel, 1983
Chatziplana grubei (Graff, 1892)
Synonyms:
Hoploplana grubei (Graff, 1892)
Planocera grubei Graff, 1892
Material examined: CBUMAG:PLA:00627, mature specimens as a whole mount, 7 mm × 4 mm. CBUMAG:PLA:00631, mature specimen as sagittal sections. Measurement from fixed specimen.
Distribution: Described from specimens found floating in algae from the Atlantic [42]. Subsequent records from Canada [43], St. Thomas, US Virgin Islands [38], the Sargasso Sea and the Gulf of Mexico [26,44], the Mexican Caribbean [45], and the Colombian Caribbean [13].
Remarks: We inspected the Sargassum associated with the rocky shores of the Santa Marta region, but we did not find this species. Using additional tissue samples from deposited at the Centro de Colecciones Científicas de la Universidad del Magdalena, obtained from floating Sargassum collected in the Parque Nacional Natural Corales de Profundidad, located in the Bolívar department [13], we generated the first COI mtDNA sequences for the species, along with an additional 28S rDNA sequence (Chatziplana grubei PQ962884 = 97.6%) (Table 1).
Figure 8. Chatziplana grubei (Graff, 1892). (A,B) CBUMAG:PLA:00627. (A) Photograph of a specimen in whole mount; (B) Detail of the eyespot organization from whole mount; (C) sagittal sections of reproductive structures (CBUMAG:PLA:00631). ce: cerebral eyespots; mb: muscle bulb; ov: oviduct; pv: prostatic vesicle; spb: spermiducal bulbs; st: stylet; te: tentacles; ten: tentacular eyespots; v: vagina.
Figure 8. Chatziplana grubei (Graff, 1892). (A,B) CBUMAG:PLA:00627. (A) Photograph of a specimen in whole mount; (B) Detail of the eyespot organization from whole mount; (C) sagittal sections of reproductive structures (CBUMAG:PLA:00631). ce: cerebral eyespots; mb: muscle bulb; ov: oviduct; pv: prostatic vesicle; spb: spermiducal bulbs; st: stylet; te: tentacles; ten: tentacular eyespots; v: vagina.
Taxonomy 05 00051 g008
Superfamily Leptoplanoidea Faubel, 1984
Family Gnesiocerotidae Marcus and Marcus, 1966
Genus Gnesioceros Diesing, 1862
Gnesioceros sargassicola (Mertens, 1833)
Synonyms:
Gnesioceros floridana (Pearse, 1938)
Gnesioceros mertens (Diesing, 1850)
Gnesioceros mertensi (Diesing, 1850)
Gnesioceros verrilli Hyman, 1939
Imogine oculifera Verrill, 1892
Pelagoplana sargassicola (Mertens, 1833)
Planaria sargassicola Mertens, 1833
Planocera sargassicola (Mertens, 1833)
Stylochoplana floridana Pearse, 1938
Stylochoplana oculifera Pearse and Walker, 1939
Stylochoplana sargassicola (Mertens, 1833)
Stylochus mertensi Diesing, 1850
Stylochus pelagicus Moseley, 1877
Stylochus sargassicola (Mertens, 1833)
Figure 9. Gnesioceros sargassicola (Mertens, 1833). (A) Photograph of live specimens. (B,C) CBUMAG:PLA:00265. (B) Detail of the eyespot organization from whole mount; (C) Detail of the posterior portion of the body, ventral view; (D,E) sagittal sections of reproductive structures (CBUMAG:PLA:00266). am: male atrium; ce: cerebral eyespots; ci: cirrus; fp: female pore; lv: Lang’s vesicle; mp: male pore; o: ovaries; pv: prostatic vesicle; spt: spermatophore; te: tentacle; ten: tentacular eyespots; v: vagina; vb: vagina bulbosa.
Figure 9. Gnesioceros sargassicola (Mertens, 1833). (A) Photograph of live specimens. (B,C) CBUMAG:PLA:00265. (B) Detail of the eyespot organization from whole mount; (C) Detail of the posterior portion of the body, ventral view; (D,E) sagittal sections of reproductive structures (CBUMAG:PLA:00266). am: male atrium; ce: cerebral eyespots; ci: cirrus; fp: female pore; lv: Lang’s vesicle; mp: male pore; o: ovaries; pv: prostatic vesicle; spt: spermatophore; te: tentacle; ten: tentacular eyespots; v: vagina; vb: vagina bulbosa.
Taxonomy 05 00051 g009
Material examined: CBUMAG:PLA:00265, one mature specimen as whole mount, 10 mm × 3 mm, and 3 mature specimens in 70% EtOH. CBUMAG:PLA:00266, one mature specimen as sagittal sections, 7 mm × 3 mm, and 6 mature and immature specimens in 70% EtOH. CBUMAG:PLA:00288, 5 immature specimens in 70% EtOH. CBUMAG:PLA:00348, 5 mature and immature specimens in 70% EtOH. CBUMAG:PLA:00404, one mature specimen in 70% EtOH. Measurements from fixed material.
Distribution: Widely distributed across the Tropical Western Atlantic, recorded as clinging fauna and found in littoral environments. Records from floating habitats include the Sargasso Sea [46], the Caribbean Sea [43], the Gulf of Mexico [47], and the North Atlantic Ocean [44,48,49]; additionally, the species has been recorded in the littoral from Bermuda [26], St. Thomas, from Texas to Massachusetts [25,50], Cape Verde [51], Cayman Islands [48], Curaçao, Bonaire, Puerto Rico, St. Barthelemy [25], Canary Islands [52], and in Colombia [11,13].
Remarks: We found specimens both beneath rocks and associated with Sargassum on the rocky shores. Some specimens were also found in floating remains of a water hyacinth, a plant that is usually carried out to the sea by rivers. Our whole mount preparations also reveal the crescent-shaped Lang’s vesicle noted by Hyman [26] and observed by Merchán-Mayorga et al. [13] (Figure 9E). Similarly, we also observed the presence of spermatophores attached to the female system in some of our specimens, likely deposited after mating, as noted also by Hyman [26], Marcus and Marcus [25], and Merchán-Mayorga et al. [13] (Figure 9C). Although the species is recurrently documented in the Tropical Western Atlantic, only a few studies, including this one, have reported the presence of spermatophores. However, the mating behavior associated with them remains unknown, requiring further investigation.
Hyman [50] distinguished the pelagic G. sargassicola from the “shore-associated” Gnesioceros floridana Hyman, 1939 based on the presence of a ring-shaped musculo-glandular fold in the former and an incomplete ring fold in the latter. However, in a subsequent work, it was suggested that both might represent the same species [47]. Marcus and Marcus [25] examined several specimens from floating Sargassum and from shore algae, and found no significant differences in the female reproductive structures, subsequently synonymizing G. floridana with G. sargassicola. Our specimens from rocky shores, as well as specimens from floating Sargassum [13], show no anatomical differences. The molecular sequences obtained from our specimens were nearly identical to each other (97–99.4%) and showed high similarity with those reported by Merchán-Mayorga et al. [13] (PQ962885 = 99.6%) and Litvaitis et al. [53] (MH700309 = 99.6%). This strong genetic similarity, together with the lack of distinguishing morphological differences between the specimens found on the rocky shore and those from floating Sargassum, potentially supports the synonymy of G. floridana and G. sargassicola as proposed by Marcus and Marcus [25]. We provide additional 28S rDNA and the first COI mtDNA sequences both from our specimens and from additional samples already deposited at the Centro de Colecciones Científicas de la Universidad del Magdalena [13] (Table 1).
Genus Styloplanocera Bock, 1913
Styloplanocera fasciata (Schmarda, 1859)
Synonyms:
Stylochoplana fasciata (Schmarda, 1859)
Stylochus fasciatus Schmarda, 1859
Styloplanocera papillifera Bock, 1913
Figure 10. Styloplanocera fasciata (Schmarda, 1859). (A) Photograph of live specimen; (B) Detail of the eyespot organization from whole mount (CBUMAG:PLA:00640); (C) Detail of the posterior, ventral view; (D) (INVPLA0025) and (E) (CBUMAG:PLA:00640) sagittal sections of reproductive structures. af: female atrium; am: male atrium; ce: cerebral eyespots; ci: cirrus; fp: female pore; lv: Lang’s vesicle; mk: marginal knobs; mp: male pore; ov: oviduct; ph: pharynx; pv: prostatic vesicle; te: tentacle; ten: tentacular eyespots; u: uterus; v: vagina; vb: vagina bulbosa.
Figure 10. Styloplanocera fasciata (Schmarda, 1859). (A) Photograph of live specimen; (B) Detail of the eyespot organization from whole mount (CBUMAG:PLA:00640); (C) Detail of the posterior, ventral view; (D) (INVPLA0025) and (E) (CBUMAG:PLA:00640) sagittal sections of reproductive structures. af: female atrium; am: male atrium; ce: cerebral eyespots; ci: cirrus; fp: female pore; lv: Lang’s vesicle; mk: marginal knobs; mp: male pore; ov: oviduct; ph: pharynx; pv: prostatic vesicle; te: tentacle; ten: tentacular eyespots; u: uterus; v: vagina; vb: vagina bulbosa.
Taxonomy 05 00051 g010
Material examined: CBUMAG:PLA:00088, one mature specimen in 70% EtOH, 18 mm × 10 mm. CBUMAG:PLA:00089, one mature specimen in 70% EtOH. CBUMAG:PLA:00334, one mature specimen in 70% EtOH, 32 mm × 13.67 mm. CBUMAG:PLA:00417, one mature specimen in 70% EtOH, 34.4 mm × 9.4 mm. CBUMAG:PLA:00551, one immature specimen in 70% EtOH, 18.1 mm × 6.2 mm. CBUMAG:PLA:00640, one mature specimen as sagittal sections of the reproductive structures and an anterior mount, 20 mm × 9 mm. CBUMAG:PLA:00641, one mature specimen as a whole mount, 15 mm × 5 mm. INVPLA0025, mature specimen as sagittal sections of the reproductive structures.
Distribution: Aruba, Curaçao, Bonaire, Barbados, St. Croix, Virgin Islands [25], Puerto Rico [29], Jamaica [54], Cuba [8], and Colombia [11].
Remarks: Styloplanocera fasciata is probably one of the most common polyclads in the Caribbean Sea [7]. Based on our field observations, although the species was commonly encountered throughout the sampling, it was more frequently observed on rocky shores with exposure to strong wave action, whereas its presence was notably reduced on more sheltered shores characterized by greater accumulation of coral rubble. All our specimens showed the characteristic dorsal coloration pattern with grey or brown blotches and dots, as well as the presence of marginal papillae [25] (Figure 10A,C). Additionally, they showed the cuticular cirrus armed with spines as described by Faubel [14] (Figure 10D). We provide additional 28S rDNA sequences that were nearly identical to each other (PX093744 vs. PX093745 = 99%), and which show high similarity with the available sequences of the species (e.g., MH700408 = 99.6%), and the first COI mtDNA sequences for the species (Table 1).
Family Notoplanidae Marcus and Marcus, 1966
Genus Amyris Marcus and Marcus, 1968
Amyris hummelincki Marcus and Marcus, 1968
Synonyms:
Amyris ujara Marcus and Marcus, 1968
Material examined: CBUMAG:PLA:00183, one mature specimen in 70% EtOH, 14 mm × 3 mm. CBUMAG:PLA:00225, one mature specimen as sagittal sections and preserved in 70% EtOH, 23.7 mm × 2 mm. CBUMAG:PLA:00426, one mature specimen as a whole mount, 24.7 mm × 2.5 mm. CBUMAG:PLA:00513, one mature specimen in 70% EtOH, 16.6 mm × 2.5 mm. CBUMAG:PLA:00539, one mature specimen in 70% EtOH, 11.4 mm × 2.5 mm. CBUMAG:PLA:00547, one mature specimen in 70% EtOH, 11.7 mm × 1.4 mm. CBUMAG:PLA:00549, one mature specimen in 70% EtOH, 21 mm × 3.2 mm.
Distribution: Curaçao and Bonaire [25]. This study provides the first formal record for Colombia.
Remarks: We observed the presence of cirrus spines from our slides and whole mount (Figure 11C,D). Marcus and Marcus [25] did not observe a spinous cirrus; however, our observations are consistent with the comment by Litvaitis et al. [53] of Amyris possessing an armed penis papilla. Faubel [14] assigned the genus Amyris to the family Notoplanidae, a placement that was later supported by both molecular and morphological evidence [53]. However, Amyris was transferred erroneously to Faubelidae Özdikmen, 2010, along with other genera, after a misunderstanding of it being considered part of Notocirridae Faubel, 1983 [55]. A more detailed discussion of this taxonomic misclassification is provided by Ramos-Sánchez et al. [56]. We continue to follow the classification of Amyris hummelincki in Notoplanidae. We provide additional 28S rDNA sequences for the species that show high similarity with the previously available sequences (e.g., MH700271 = 98.5%) (Table 1).
Figure 11. Amyris hummelincki Marcus and Marcus, 1968. (A) Photograph of live specimen; (B,C) CBUMAG:PLA:00426. (B) Detail of the eyespot organization from whole mount; (C) Detail of the cirrus, ventral view from whole mount; (D,E) sagittal sections of reproductive structures (CBUMAG:PLA:00225). b: brain; ce: cerebral eyespots; ci: cirrus; cs: cirrus spines; fp: female pore; lv: Lang’s vesicle; mp: male pore; ov: oviduct; pv: prostatic vesicle; sv: seminal vesicle; ten: tentacular eyespots; v: vagina.
Figure 11. Amyris hummelincki Marcus and Marcus, 1968. (A) Photograph of live specimen; (B,C) CBUMAG:PLA:00426. (B) Detail of the eyespot organization from whole mount; (C) Detail of the cirrus, ventral view from whole mount; (D,E) sagittal sections of reproductive structures (CBUMAG:PLA:00225). b: brain; ce: cerebral eyespots; ci: cirrus; cs: cirrus spines; fp: female pore; lv: Lang’s vesicle; mp: male pore; ov: oviduct; pv: prostatic vesicle; sv: seminal vesicle; ten: tentacular eyespots; v: vagina.
Taxonomy 05 00051 g011
Genus Notoplana Laidlaw, 1903
Notoplana queruca Marcus and Marcus, 1968
Material examined: INVPLA0011, mature specimen in sagittal sections.
Distribution: Curaçao, St. Martin, Florida Keys (US) [25], and Colombia [11].
Remarks: We confirm the identification by Quiroga et al. [11] after examining their sectioned specimen and additional photographs provided by the authors. From the sections, it is possible to distinguish the “carrot-shaped” seminal vesicle interpolated with the prostatic vesicle with a proximal conical projection of the ejaculatory duct (Figure 12B), as well as the long-folded male antrum. In addition, the vagina runs almost horizontally, as mentioned in the species description [25]. This species was not encountered during our sampling; however, we provide a photograph of the live specimen and sagittal sections of reproductive structures from Quiroga et al. [11] material.
Figure 12. Notoplana queruca Marcus and Marcus, 1968. (A) Photograph of live specimen, taken by Quiroga and Bolaños in 2002; (B,C) sagittal sections of reproductive structures. e: eyespots; ph: pharynx; ov: oviduct; pv: prostatic vesicle; sv: seminal vesicle; u: uterus; v: vagina; vd: vas deferens.
Figure 12. Notoplana queruca Marcus and Marcus, 1968. (A) Photograph of live specimen, taken by Quiroga and Bolaños in 2002; (B,C) sagittal sections of reproductive structures. e: eyespots; ph: pharynx; ov: oviduct; pv: prostatic vesicle; sv: seminal vesicle; u: uterus; v: vagina; vd: vas deferens.
Taxonomy 05 00051 g012
Notoplana insularis Hyman, 1939
Material examined: USNM 20423, anterior mount and sagittal sections of the holotype, 9 mm × 3 mm [27]. USNM 24633–24635, whole mounts.
Distribution: Providencia Island, Colombia [27], Florida (US), St. Thomas (VI), Puerto Rico, and Trinidad [29].
Remarks: Notoplana insularis was originally described by Hyman [27] from a specimen collected on Providencia Island (=Old Providence). In a later study, Hyman [29] reported the species from additional localities, suggesting that it may be a common species throughout the Caribbean and Antillean Arc. However, we did not encounter this species along the Santa Marta coast.
After reviewing the type material (USNM 20423, Figure 13), we found that the histological sections are in poor condition, hindering a thorough evaluation. Further sampling from the type locality and other sites is required. Photographic documentation of the type material is provided (Figure 13).
Figure 13. Notoplana insularis Hyman, 1939. (A,B) Holotype USNM20423, (C) Paratype USNM24634. (A) Photograph of the anterior mount. (B) sagittal section of reproductive structures. (C) Whole mount. e: eyespots; ph: pharynx; pv: prostatic vesicle; st: stylet; sv: seminal vesicle.
Figure 13. Notoplana insularis Hyman, 1939. (A,B) Holotype USNM20423, (C) Paratype USNM24634. (A) Photograph of the anterior mount. (B) sagittal section of reproductive structures. (C) Whole mount. e: eyespots; ph: pharynx; pv: prostatic vesicle; st: stylet; sv: seminal vesicle.
Taxonomy 05 00051 g013
Notoplana cf. tipuca Marcus and Marcus, 1968
Material examined: CBUMAG:PLA:00215, mature specimen as sagittal sections of reproductive structures and anterior mount, 27 mm × 4 mm. CBUMAG:PLA:00408, mature specimen preserved in 70% EtOH, 17.6 mm × 4.9 mm. CBUMAG:PLA:00409, mature specimen as sagittal sections and preserved in 70% EtOH, 21.5 mm × 3 mm. CBUMAG:PLA:00470, mature specimen as whole mount, 14.4 mm × 2.8 mm.
Distribution: Previously only known from the type locality, Piscadera Bay, Curaçao [25]. We found our specimens in Bahía Concha and Neguanje Bay.
Remarks: Found mostly under coral rubble. Our specimens possess an interpolated prostatic vesicle, with the ejaculatory duct of the seminal vesicle entering proximally into the prostatic vesicle (Figure 14D). The penis papilla is armed with a long slender stylet. The female gonopore is located far from the male pore; the vagina extends anteriorly from the pore and then coils posteriorly to end in a long Lang’s vesicle (Figure 14E). Cerebral eyespots are arranged in two groups (Figure 14B), and a band of marginal eyes encircles the body. These characters resemble those of Notoplana tipuca. However, in our specimens, the distance between the gonopores is significantly greater, ranging from 0.7 to 2 mm in fixed specimens, compared to the 0.4 mm measured by Marcus and Marcus [25] from their mounted specimen. Although these measurements are relative to specimen size, the representation of the reproductive organs indicates comparatively shorter distances than those observed in our sagittal sections (Figure 14D,E). This discrepancy may be attributed either to fixation artifacts in the original material examined by Marcus and Marcus [25] or to natural variation within the population from Curaçao. Additionally, due to the lack of photographs of the type material and absence of DNA sequences, the identity remains uncertain and requires further confirmation.
Marcus & Marcus [25] originally established the genus Igluta Marcus and Marcus, 1968 (with I. tipuca as its only species) within the family Cryptocelidae. The only other cryptocelid genus exhibiting a penis with armature and Lang’s vesicle is Amemiyaia Kato, 1944; however, contrary to Igluta, this genus has a tripartite seminal vesicle, has a coiled ejaculatory duct within the prostatic vesicle, and a vagina bulbosa [25,57]. Faubel [14] later synonymized Igluta with Notoplana based on the organization of the male apparatus, while Prudhoe [16] retained Igluta as valid, the same status is given in the Turbellarian taxonomic database [1]. Given that our molecular data show higher similarity to cryptocelid sequences than to notoplanid ones (e.g., Phaenocelis peleca MH700345 = 97.5% and Amemiyaia pacifica LC508143 = 97% vs. Notoplana sp. MH700334 = 92.6%), the reinstatement of Igluta may be necessary once additional material from the type locality becomes available. We provide 28S rDNA and COI mtDNA sequences for this morphospecies (Table 1).
Figure 14. Notoplana cf. tipuca Marcus and Marcus, 1968. (A) Photograph of live specimen; (B) Detail of the eyespot organization from whole mount (CBUMAG:PLA:00470); (C) Detail of the posterior portion of the body, ventral view; (D,E) sagittal sections of reproductive structures (CBUMAG:PLA:00409). b: brain; ce: cerebral eyespots; fp: female pore; lv: Lang’s vesicle; mp: male pore; ph: pharynx; pv: prostatic vesicle; spb: spermiducal bulbs; st: stylet; ten: tentacular eyespots; v: vagina.
Figure 14. Notoplana cf. tipuca Marcus and Marcus, 1968. (A) Photograph of live specimen; (B) Detail of the eyespot organization from whole mount (CBUMAG:PLA:00470); (C) Detail of the posterior portion of the body, ventral view; (D,E) sagittal sections of reproductive structures (CBUMAG:PLA:00409). b: brain; ce: cerebral eyespots; fp: female pore; lv: Lang’s vesicle; mp: male pore; ph: pharynx; pv: prostatic vesicle; spb: spermiducal bulbs; st: stylet; ten: tentacular eyespots; v: vagina.
Taxonomy 05 00051 g014
Family Notocomplanidae Litvaitis, Bolaños and Quiroga, 2019
Genus Notocomplana Faubel, 1983
Notocomplana ferruginea (Schmarda, 1859)
Synonyms:
Discocelis binoculata Verrill, 1901
Leptoplana ferruginea (Schmarda, 1859)
Melloplana ferruginea (Schmarda, 1859)
Notoplana bahamensis Bock, 1913
Notoplana binoculata (Verrill, 1901)
Notoplana caribbeana Hyman, 1939
Notoplana ferruginea Schmarda, 1859
Polycelis ferruginea Schmarda, 1859
Figure 15. Notocomplana ferruginea (Schmarda, 1859). (A) Photograph of live specimen. (B,D,E) CBUMAG:PLA:00211. (B) Detail of the eyespot organization from whole mount; (C) Detail of the posterior end, ventral view; (D,E) sagittal sections of reproductive structures. am: male atrium; ce: cerebral eyespots; fp: female pore; lv: Lang’s vesicle; m: mouth; mp: male pore; ov: oviduct; pv: prostatic vesicle; sv: seminal vesicle; ten: tentacular eyespots; v: vagina; vd: vas deferens.
Figure 15. Notocomplana ferruginea (Schmarda, 1859). (A) Photograph of live specimen. (B,D,E) CBUMAG:PLA:00211. (B) Detail of the eyespot organization from whole mount; (C) Detail of the posterior end, ventral view; (D,E) sagittal sections of reproductive structures. am: male atrium; ce: cerebral eyespots; fp: female pore; lv: Lang’s vesicle; m: mouth; mp: male pore; ov: oviduct; pv: prostatic vesicle; sv: seminal vesicle; ten: tentacular eyespots; v: vagina; vd: vas deferens.
Taxonomy 05 00051 g015
Material examined: CBUMAG:PLA:00211, mature specimen as sagittal sections and as a whole mount, only anterior part, 27.2 mm × 9.9 mm; CBUMAG:PLA:00212, mature specimen in 70% EtOH, 30.2 mm × 12 mm; CBUMAG:PLA:00214, mature specimen in 70% EtOH, 37.7 mm × 12 mm; CBUMAG:PLA:00240, mature specimen in 70% EtOH, 50.8 mm × 13 mm; CBUMAG:PLA:00241, mature specimen in 70% EtOH, 32.1 mm × 15.2 mm.
Distribution: Jamaica [54], Curaçao, Bonaire, Bahamas, Puerto Rico, Providencia Island, Colombia [25,29], the Gulf of Mexico [9] and the Colombian Caribbean coast [11].
Remarks: This was one of the most common polyclads encountered during our sampling and it is likely distributed throughout the entire Tropical Western Atlantic. While the body coloration is reported as milky white [25,27], our specimens have a clear brown tinge, especially towards the anterior margin and center of the body (Figure 15A). Additionally, after inspecting all live specimens, it was possible to distinguish a faint marginal reddish line along the anterior margin. One of the specimens exhibited markedly enlarged tentacular eyes compared to others, a variation that was once used to distinguish a separate species, Notoplana binoculata (Verrill, 1901). However, this taxon was later synonymized with N. ferruginea [29], and our examination of the reproductive structures supports this synonymy. We provide additional 28S rDNA sequences similar between each other (97.4–99%) and that show high similarity with previously available sequences (e.g., PX093753 vs. MH700322 = 97.2% and PX093754 vs. MH700323 = 99.3%), and the first COI mtDNA sequences for the species (Table 1).
Notocomplana martae (Marcus, 1948)
Synonyms:
Notoplana martae Marcus, 1948
Figure 16. Notocomplana martae (Marcus, 1948). (A) Photograph of live specimen; (B) Detail of the eyespot organization from whole mount; (C) Detail of the ventral view; (D,E) sagittal sections of reproductive structures. am: male atrium; b: brain; ce: cerebral eyespots; gp: gonopores; i: intestine; p: penis; ph: pharynx; pv: prostatic vesicle; sv: seminal vesicle; ten: tentacular eyespots; u: uterus; v: vagina; vb: vagina bulbosa.
Figure 16. Notocomplana martae (Marcus, 1948). (A) Photograph of live specimen; (B) Detail of the eyespot organization from whole mount; (C) Detail of the ventral view; (D,E) sagittal sections of reproductive structures. am: male atrium; b: brain; ce: cerebral eyespots; gp: gonopores; i: intestine; p: penis; ph: pharynx; pv: prostatic vesicle; sv: seminal vesicle; ten: tentacular eyespots; u: uterus; v: vagina; vb: vagina bulbosa.
Taxonomy 05 00051 g016
Material examined: CBUMAG:PLA:00252, one mature specimen as sagittal sections and whole mount only of the anterior portion of the body, 5.2 mm × 0.7 mm.
Distribution: Described from Ilha de São Sebastião and Ilha de Palmas, São Paulo state in southeastern Brazil [32,58]. This study presents the first record of this species for Colombia and the Caribbean Sea.
Remarks: A single specimen was collected from Sargassum in the intertidal zone of Taganga Bay. Histological sections of the reproductive structures are consistent with the original description of N. martae by Marcus [58] (Figure 16D,E), and the organization of the cerebral eyespots (Figure 16B) matches that observed in the type specimen photographs published by Bahia and Schrödl [32]. Our specimen differs only by having an additional brown coloration in contrast to the white coloration mentioned by Marcus [58] (Figure 16A); however, this difference may result from feeding on other organisms inhabiting the Sargassum mats. Marcus [58] also reported this species from algae in the upper littoral zone. Here we provide the first photographs of a live specimen (Figure 16), as well as the first 28S rDNA and COI mtDNA sequences (Table 1).
Notocomplana sp.
Material examined: CBUMAG:PLA:00136, mature specimen as sagittal sections and preserved in 70% EtOH, 33.6 mm × 14.4 mm; CBUMAG:PLA:00406, mature specimen as sagittal sections and preserved in 70% EtOH, 26.9 mm × 8.3 mm; CBUMAG:PLA:00453, mature specimen as sagittal sections and anterior mount, 25.7 mm × 6.4 mm.
Distribution: Found in Bahía Concha and Neguanje bay.
Remarks: This morphospecies was less common than N. ferruginea during our sampling. Internally, this species is characterized by the presence of a bigger conical penis papilla and a small oval Lang’s vesicle (Figure 17D,E). Additional characters include gonopores far from each other, interpolated prostatic vesicle with a projection of the ejaculatory duct, and a seminal vesicle relatively of similar size and ventral to the prostatic vesicle (Figure 17D). The vagina shows various folds, runs anteriorly and then turns towards the posterior (Figure 17E).
Our specimens are externally similar in size and coloration to N. ferruginea and could easily be mistaken for that species. However, they lack the marginal reddish line that characterizes N. ferruginea. Internally, there are some differences from other Notocomplana species present in the West Atlantic, including the presence of a small and oval Lang’s vesicle, which is bigger and longer in N. ferruginea (Figure 15E) and Notocomplana lapunda Marcus and Marcus, 1968 [25], and absent in N. martae (Figure 16E). Notocomplana evelinae Marcus, 1947 has a similar Lang’s vesicle but a smaller prostatic vesicle [21]. Nevertheless, due to the lack of available sequences for our specimens, we could not determine whether this morphospecies represents a different species from those previously reported for the region, and therefore we have identified it only to the genus level. This morphospecies could represent an undescribed species, but we prefer to be conservative until molecular data are available.
Family Stylochoplanidae Faubel, 1983
Genus Armatoplana Faubel, 1983
Armatoplana divae (Marcus, 1947)
Synonyms:
Stylochoplana divae Marcus, 1947
Figure 18. Armatoplana divae (Marcus, 1947). (A) Photograph of live specimen; (B) Detail of the eyespot organization from whole mount (CBUMAG:PLA:00264); (C) Detail of the posterior portion of the body, ventral view; (D,E) sagittal sections of reproductive structures (CBUMAG:PLA:00110). ce: cerebral eyespots; ed: ejaculatory duct; fp: female pore; gp: gonopores; i: intestine; lv: Lang’s vesicle; mp: male pore; ph: pharynx; pv: prostatic vesicle; st: stylet; sp: sperm; te: tentacle; ten: tentacular eyespots; u: uterus; v: vagina; vd: vas deferens.
Figure 18. Armatoplana divae (Marcus, 1947). (A) Photograph of live specimen; (B) Detail of the eyespot organization from whole mount (CBUMAG:PLA:00264); (C) Detail of the posterior portion of the body, ventral view; (D,E) sagittal sections of reproductive structures (CBUMAG:PLA:00110). ce: cerebral eyespots; ed: ejaculatory duct; fp: female pore; gp: gonopores; i: intestine; lv: Lang’s vesicle; mp: male pore; ph: pharynx; pv: prostatic vesicle; st: stylet; sp: sperm; te: tentacle; ten: tentacular eyespots; u: uterus; v: vagina; vd: vas deferens.
Taxonomy 05 00051 g018
Material examined: CBUMAG:PLA:00110, one mature specimen as sagittal sections and preserved in 70% EtOH, 18 mm × 6 mm; CBUMAG:PLA:00255, one mature specimen preserved in 70% EtOH, 7.2 mm × 3 mm; CBUMAG:PLA:00263, one mature specimen preserved in 70% EtOH, 20 mm × 8 mm; CBUMAG:PLA:00264, one mature specimen as a whole mount, 15.5 mm × 6 mm; CBUMAG:PLA:00537, one mature specimen in 70% EtOH, 14.1 mm × 4.6 mm.
Distribution: Originally recorded from São Paulo and Rio de Janeiro, Brazil [21,32]. Also reported from Colombia [11].
Remarks: All morphological characteristics observed in our specimens match the original description by Marcus [21], such as the presence of nuchal tentacles and the dorsal color pattern, which may be darker depending on the gut content. We provide additional 28S rDNA that shows similarity between each other (97.4%) and to previously available sequences (Armatoplana divae MH700274 = 97.56%; Armatoplana divae MH700273 = 97.66%), and the first COI mtDNA sequences for the species (Table 1).
Armatoplana colombiana Bolaños, Quiroga and Litvaitis, 2006
Material examined: CBUMAG:PLA:00095, one mature specimen in 70% EtOH, 12 mm × 4.6 mm; CBUMAG:PLA:00427, one mature specimen in 70% EtOH, 6.8 mm × 3 mm; CBUMAG:PLA:00491, one mature specimen as a whole mount, 3 mm × 1 mm (from fixed specimen); CBUMAG:PLA:00492, one mature specimen as a whole mount, 4 mm × 2 mm (from fixed specimen); CBUMAG:PLA:00493, one mature specimen in 70% EtOH, 5.95 mm × 2.36 mm; CBUMAG:PLA:00525, one mature specimen in 70% EtOH, 5 mm × 2.4 mm; CBUMAG:PLA:00531, one mature specimen as whole mount and one as sagittal sections, 5 mm × 3 mm and 5 mm × 2 mm (from fixed material).
Distribution: Previously known only from the type locality, Inca Inca Bay, Colombia [11,12]. In this study, we report additional specimens from Taganga Bay.
Remarks: Specimens were found forming aggregations beneath smooth rocks and appear to be common in the type locality. Examination of our whole mounts and histological slides, together with the original description, show the diagnostic curved prostatic vesicle, the extremely long and curved stylet, and the small marginal knobs (Figure 19). However, while the original description of A. colombiana illustrates an oval Lang’s vesicle [12], our whole mounts reveal a crescent-shaped vesicle (Figure 19C); this difference may be a result of the difficulty of reconstructing the reproductive structures from the histological slides of such small specimens and the lack of whole mount preparations in the original description [12]. Additionally, the prostatic vesicle has a more pronounced curvature than shown by Bolaños et al. [12] (Figure 19D). We provide the first 28S rDNA and COI mtDNA sequences for the species (Table 1).
Armatoplana leptalea (Marcus, 1947)
Synonyms:
Stylochoplana leptalea Marcus, 1947
Figure 20. Armatoplana leptalea (Marcus, 1947). (A) Photograph of live specimen; (B) Detail of the eyespot organization from whole mount (CBUMAG:PLA:00156); (C) Detail of the ventral view; (D) (CBUMAG:PLA:00120) and (E) (CBUMAG:PLA:00156) sagittal sections of reproductive structures. am: male atrium; ce: cerebral eyespots; ed: ejaculatory duct; fp: female pore; gp: gonopores; lv: Lang’s vesicle; mp: male pore; ov: oviduct; ph: pharynx; pv: prostatic vesicle; sv: seminal vesicle; st: stylet; ten: tentacular eyespots; v: vagina; vb: vagina bulbosa; vd: vas deferens.
Figure 20. Armatoplana leptalea (Marcus, 1947). (A) Photograph of live specimen; (B) Detail of the eyespot organization from whole mount (CBUMAG:PLA:00156); (C) Detail of the ventral view; (D) (CBUMAG:PLA:00120) and (E) (CBUMAG:PLA:00156) sagittal sections of reproductive structures. am: male atrium; ce: cerebral eyespots; ed: ejaculatory duct; fp: female pore; gp: gonopores; lv: Lang’s vesicle; mp: male pore; ov: oviduct; ph: pharynx; pv: prostatic vesicle; sv: seminal vesicle; st: stylet; ten: tentacular eyespots; v: vagina; vb: vagina bulbosa; vd: vas deferens.
Taxonomy 05 00051 g020
Material examined: CBUMAG:PLA:00119, one mature specimen as sagittal sections and preserved in 70% EtOH, 13.8 mm × 4.4 mm; CBUMAG:PLA:00120, one mature specimen as sagittal sections of reproductive structures and preserved in 70% EtOH, 20.2 mm × 6 mm; CBUMAG:PLA:00156, one mature specimen as sagittal sections and as an anterior mount, 17.2 mm × 4.1 mm; CBUMAG:PLA:00175, one mature specimen as sagittal sections and preserved in 70% EtOH, 33 mm × 8 mm. CBUMAG:PLA:00407, one mature specimen as a whole mount, 17.7 mm × 4 mm.
Distribution: Antigua, Curaçao, Florida Keys [25], southeastern and northeastern Brazil [21,25,32,40]. This study provides the first formal record for Colombia.
Remarks: Our specimens resemble externally and internally both the type material and additional Brazilian specimens pictured in Bahia and Schördl [32]. The phylogenetic analysis by Litvaitis et al. [53] showed that the DNA sequences of A. leptaleta from Brazil and the Caribbean show two distinct clades. Our sequences exhibit high similarity to the Caribbean clade (MH700275 = 99.1%; MH700276 = 99.4%). Based on the morphological agreement with the original description, we classified our specimens as A. leptalea sensu stricto, while acknowledging the need for further taxonomic investigation to determine whether this taxon represents a species complex.
Genus Interplana Faubel, 1983
Interplana evelinae (Marcus, 1952)
Synonyms:
Stylochoplana evelinae Marcus, 1952
Figure 21. Interplana evelinae (Marcus, 1952). (A) Photograph of live specimen; (B) Detail of the eyespot organization from whole mount; (C) Detail of the ventral view; (D,E) sagittal sections of reproductive structures. ce: cerebral eyespots; cu: cuticular protrusion; gp: gonopores; mp: male pore; ov: oviduct; ph: pharynx; pv: prostatic vesicle; st: stylet; te: tentacle; ten: tentacular eyespots; u: uterus; v: vagina; vb: vagina bulbosa; vd: vas deferens.
Figure 21. Interplana evelinae (Marcus, 1952). (A) Photograph of live specimen; (B) Detail of the eyespot organization from whole mount; (C) Detail of the ventral view; (D,E) sagittal sections of reproductive structures. ce: cerebral eyespots; cu: cuticular protrusion; gp: gonopores; mp: male pore; ov: oviduct; ph: pharynx; pv: prostatic vesicle; st: stylet; te: tentacle; ten: tentacular eyespots; u: uterus; v: vagina; vb: vagina bulbosa; vd: vas deferens.
Taxonomy 05 00051 g021
Material examined: CBUMAG:PLA:00111, mature specimen as sagittal sections of the reproductive structures and anterior mount, 15.9 mm × 8.6 mm.
Distribution: Described from southeastern Brazil [24,32]. This study provides the first record for Colombia and the Caribbean Sea.
Remarks: We collected only a single specimen in our sampling, found alongside individuals of Phaenocelis peleca, a species with which it may be easily confused due to its similar white coloration with brown spots over the pharynx region (Figure 21A). Marcus [24] also reported finding two light pink worms. Nonetheless, I. evelinae can be distinguished externally by the presence of small, pointed tentacles and internally by a markedly different organization of the reproductive structures, including a complex stylet and a cuticular protrusion in the vagina bulbosa [24] (Figure 21A–E). The observation of the reproductive structures from our sagittal sections (Figure 21D,E) agrees with the description of Marcus [24]; however, they differ in that the cuticular nature of the vagina bulbosa does not have such a big protrusion as was pictured in the species description [24]. We provide the first photographs of a living specimen, as well as detailed images of its reproductive anatomy. This contribution is particularly relevant given that I. evelinae is the type species of the genus Interplana.
Genus Phaenoplana Faubel, 1983
Phaenoplana longipenis (Hyman, 1953)
Synonyms:
Stylochoplana longipenis Hyman, 1953
Figure 22. Phaenoplana longipenis (Hyman, 1953). (A,B) Holotype USNM 365. (A) Photograph of anterior mount; (B) Detail of the eyespot organization from anterior mount; (C) sagittal section of reproductive structures (INVPLA007). ce: cerebral eyespots; lv: Lang’s vesicle; mp: male pore; p: penis; sv: seminal vesicle; ten: tentacular eyespots; v: vagina.
Figure 22. Phaenoplana longipenis (Hyman, 1953). (A,B) Holotype USNM 365. (A) Photograph of anterior mount; (B) Detail of the eyespot organization from anterior mount; (C) sagittal section of reproductive structures (INVPLA007). ce: cerebral eyespots; lv: Lang’s vesicle; mp: male pore; p: penis; sv: seminal vesicle; ten: tentacular eyespots; v: vagina.
Taxonomy 05 00051 g022
Material examined: INVPLA007, mature specimen as sagittal sections of reproductive structures; USNM 365.1–365.3, holotype as sagittal sections of reproductive structures and anterior mount.
Distribution: Guaymas, Sonora, Mexico; San Pedro, Santa Catalina Island, and Newport Bay, California [59]. Also reported for the Caribbean Coast of Colombia [11].
Remarks: Although we did not encounter this species during our sampling, examination of the specimen reported by Quiroga et al. [11] (INVPLA007) corroborated its identity as P. longipenis. Originally described from the Pacific coast of North America, its occurrence in the Colombian Caribbean may be incidental, potentially linked to maritime traffic, given the proximity of Santa Marta to major shipping routes. No additional records have been published for either the Pacific or the Caribbean. Nonetheless, given the confirmed identity of the Colombian specimen, it is prudent not to dismiss the possibility of P. longipenis occurring in other parts of the Caribbean. Further molecular and morphological studies are recommended to clarify its true distribution and to determine whether it represents an amphiamerican species.
Superfamily Discoceloidea Dittman, Cuadrado, Aguado, Noreña and Egger, 2019
Family Cryptocelidae Laidlaw, 1903
Genus Phaenocelis Stummer-Traunfels, 1933
Phaenocelis medvedica Marcus, 1952
Material examined: CBUMAG:PLA:00162, one mature specimen as sagittal sections and preserved in 70% EtOH, 21.6 mm × 4.8 mm; CBUMAG:PLA:00169, one mature specimen as sagittal sections and preserved in 70% EtOH, 23 mm × 3.8 mm; CBUMAG:PLA:00261, one mature specimen as a whole mount, 27 mm × 5.4 mm.
Distribution: Described from southeastern Brazil [24]. It has been recorded in Rio de Janeiro and northeastern Brazil [32,40], on the Caribbean Coast of Colombia [11], and recently in the Gulf of Mexico [9].
Remarks: The specimens examined display the pink coloration described by Marcus [24]; however, we also observed individuals with a more pale coloration, suggesting that the characteristic pink color may result from ingested food. The internal morphology matches that reported in the original description [24]. P. medvedica was the most frequently encountered species in our sampling and is likely among the most common polyclads in the Caribbean Sea [7]. We provide a new 28S rDNA sequence that shows high similarity to previously available ones (e.g., KY263706 = 99.69%), and the first COI mtDNA sequences for the species (Table 1).
Phaenocelis peleca Marcus and Marcus, 1968
Synonyms:
Phaenocelis pelica Marcus and Marcus, 1968
Phaenoplana peleca (Marcus and Marcus, 1968)
Material examined: CBUMAG:PLA:00142, mature specimen as a whole mount, 9 mm × 6 mm; CBUMAG:PLA:00185, mature specimen as sagittal sections of the reproductive structures and preserved in 70% EtOH, 15.3 mm × 7 mm; CBUMAG:PLA:216, mature specimen as sagittal sections of the reproductive structures and preserved in 70% EtOH, 9.7 mm × 4.9 mm; CBUMAG:PLA:00511, mature specimen as a whole mount, 9.6 mm × 5.5. mm. INVPLA0012; INVPLA0013, mature specimen as sagittal sections of the reproductive structures.
Distribution: Described from Curaçao [25] and recorded recently from the Gulf of Mexico [9]. This study provides the first formal record for Colombia.
Remarks: This study constitutes the first formal record of Phaenocelis peleca as a nominal species for Colombia. Quiroga et al. [11] had previously reported a specimen as Notocomplana sp. (INVPLA0012; INVPLA0013), which, upon reexamination, corresponds to P. peleca. Our sampled specimens match the description of the external appearance and of the reproductive structures provided by Marcus and Marcus [25]. As mentioned by Cuadrado et al. [9], our specimens are smaller than those from the Gulf of Mexico; however, this size difference does not appear to correlate with maturity. We recorded this species exclusively in Bahía Concha and Neguanje Bay, both within the Tayrona National Natural Park, where the substrate is predominantly composed of coral rubble. Most specimens were found aggregated under rocks and rubble. Notably, a specimen of I. evelinae was found within one of these aggregations. Our 28S sequences show relatively low similarity to previously available ones (PX093765 vs. MH700345 = 94.8%; PX093764 vs. MH700343 = 97.2%). We provide 28S rDNA sequences from our specimens and the first COI mtDNA sequence for the species (Table 1).
Figure 24. Phaenocelis peleca Marcus and Marcus, 1968. (A) Photograph of live specimen; (B) Detail of the eyespot organization from whole mount (CBUMAG:PLA:00142); (C) Detail of the ventral view; (D,E) sagittal sections of reproductive structures (CBUMAG:PLA:00185). am: male atrium; b: brain; ce: cerebral eyespots; fp: female pore; gp: gonopores; lv: Lang’s vesicle; m: mouth; mp: male pore; ov: oviduct; ph: pharynx; pp: penis papillae; pv: prostatic vesicle; sv: seminal vesicle; ten: tentacular eyespots; u: uterus; v: vagina; vs: vas deferens.
Figure 24. Phaenocelis peleca Marcus and Marcus, 1968. (A) Photograph of live specimen; (B) Detail of the eyespot organization from whole mount (CBUMAG:PLA:00142); (C) Detail of the ventral view; (D,E) sagittal sections of reproductive structures (CBUMAG:PLA:00185). am: male atrium; b: brain; ce: cerebral eyespots; fp: female pore; gp: gonopores; lv: Lang’s vesicle; m: mouth; mp: male pore; ov: oviduct; ph: pharynx; pp: penis papillae; pv: prostatic vesicle; sv: seminal vesicle; ten: tentacular eyespots; u: uterus; v: vagina; vs: vas deferens.
Taxonomy 05 00051 g024
Phaenocelis cf. purpurea (Schmarda, 1859)
Synonyms:
Comprostatum veneris Hyman, 1944
Comprostatum insularis Hyman, 1944
Leptoplana purpurea Schmarda, 1859
Phaenocelis insularis (Hyman, 1944)
Material examined: CBUMAG:PLA:00181, mature specimen as anterior mount, 17.3 mm × 6 mm; CBUMAG:PLA:00182, mature specimen as sagittal sections of the reproductive structures and preserved in 70% EtOH, 22.1 mm × 6.5 mm; CBUMAG:PLA:516, mature specimen as sagittal sections of the reproductive structures and anterior mount, 14.6 mm × 3.3 mm; CBUMAG:PLA:00540, mature specimen preserved in 70% EtOH, 41.2 mm × 5.5 mm.
Distribution: Jamaica [54], Florida [60] and Curaçao [25]. The specimens were found exclusively in Neguanje Bay.
Remarks: The genus Phaenocelis currently comprises only three recognized species [31]. This morphospecies resembles P. medvedica and P. purpurea (Schmarda, 1859) in external appearance; however, it may be distinguished from P. medvedica by its darker coloration, less noticeable cerebral eyes and smaller pharynx (Figure 25A,B). Internally, it differs from Phaenocelis medvedica and P. peleca by having a short ejaculatory duct and relatively long and slender male atrium that accommodates a slightly curved rod-like penis, a less conspicuous prostatic vesicle than P. medvedica, and a simpler vagina leading to a globular Lang’s vesicle (Figure 25D,E). However, our sequences do not match those publicly available for the species (MH700348 = 97.5%, MH700347 = 97.8%), showing higher similarity to an unidentified Phaenocelis (MH700355 = 98.1%, MH700356 = 99.5%), which were not accompanied by a detailed morphological description. We regard that the species identity needs further confirmation until additional material from the type locality and additional locations where it was recorded is available. We provide 28S rDNA and COI mtDNA sequences from our specimens (Table 1).
Figure 25. Phaenocelis cf. purpurea (Schmarda, 1859). (A) Photograph of live specimen; (B) Detail of the eyespot organization from whole mount (CBUMAG:PLA:516); (C) Detail of the ventral view; (D,E) sagittal sections of reproductive structures (CBUMAG:PLA:00182). am: male atrium; b: brain; ce: cerebral eyespots; ed: ejaculatory duct; gp: gonopores; lv: Lang’s vesicle; mp: male pore; ov: oviduct; ph: pharynx; pv: prostatic vesicle; sv: seminal vesicle; ten: tentacular eyespots; v: vagina; vd: vas deferens.
Figure 25. Phaenocelis cf. purpurea (Schmarda, 1859). (A) Photograph of live specimen; (B) Detail of the eyespot organization from whole mount (CBUMAG:PLA:516); (C) Detail of the ventral view; (D,E) sagittal sections of reproductive structures (CBUMAG:PLA:00182). am: male atrium; b: brain; ce: cerebral eyespots; ed: ejaculatory duct; gp: gonopores; lv: Lang’s vesicle; mp: male pore; ov: oviduct; ph: pharynx; pv: prostatic vesicle; sv: seminal vesicle; ten: tentacular eyespots; v: vagina; vd: vas deferens.
Taxonomy 05 00051 g025
Genus Triadomma Marcus, 1947
Triadomma curvum Marcus, 1949
Material examined: CBUMAG:PLA:00386, mature specimen as anterior mount, 6.7 mm × 1.5 mm; CBUMAG:PLA:00489, mature specimen as sagittal sections, 5.7 mm × 1.3 mm; CBUMAG:PLA:00533, mature specimen as a whole mount, 6.9 mm × 2.4 mm. Measurements refer to live specimens.
Distribution: Originally described from Ilha de São Sebastião, Saõ Paulo [22]. This study provides the first record for Colombia and the Caribbean Sea.
Remarks: Our specimens display two groups of cerebral and tentacular eyespots that extend anteriorly towards the margin (Figure 26B), a long curved stylet and a true seminal vesicle in the male apparatus (Figure 26D,E), consistent with the species description [22]. Marcus [21] established the genus Triadomma within Cryptocelidae Laidlaw, 1903, based on the presence of minute anterior marginal eyespots, also observed in our specimens (Figure 27B). Later, Faubel [14] transferred both species described by Marcus [21,22] to Notoplanidae due to the presence of an interpolated prostatic vesicle with tubular interior lining, a feature also observed in our specimens (Figure 27D). Prudhoe [16], however, retained the original family assignment proposed by Marcus [21]. The genus was subsequently and erroneously moved to Faubelidae [32,55] (see the comment under A. hummelincki). Given that our molecular data show relatively low similarity with other sequences of acotyleans (e.g., Gnesioceros sargassicola MH700309 = 94.7%; Comoplana agilis MN384685 = 94.5%), including those of Notoplanidae and Cryptocelidae (e.g., Notoplana sp. MH700334 = 94.4% vs. Phaenocelis sp. MH700350 = 92.5%), we continue to follow the placement of Marcus [22] and Prudhoe [16], retaining Triadomma in Cryptocelidae until additional material from the type locality and from the type species becomes available to better assess its systematic position within Acotylea. This study provides, for the first time, live photographs as well as 28S rDNA and COI mtDNA sequences for the species (Table 1).
Figure 26. Triadomma curvum Marcus, 1949. (A) Photograph of live specimen; (B) Detail of the eyespot organization from whole mount (CBUMAG:PLA:00386); (C) Detail of the ventral view; (D,E) sagittal sections of reproductive structures (CBUMAG:PLA:00489). am: male atrium; ce: cerebral eyespots; fp: female pore; gp: gonopores; me: marginal eyespots; mp: male pore; ov: oviduct; ph: pharynx; pv: prostatic vesicle; st: stylet; sv: seminal vesicle; ten: tentacular eyespots; u: uterus; vb: vagina bulbosa; vd: vas deferens.
Figure 26. Triadomma curvum Marcus, 1949. (A) Photograph of live specimen; (B) Detail of the eyespot organization from whole mount (CBUMAG:PLA:00386); (C) Detail of the ventral view; (D,E) sagittal sections of reproductive structures (CBUMAG:PLA:00489). am: male atrium; ce: cerebral eyespots; fp: female pore; gp: gonopores; me: marginal eyespots; mp: male pore; ov: oviduct; ph: pharynx; pv: prostatic vesicle; st: stylet; sv: seminal vesicle; ten: tentacular eyespots; u: uterus; vb: vagina bulbosa; vd: vas deferens.
Taxonomy 05 00051 g026
Family Discocelidae Laidlaw, 1903
Genus Adenoplana Stummer-Traunfels, 1933
Adenoplana evelinae Marcus, 1950
Material examined: CBUMAG:PLA:158, mature specimen as a whole mount, 26.5 mm × 9.2 mm; CBUMAG:PLA:00535, mature specimens as sagittal sections of the reproductive structures and whole mount, 28.4 mm × 12.2 mm.
Distribution: Southeastern and northeastern Brazil [23,32,40]. This study provides the first record for Colombia and the Caribbean Sea.
Figure 27. Adenoplana evelinae Marcus, 1950. (A) Photograph of live specimens; (B) Detail of the eyespot organization from whole mount (CBUMAG:PLA:158); (C) Detail of the ventral view; (D,E) sagittal sections of reproductive structures (CBUMAG:PLA:00535). am: male atrium; ce: cerebral eyespots; ed: ejaculatory duct; fp: female pore; lv: Lang’s vesicle; m: mouth; mp: male pore; ph: pharynx; po: prostatoid organ; ten: tentacular eyespots; u: uterus; v: vagina.
Figure 27. Adenoplana evelinae Marcus, 1950. (A) Photograph of live specimens; (B) Detail of the eyespot organization from whole mount (CBUMAG:PLA:158); (C) Detail of the ventral view; (D,E) sagittal sections of reproductive structures (CBUMAG:PLA:00535). am: male atrium; ce: cerebral eyespots; ed: ejaculatory duct; fp: female pore; lv: Lang’s vesicle; m: mouth; mp: male pore; ph: pharynx; po: prostatoid organ; ten: tentacular eyespots; u: uterus; v: vagina.
Taxonomy 05 00051 g027
Remarks: We provide photographs of both juveniles and adult specimens (Figure 27A). In both stages, the marginal eyespots form a complete band encircling the body margin. Our observations and molecular data suggest that A. evelinae may have a transparent body during early stages, which becomes opaque as the animals grow and feed, rather than representing two distinct color morphs, as previously suggested by Bahia and Schrödl [32]. The reproductive anatomy is typical of Adenoplana (Figure 27D,E), with A. evelinae distinguished primarily by the presence of a continuous band of marginal eyespots [23]. We provide 28S rDNA sequences (Adenoplana evelinae MH700268 = 99.7%; KY263647 = 100%) and the first COI mtDNA sequence for the species (Table 1).
Adenoplana obovata (Schmarda, 1859)
Synonyms:
Leptoplana obovata (Schmarda, 1859)
Polycelis obovata (Schmarda, 1859)
Material examined: INVPLA001; INVPLA002. Preserved specimen and sagittal sections.
Distribution: Described from Jamaica [54]. It was also recorded from the Colombian Caribbean coast [11].
Remarks: We did not encounter this species in our sampling. However, the available material from Quiroga et al. [11] and additional photographs shows the diagnostic marginal eyespots extending only up to the level of the pharynx. The reproductive anatomy is typical of the genus Adenoplana (Figure 28B,C).
Figure 28. Adenoplana obovata (Schmarda, 1859). (A) Photograph of live specimen, taken by Quiroga and Bolaños in 2002; (B) Detail of the ventral view; (C) sagittal section of reproductive structures. am: male atrium; fp: female pore; m: mouth; me: marginal eyespots; mp: male pore; ph: pharynx; po: prostatoid organ; ten: tentacular eyespots; vd: vas deferens.
Figure 28. Adenoplana obovata (Schmarda, 1859). (A) Photograph of live specimen, taken by Quiroga and Bolaños in 2002; (B) Detail of the ventral view; (C) sagittal section of reproductive structures. am: male atrium; fp: female pore; m: mouth; me: marginal eyespots; mp: male pore; ph: pharynx; po: prostatoid organ; ten: tentacular eyespots; vd: vas deferens.
Taxonomy 05 00051 g028
Family Ilyplanidae Faubel, 1983
Genus Ilyella Faubel, 1983
Ilyella yrsa (Marcus and Marcus, 1968)
Synonyms:
Zygantroplana yrsa Marcus and Marcus, 1968
Material examined: CBUMAG:PLA:00157, mature specimen as a whole mount, 9.7 mm × 2.1 mm; CBUMAG:PLA:00237, mature specimen as an anterior mount, 8.26 mm × 3 mm; CBUMAG:PLA:00247, mature specimen as a whole mount, 6 mm × 3 mm; CBUMAG:PLA:00642, a mature specimen as sagittal sections, 4 mm × 3 mm; CBUMAG:PLA:00643, a mature specimen as sagittal sections, 5 mm × 4 mm.
Distribution: Aruba, Curaçao, Bonaire; Los Frailes, Isla Coche and Isla de Aves (VE); Antigua, Grenada and Barbuda [25]. This study provides the first record for Colombia.
Remarks: We found this species on the algae Dictyota, on the hydrozoan Pennaria disticha Goldfuss, 1820, and under rocks. In all specimens, we observed the cerebral eyespots arranged in two distinct groups, a posterior notch, and paired uteri located posterior to the pharynx. The reproductive system is situated close to the posterior end, allowing to distinguish both the Lang’s vesicle and the duct of the vagina, which opens at the far posterior end (Figure 29). Whole mounts of our specimens are consistent with the description and illustrations of the species and its reproductive anatomy provided by Marcus and Marcus [25]. In the original description, the species was assigned to the genus Zygantroplana Laidlaw, 1906, and later transferred to Ilyella by Faubel [14]; however, our sequences show a higher similarity to leptoplanids (e.g., A. hummelincki MH70027 = 96.6% and N. ferruginea MT677877 = 96.4%) than to Ilyella gigas (Scharmda, 1859) (LC508139 = 92%), the type species of the genus. No sequences of the two species of Zygantroplana are available. This discrepancy highlights the need for a revision of the systematics of the family and its members [61]. We provide the first live photographs and detailed images of the reproductive structures, as well as the first 28S rDNA and COI mtDNA sequences for this species (Table 1).
Figure 29. Ilyella yrsa (Marcus and Marcus, 1968). (A) Photograph of live specimen; (B,C) CBUMAG:PLA:00247. (B) Detail of the eyespot organization from whole mount; (C) Detail of the posterior portion of the body, ventral view; (D) (CBUMAG:PLA:00642) and (E) (CBUMAG:PLA:00643) sagittal sections of reproductive structures. am: male atrium; b: brain; ce: cerebral eyespots; lv: Lang’s vesicle; ov: oviduct; u: uterus; v: vagina; vd: vas deferens.
Figure 29. Ilyella yrsa (Marcus and Marcus, 1968). (A) Photograph of live specimen; (B,C) CBUMAG:PLA:00247. (B) Detail of the eyespot organization from whole mount; (C) Detail of the posterior portion of the body, ventral view; (D) (CBUMAG:PLA:00642) and (E) (CBUMAG:PLA:00643) sagittal sections of reproductive structures. am: male atrium; b: brain; ce: cerebral eyespots; lv: Lang’s vesicle; ov: oviduct; u: uterus; v: vagina; vd: vas deferens.
Taxonomy 05 00051 g029

3.3. Dichotomous Key for the Acotylean Polyclads of the Colombian Caribbean

  • A. Presence of a sucker or cotyl ventrally, posterior to the female gonopore and/or presence of marginal tentacles or pseudotentacles → Suborder Cotylea.
  • B. Without a sucker or cotyl and/or presence of nuchal tentacles → Suborder Acotylea (1.).
  • 1. Body with extensions of the body in the shape of papillae or small knobs, dorsal or marginal → 2.
  • 1′ Body without any type of extensions of the body, with or without tentacles → 4.
  • 2. Body with dorsal papillae, shape relatively oval, with nuchal tentacles. May be found in association with bryozoans → Hoploplana cf. divae (Figure 2).
  • 2′ Body with marginal knobs, either surrounding the entire margin or restricted anteriorly → 3.
  • 3. Marginal knobs encircling the body, may be retractable when touched. Dorsal surface with a pattern of gray patches and dots. Presence of nuchal tentacles. The worm may curl on itself when disturbed → Styloplanocera fasciata (Figure 10).
  • 3′ Marginal knobs restricted to the head (between 6–8). Dorsal surface with irregularly placed brown dots. Presence of nuchal tentacles. Usually found in groups → Armatoplana colombiana (Figure 19).
  • 4. With nuchal tentacles, pharynx usually positioned in the middle of the body → 5.
  • 4′ Without tentacles or with rudiments. Pharynx anterior, in the middle or posterior → 10.
  • 5. Relatively small, body broader anterior tapering towards the posterior. Dorsally brown with dark spots. May curl or swim when disturbed. Normally associated with algae or seagrass → Gnesioceros sargassicola (Figure 9).
  • 5′ Body mostly oval or slender when moving, with or without dorsal pattern or coloration → 6.
  • 6. Body semitransparent, mostly white with some brown dots along the pharynx. Small tentacles only with eyespots at its base. Male and female reproductive structures cuticularized → Interplana evelinae (Figure 21).
  • 6′ Body opaque or semitransparent but with visible coloration or pattern. Tentacles with or without eyespots inside → 7.
  • 7. Body with either a white reticulate pattern or dark lines along the margin over a brown/whitish background. Tentacles only with eyespots at its base (So far only known from floating Sargassum) → Chatziplana grubei (Figure 8).
  • 7′ Body with some kind of pattern dorsally. Tentacles with eyespots inside and at its base → 8.
  • 8. Body white with orange-brownish rings over the dorsal surface, the rings are bigger at the middle of the body and decrease their size towards the margin. Marginal eyespots present → Idioplana atlantica (Figure 3).
  • 8′ Body with a dorsal pattern different to rings. With or without marginal eyespots → 9.
  • 9. Body light brown with a darker brown color following the anastomosing pattern of the intestine dorsally ending in a band of the same color encircling the body, may not be easily visible due to the gut content. Without marginal eyespots → Armatoplana divae (Figure 18).
  • 9′ Body with cream color, dorsal surface almost completely covered by orange/red dots (typical Stylochidae coloration), leaving only the brain region uncovered. Pointed tentacles. Marginal eyespots encircling the entire body → Stylochus sp. (Figure 7).
  • 10. With two small uplifts of the body (rudiments) next to the brain where the tentacular eyespots are located → 11.
  • 10′ Body without anything distinguishably as tentacle or rudiment → 14.
  • 11. Body mostly oval and opaque (except when juveniles). With marginal eyespots → 12.
  • 11′ Body mostly slender, either opaque or semitransparent. Without marginal eyespots → 13.
  • 12. Eyespots clearly grouped in tentacular and cerebral groups. Brown coloration darker over the pharynx and clearer towards the margins. Marginal eyespots on the entire margin, being denser anteriorly → Adenoplana evelinae (Figure 27).
  • 12′ Eyespots clearly grouped in tentacular and cerebral groups. Brown semitransparent body. Marginal eyespots only anterior to the level of the pharynx, the latter having less folds in comparison → Adenoplana obovata (Figure 28).
  • 13. Body brown semitransparent or opaque, darker over the pharynx. Tentacular and cerebral eyespots grouped together but distinguishable between the two. Faint reddish line along the anterior margin → Notocomplana ferruginea (Figure 15).
  • 13′ Body whitish or brown, almost transparent colored by gut content and reproductive structures. The difference between tentacular and cerebral eyespots less noticeable. Without extra coloration on the margins → Notocomplana sp. (Figure 17).
  • 14. Slender long body, pharynx located at the far posterior. With frontal eyespots organized in a fan-like manner between the brain and the margin → 15.
  • 14′ Slender body, pharynx anterior or in the middle. Tentacular and cerebral eyespots, with or without marginal eyespots but not with frontal ones → 17.
  • 15. Body covered by small orange dots on the dorsum, darker towards the posterior and more pronounced in the middle → Latocestus sp. (Figure 5).
  • 15′ Body without dorsal pattern, color white, grey, green or pinkish → 16.
  • 16. Body translucent, white or grey and colored by the food content except for the margins. Light pink color dorsally over where the pharynx is located → Latocestus brasiliensis (Figure 4).
  • 16′ Brown body or slightly green or pink, the main branch of the intestine clearly visible dorsally as it shows lighter coloration along with the ventral surface. Broad band of marginal eyes → Latocestidae sp. (Figure 6).
  • 17. Marginal eyes encircling the entire body or only at the anterior. Body relatively longer than wider → 18.
  • 17′ Only with cerebral and tentacular eyespots. Body slightly longer than wider → 22.
  • 18. Tentacular eyespots running anteriorly in two groups at each side of the brain, cerebral eyes haphazardly distributed, miniscule marginal eyespots only at the anterior running until the brain level. Pharynx slightly folded → Triadomma curvum (Figure 26).
  • 18′ Marginal eyespots running along the entire margin of the body, usually more pronounced at the anterior → 19.
  • 19. Easily damaged when handled. Body white, almost transparent with brown pigment to the sides of the pharynx. The latter located relatively anterior in the body. Tentacular groups with up to 10 eyespots each → Notoplana cf. tipuca (Figure 14).
  • 19′ Body semitransparent white, pink or reddish. Pharynx usually in the middle of the body occupying at least 1/3 of it → 20.
  • 20. Body translucent white or with coloration from food content. Tentacular eyespots formed by two dense groups next to the brain. Brain region colorless. When mature, uterus running around the pharynx → Phaenocelis peleca (Figure 24).
  • 20′ Body translucent pink or reddish, darker at the pharynx region. Brown parallel pigments located at either side of the worm. Brain pink colored → 21.
  • 21. Usually light pink, sometimes almost white. Brown pigments mostly restricted to the pharynx. The Lang’s vesicle may be visible as a white long tube running from the gonopores to the posterior → Phaenocelis medvedica (Figure 23).
  • 21′ Overall darker pink or reddish. Brown pigments running parallel almost in the entire body. The cerebral eyespots are hardly distinguishable → Phaenocelis cf. purpurea (Figure 25).
  • 22. Cerebral and tentacular eyespots forming parallel lines → 23.
  • 22′ Cerebral and tentacular eyespots in two separate groups → 25.
  • 23. Body relatively long, creamy white with a pink colored pharynx. The big Lang’s vesicle may be observable as a transparent line after the pharynx. May break easily when handled → Amyris hummelincki (Figure 11).
  • 23′ Usually brown or pale semitransparent body, testes visible as white dots dorsally → 24.
  • 24. Body oblong, tapering towards the posterior. Eyespots easily distinguishable as two lines next to the brain → Notoplana insularis (Figure 13).
  • 24′ Body oblong, with notch in the posterior end. Eyespots easily distinguishable as two lines next to the brain. Lang’s vesicle seen as a clear circle after the pharynx → Ilyella yrsa (Figure 29).
  • 25. Tentacular and cerebral eyespots forming four defined groups next to the brain, thin body tapering posteriorly. Pharynx slightly folded→ Notocomplana martae (Figure 16).
  • 25′ Tentacular and cerebral eyespots in two distinct groups but still close to each other → 26.
  • 26. Tentacular eyespots bigger than cerebral eyes but the seconds more numerous. Body grey in coloration → Phaenoplana longipenis (Figure 22).
  • 26′ Tentacular and cerebral eyespots similar in size, number of eyespots variable → 27.
  • 27. Body margins folded. Body clear brown → Notoplana queruca (Figure 12).
  • 27′ Body margins folded. Body almost transparent → Armatoplana leptalea (Figure 20).

4. Discussion

To date, the only checklist of polyclad species from the Caribbean coast of Colombia included 25 species, 13 of which were classified as acotyleans [11]. Since then, Cestoplana rubrocincta (Grube, 1840) and its family have been reclassified as cotyleans [62], reducing the number of acotylean species on that list to 12. With the recent inclusion of Chatziplana grubei [13], along with the results of our present study, we update the species checklist to include a total of 29 acotyleans. Of these, 11 represent new species records for Colombia, one constitutes a new genus record for the country, and five are new records for the Caribbean Sea. This brings the total number of known polyclad species in Colombia to 41 (including cotyleans), contributing to the inventory of polyclads in the Tropical Western Atlantic.
Although our sampling was extensive and carefully conducted, we did not record some of the species previously reported for the Colombian Caribbean (i.e., Idioplana atlantica, Notoplana queruca, and Phaenoplana longipenis by Quiroga et al. [11] and Notoplana insularis by Hyman [27]). Likewise, we documented several taxa not recorded before. The greater effort and inclusion of new sampling areas in our study partly explains the increase in records. However, the absence of species cited in earlier studies raises questions about whether environmental factors might be contributing to local species loss. For now, this remains a hypothesis, but it highlights the need for targeted monitoring to determine whether these absences reflect natural variability, sampling limitations, or actual ecological changes affecting polyclad diversity in the region.
In the Caribbean Sea, marine species richness appears to be concentrated along the Antilles Arc and the northern coast of South America (Colombia and Venezuela). While these regions have been sampled more extensively than other areas of the Caribbean [63], most studies have largely overlooked lesser-known taxa such as polyclad flatworms. Notably, comprehensive studies of the Caribbean polyclads were published by Hyman [29,30] and du Bois-Reymond Marcus and Marcus [25], yet none of these included the Caribbean coast of Colombia. Together with the study by Quiroga et al. [11], our work expands the current knowledge of tropical polyclad diversity and underscores the Colombian Caribbean as a highly diverse region, hosting both Caribbean and Brazilian taxa. Further exploration of understudied habitats, such as soft-bottom substrates and beach interstitial zones, may significantly increase the number of known species in the region. This is exemplified by the recent discovery of clinging polyclads in floating Sargassum mats [13], and would contribute to a better understanding of polyclad biogeography.
On a broader scale, the strategic location of Colombia in the Caribbean positions it as a key area for the study of cryptic and neglected taxa. As has been shown in our and in similar studies (e.g., nemerteans in Gonzalez-Cueto et al. [64]), whenever such groups are investigated, remarkable findings emerge that significantly increase the known biodiversity. Nonetheless, many of the previous polyclad studies in the Caribbean, Gulf of Mexico, and the east coast of North America, were based on poorly fixed material, often lacking documentation of external coloration and complete morphological descriptions [11,25,29,30,32]. These limitations, combined with the delicate nature of polyclads and the challenges associated with preserving them, have complicated accurate taxonomic identification [10]. However, in some cases, the revision of museum collections and the acquisition of fresh material have proven valuable for refining species diagnosis [32]. As a result of our taxonomic efforts, we provide for the first time color photographs for 7 species that previously lacked documentation of live coloration, and present improved images of sagittal sections detailing reproductive structures.
The incorporation of molecular sequences in this study strengthens species identification by bridging traditional taxonomy with integrative approaches. Beyond supporting taxonomic resolution, the molecular data also provide opportunities to assess species boundaries and biogeographic patterns that cannot be inferred from morphology alone. In addition, we provide an identification key that facilitates rapid and reliable recognition of acotylean polyclads from the Colombian Caribbean, particularly in the Santa Marta region. This key will allow researchers, including those specialized in flatworm taxonomy, to identify species more accurately. Such accessibility is especially valuable for ecological studies and environmental monitoring, where polyclads are often overlooked due to the difficulty of their identification. By promoting their inclusion in biodiversity assessments, the key will enhance our understanding of their distribution and ecological roles. Furthermore, it supports conservation planning by highlighting the potential of soft-bodied invertebrates as sensitive bioindicators of environmental change.

Author Contributions

Conceptualization, J.I.M.-M., S.Q. and D.M.B.; methodology, J.I.M.-M.; validation, J.I.M.-M., S.Q., D.M.B. and L.R.C.; investigation, J.I.M.-M. and S.Q.; resources, S.Q. and L.R.C.; data curation, J.I.M.-M.; writing—original draft preparation, J.I.M.-M. and S.Q.; writing—review and editing, J.I.M.-M., S.Q., D.M.B. and L.R.C.; visualization, J.I.M.-M.; supervision, D.M.B. and L.R.C.; project administration, S.Q.; funding acquisition, S.Q., D.M.B. and L.R.C. This is the contribution No. 27 from the Centro de Colecciones Científicas de la Universidad del Magdalena. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Science Foundation (DEB-1456674), and through the Fondo de Investigación—FONCIENCIAS 2024 from the Universidad del Magdalena.

Data Availability Statement

All the material examined in this study was deposited in the Centro de Colecciones Científicas from Universidad del Magdalena, Santa Marta, Colombia. Additionally, all the sequences generated were submitted to Genbank.

Acknowledgments

The authors would like to thank Parque Nacionales Naturales de Colombia and the PNN Tayrona staff for their assistance with obtaining permits (AUR 010 de 2022 and AUR 005 de 2025) and for granting access to the sampling sites. Additional samples from floating Sargassum were obtained with the help of Isabella Posada-Restrepo and Katherin García-Ramos who conducted the fieldwork as part of the BIOM/PD-2023-03 funding project. The authors would also like to thank Andrés Rojas Suárez for his help with the fieldwork and polyclad fixation, Adair G. Coria for his insights into polyclad histology, and Ángel Oviedo and M. Mateo Rodríguez for their support with the molecular work.

Conflicts of Interest

The authors declare no conflicts of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or in the decision to publish the results.

Abbreviations

The following abbreviations are used in this manuscript:
AMNHAmerican Museum of Natural History
USNMUnited States National Museum

References

  1. Tyler, S.; Schilling, S.; Hooge, M.; Bush, L. Turbellarian Taxonomic Database. Version 2.3. Available online: https://turbellaria.umaine.edu/turbellaria/ (accessed on 4 July 2025).
  2. Lang, A. Die Polycladen (Seeplanarien) des Golfes von Neapel und der Angrenzenden Meeresabschnitte; Zoologischen Station Zu Neapel: Leipzig, Germany, 1884. [Google Scholar]
  3. Dittmann, I.; Pérez-Monte, D.; Aguado, M.T.; Noreña, C.; Egger, B. Polyclad Phylogeny Persists to Be Problematic. Org. Divers. Evol. 2019, 19, 585–608. [Google Scholar] [CrossRef] [Scilit]
  4. Oya, Y.; Kajihara, H. Molecular Phylogenetic Analysis of Acotylea (Platyhelminthes: Polycladida). Zool. Sci. 2020, 37, 1. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  5. Cuadrado, D.; Rodríguez, J.; Machordom, A.; Noreña, C.; Fernández-Álvarez, F.Á.; Hutchings, P.; Williamson, J. Base-Substitution Rates of Nuclear and Mitochondrial Genes for Polyclad Flatworms. Zoosyst. Evol. 2024, 100, 863–876. [Google Scholar] [CrossRef] [Scilit]
  6. Quiroga, S.Y.; Bolaños, M.; Litvaitis, M.K. Policládidos (Platyhelminthes: “Turbellaria”) del Atlántico Tropical Occidental. Biota Colomb. 2004, 5, 159–172. [Google Scholar]
  7. Rawlinson, K. Biodiversity of Coastal Polyclad Flatworm Assemblages in the Wider Caribbean. Mar. Biol. 2008, 153, 769–778. [Google Scholar] [CrossRef] [Scilit]
  8. Catalá Jimenez, A.; Diez, Y.L.; Carbonell Yuanis, D. Nuevos registros de Polycladida (Platyhelminthes) para Cuba. Rev. Investig. Mar. 2016, 36, 94–104. [Google Scholar]
  9. Cuadrado, D.; Hernández-Gonzalez, A.; Noreña, C.; Simões, N. Polyclads (Platyhelminthes) in the Southern Gulf of Mexico: Unveiling Biodiversity and Descriptions of Two New Species. ZooKeys 2024, 1221, 103–144. [Google Scholar] [CrossRef] [Scilit]
  10. Newman, L.J.; Cannon, L.R. The Importance of the Fixation of Colour, Pattern and Form in Tropical Pseudocerotidae (Platyhelminthes, Polycladida). Hydrobiologia 1995, 305, 141–143. [Google Scholar] [CrossRef] [Scilit]
  11. Quiroga, S.Y.; Bolaños, D.M.; Litvaitis, M.K. A Checklist of Polyclad Flatworms (Platyhelminthes: Polycladida) from the Caribbean Coast of Colombia, South America. Zootaxa 2004, 633, 1–12. [Google Scholar] [CrossRef] [Scilit]
  12. Bolaños, D.M.; Quiroga, S.Y.; Litvaitis, M.K. A New Acotylean Flatworm, Armatoplana colombiana n. sp. (Platyhelminthes: Polycladida: Stylochoplanidae) from the Caribbean Coast of Colombia, South America. Zootaxa 2006, 1162, 53–64. [Google Scholar] [CrossRef] [Scilit]
  13. Merchán-Mayorga, J.; Quiroga, S.; Posada-Restrepo, I.; García-Ramos, K. Free-Living Clinging Flatworms (Rhabditophora, Polycladida) Associated with Sargassum from the Caribbean Coast of Colombia. Biodivers. Data J. 2025, 13, e150699. [Google Scholar] [CrossRef] [Scilit]
  14. Faubel, A. The Polycladida, Turbellaria. Proposal and Establishment of a New System. Part I. The Acotylea. Mitt. Hamb. Zool. Mus. Inst. 1983, 80, 17–121. [Google Scholar]
  15. Faubel, A. The Polycladida, Turbellaria. Proposal and Establishment of a New System. Part II. The Cotylea. Mitt. Hamb. Zool. Mus. Inst. 1984, 81, 189–259. [Google Scholar]
  16. Prudhoe, S. A Monograph on Polyclad Turbellaria; British Museum (Natural History); Oxford University Press: New York, NY, USA, 1985; ISBN 978-0-565-00977-9. [Google Scholar]
  17. Batista-Morales, A.M.; Merchán-Cepeda, A.; Díaz-Sánchez, C.M.; Gómez-Campo, D.I.; Arteaga-Sogamoso, E.; Montoya-Cadavid, E.; Gómez-Campo, K.; Chasqui, L.; Mejía-Ladino, L.M.; Garrido-Linares, M.; et al. Capítulo V: Estado Del Conocimiento y Vacios de Información (pp. 157–203). In Informe del Estado de los Ambientes y Recursos Marinos y Costeros en Colombia: Año 2011; INVEMAR: Santa Marta, Colombia, 2012; p. 203. [Google Scholar]
  18. Batista-Morales, A.M. Capítulo VII: Estado de los litorales rocosos (pp. 125–155). In Informe del Estado de los Ambientes y Recursos Marinos y Costeros en Colombia: Año 2008; Serie de Publicaciones Periódicas; INVEMAR: Santa Marta, Colombia, 2009; p. 243. [Google Scholar]
  19. Pabón Caicedo, J.D.; Montealegre Bocanegra, J.E. Los fenómenos de El Niño y de La Niña, su Efecto Climático e Impactos Socioeconómicos; Academia Colombiana de Ciencias Exactas, Físicas y Naturales: Bogotá, Colombia, 2017; p. 168. [Google Scholar]
  20. Pérez, R.A.; Ortiz, R.J.C.; Bejarano, A.L.F.; Otero, D.L.; Restrepo, L.J.C.; Franco, H.A. Sea Breeze in the Colombian Caribbean Coast. Atmósfera 2018, 31, 389–406. [Google Scholar] [CrossRef] [Scilit]
  21. Marcus, E. Turbelários marinhos no Brasil. Bol. Fac. Filos. Ciênc. Let. Univ. São Paulo Zool. 1947, 12, 99–215. [Google Scholar] [CrossRef] [Scilit]
  22. Marcus, E. Turbellaria brasileiros (7). Bol. Fac. Filos. Ciênc. Let. Univ. São Paulo Zool. 1949, 14, 7–155. [Google Scholar] [CrossRef] [Scilit]
  23. Marcus, E. Turbellaria brasileiros (8). Bol. Fac. Filos. Ciênc. Let. Univ. São Paulo Zool. 1950, 15, 5–191. [Google Scholar] [CrossRef] [Scilit]
  24. Marcus, E. Turbellaria brasileiros (10). Bol. Fac. Filos. Ciênc. Let. Univ. São Paulo Zool. 1952, 17, 5–187. [Google Scholar] [CrossRef] [Scilit]
  25. du Bois-Reymond Marcus, E.; Marcus, E. Polycladida from Curaçao and Faunistically Related Regions. Stud. Fauna Curaçao Other Caribb. Isl. 1968, 26, 1–133. [Google Scholar]
  26. Hyman, L.H. Acoel and Polyclad Turbellaria from Bermuda and the Sargassum. Bull. Bingham Oceanogr. Collect. 1939, 7, 1–26. [Google Scholar]
  27. Hyman, L.H. Polyclad worms collected on the presidential cruise of 1938. Smithson. Misc. Collect. 1939, 98, 1–13. [Google Scholar]
  28. Hyman, L.H. The Polyclad Flatworms of the Atlantic Coast of the United States and Canada. Proc. US Natl. Mus. 1940, 89, 449–495. [Google Scholar] [CrossRef] [Scilit]
  29. Hyman, L.H. Some Polyclad Flatworms from the West Indies and Florida. Proc. US Natl. Mus. 1955, 104, 115–150. [Google Scholar] [CrossRef] [Scilit]
  30. Hyman, L.H. A Further Study of the Polyclad Flatworms of the West Indian Region. Bull. Mar. Sci. 1955, 5, 259–268. [Google Scholar]
  31. Tyler, S.; Schilling, S.; Hooge, M.; Bush, L. World List of Turbellarian Worms: Acoelomorpha, Catenulida, Rhabditophora. Polycladida. Available online: https://www.marinespecies.org/aphia.php?p=taxdetails&id=2853 (accessed on 4 July 2025).
  32. Bahia, J.; Schrödl, M. Brazilian Polycladida (Rhabditophora: Platyhelminthes): Rediscovery of Marcus’ Type Material and General Revision. Zootaxa 2018, 4490, 1–121. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  33. Sonnenberg, R.; Nolte, A.W.; Tautz, D. An Evaluation of LSU rDNA D1-D2 Sequences for Their Use in Species Identification. Front. Zool. 2007, 4, 6. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. Griekspoor, A.; Groothuis, T. 4Peaks, Ver. 1.8; Netherlands, 2015. Available online: https://nucleobytes.com/4peaks/ (accessed on 9 September 2025).
  35. Larsson, A. AliView: A Fast and Lightweight Alignment Viewer and Editor for Large Datasets. Bioinformatics 2014, 30, 3276. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  36. Bahia, J.; Padula, V.; Delgado, M. Five New Records and Morphological Data of Polyclad Species (Platyhelminthes: Turbellaria) from Rio Grande Do Norte, Northeastern Brazil. Zootaxa 2012, 3170, 31–44. [Google Scholar] [CrossRef] [Scilit]
  37. Noreña, C.; Rodríguez Monter, J.; Pérez, J.; Almón, B. New Acotylea (Polycladida, Platyhelminthes) from the East Coast of the North Atlantic Ocean with Special Mention of the Iberian Littoral. Zootaxa 2015, 4039, 157–172. [Google Scholar] [CrossRef] [Scilit]
  38. Bock, S. Studien Über Polycladen. Zool. Bijdr. Från Upps. 1913, 2, 31–344. [Google Scholar]
  39. Hyman, L.H. Miscellaneous Marine and Terrestrial Flatworms from South America. Am. Mus. Novit. 1955, 1742, 1–33. [Google Scholar]
  40. Bahia, J.; Padula, V.; Correia, M.D.; Sovierzoski, H.H. First Records of the Order Polycladida (Platyhelminthes, Rhabditophora) from Reef Ecosystems of Alagoas State, North-Eastern Brazil, with the Description of Thysanozoon alagoensis sp. nov. J. Mar. Biol. Assoc. UK 2015, 95, 1653–1666. [Google Scholar] [CrossRef] [Scilit]
  41. Bulnes, V.N.; Faubel, A.; Park, J.-K. Two New Marine Species from South Korea with Remarks on the Family Stylochidae (Acotylea, Polycladida, Plathelminthes). J. Nat. Hist. 2005, 39, 2089–2107. [Google Scholar] [CrossRef] [Scilit]
  42. Graff, L. von Pelagische Polycladen. Arbeiten aus dem Zoologischen Institut zu Graz. 1893, 5, 1–32. [Google Scholar]
  43. Plehn, M. Die Polycladen der Plankton-Expedition. In Ergebnisse der in dem Atlantischen Ocean von Mitte Juli bis Anfang November 1889 ausgeführten Plankton-Expedition der Humboldt-Stiftung; Auf Frund von gemeinschaftlichen Untersuchungen einer Reihe von Fach-Forschern; Lipsius & Tischer: Kiel, Germany, 1896; Volume 2, p. 13. [Google Scholar]
  44. Faubel, A. On the Geographical Occurrence of Pelagic Polyclad Turbellarians. Cah. Biol. Mar. 1984, 25, 153–168. [Google Scholar]
  45. van Tussenbroek, B.I.; Monroy-Velázquez, L.V.; Rodríguez, D.; Suescún-Bolívar, L.P.; Thomé, P.E.; Cerqueda-García, D.; García-Maldonado, J.Q.; Martínez-López, I.G.; López-Portillo, J.A.; Barba-Santos, M.G.; et al. Monitoring Drift and Associated Biodiversity of Nearshore Rafts of Holopelagic Sargassum Spp. in the Mexican Caribbean. Aquat. Bot. 2024, 195, 103792. [Google Scholar] [CrossRef] [Scilit]
  46. Mertens, H. Untersuchungen Über Den Innern Bau Verschiedener in Der See Lebender Planarien. Mem. Acad. Sci. St. Petersb. 1832, 2, 3–17. [Google Scholar]
  47. Hyman, L.H. Free-Living Flatworms (Turbellaria) of the Gulf of Mexico. Fish. Bull. 1954, 5, 301–302. [Google Scholar]
  48. Prudhoe, S. XXXIV—On Some Polyclad Turbellarians from the Cayman Islands. Ann. Mag. Nat. Hist. 1944, 11, 322–334. [Google Scholar] [CrossRef] [Scilit]
  49. Moseley, H.N. On Stylochus pelagicus, a New Species of Pelagic Planarian, with Notes on Other Pelagic Species, on the Larval Forms of Thysanzoon, and of a Gymnosomatous Pteropod. J. Cell Sci. 1877, 2, 23–33. [Google Scholar] [CrossRef] [Scilit]
  50. Hyman, L.H. Some Polyclads of the New England Coast, Especially of the Woods Hole Region. Biol. Bull. 1939, 76, 127–152. [Google Scholar] [CrossRef] [Scilit]
  51. Laidlaw, F.F. On the Marine Fauna of the Cape Verde Islands from Collections Made in 1904 by Mr. C. Crossland: The Polyclad Turbellaria. Proc. Zool. Soc. Lond. 1906, 76, 705–719. [Google Scholar]
  52. Cuadrado, D.; Rodríguez, J.; Moro, L.; Grande, C.; Noreña, C. Polycladida (Platyhelminthes, Rhabditophora) from Cape Verde and Related Regions of Macaronesia. Eur. J. Taxon. 2021, 736, 1–43. [Google Scholar] [CrossRef] [Scilit]
  53. Litvaitis, M.K.; Bolaños, D.M.; Quiroga, S.Y. Systematic Congruence in Polycladida (Platyhelminthes, Rhabditophora): Are DNA and Morphology Telling the Same Story? Zool. J. Linn. Soc. 2019, 186, 865–891. [Google Scholar] [CrossRef] [Scilit]
  54. Schmarda, L.K. Neue Turbellarien, Rotatorien Und Anneliden, Beobachtet Und Gesammelt Auf Einer Reise Um Die Erde 1853 Bis 1857. In Neue Wirbellose Thiere, Beobachtet Und Gesammelt Auf Einer Reise Um Die Erde 1853 Bis 1857; W. Engelmann: Leipzig, Germany, 1859; Volume 1, p. 66. [Google Scholar]
  55. Özdikmen, H. A New Family and Two Genera Names for Turbellaria (Platyhelminthes). Mun. Ent. Zool. 2010, 5, 115–117. [Google Scholar]
  56. Ramos-Sánchez, M. The Polyclads (Platyhelminthes: Polycladida) from the Tropical Eastern Pacific: Commented Checklist and Description of a New Species. Eur. J. Taxon. 2024, 962, 1–67. [Google Scholar] [CrossRef] [Scilit]
  57. Kato, K. Polycladida of Japan. J. Sigenkagaku Kenkyusyo 1944, 1, 257–318. [Google Scholar]
  58. Marcus, E. Turbellaria Do Brasil. Bol. Fac. Filos. Ciênc. Let. Univ. São Paulo Zool. 1948, 13, 111–243. [Google Scholar] [CrossRef] [Scilit]
  59. Hyman, L.H. The Polyclad Flatworms of the Pacific Coast of North America. Bull. Am. Mus. Nat. Hist. 1953, 100, 265–392. [Google Scholar]
  60. Hyman, L.H. Marine Turbellaria from the Atlantic Coast of North America. Am. Mus. Novit. 1944, 1266, 1–15. [Google Scholar]
  61. Oya, Y.; Tsuyuki, A.; Kajihara, H. A New Species of Zygantroides (Platyhelminthes: Polycladida) from Amakusa, Japan. Species Divers. 2020, 25, 189–196. [Google Scholar] [CrossRef] [Scilit]
  62. Bahia, J.; Padula, V.; Schrödl, M. Polycladida Phylogeny and Evolution: Integrating Evidence from 28S rDNA and Morphology. Org. Divers. Evol. 2017, 17, 1–26. [Google Scholar] [CrossRef] [Scilit]
  63. Miloslavich, P.; Díaz, J.M.; Klein, E.; Alvarado, J.J.; Díaz, C.; Gobin, J.; Escobar-Briones, E.; Cruz-Motta, J.J.; Weil, E.; Cortés, J.; et al. Marine Biodiversity in the Caribbean: Regional Estimates and Distribution Patterns. PLoS ONE 2010, 5, e11916. [Google Scholar] [CrossRef] [Scilit]
  64. Gonzalez-Cueto, J.; Quiroga, S.; Norenburg, J. A Shore-Based Preliminary Survey of Marine Ribbon Worms (Nemertea) from the Caribbean Coast of Colombia. Zookeys 2014, 439, 83–108. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Sampling sites along the coast of Santa Marta, Colombia. The small star in the inset map indicates the Colombian Caribbean study region and the larger stars denote the specific sampling sites within this area. Map adapted from IHO Sea Areas, version 3 (2018), used under a Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International License. Data sourced from https://doi.org/10.14284/323.
Figure 1. Sampling sites along the coast of Santa Marta, Colombia. The small star in the inset map indicates the Colombian Caribbean study region and the larger stars denote the specific sampling sites within this area. Map adapted from IHO Sea Areas, version 3 (2018), used under a Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International License. Data sourced from https://doi.org/10.14284/323.
Taxonomy 05 00051 g001
Figure 7. Stylochus sp. (A) Photograph of live specimen; (B) Detail of the eyespot arrangement from whole mount (CBUMAG:PLA:00134); (C) Detail of the posterior, ventral view; (D,E) sagittal sections of reproductive structures (CBUMAG:PLA:00293). am: male atrium; ce: cerebral eyespots; fp: female pore; mp: male pore; ov: oviduct; ph: pharynx; pv: prostatic vesicle; sv: seminal vesicle; te: tentacles; ten: tentacular eyespots; v: vagina; vd: vas deferens.
Figure 7. Stylochus sp. (A) Photograph of live specimen; (B) Detail of the eyespot arrangement from whole mount (CBUMAG:PLA:00134); (C) Detail of the posterior, ventral view; (D,E) sagittal sections of reproductive structures (CBUMAG:PLA:00293). am: male atrium; ce: cerebral eyespots; fp: female pore; mp: male pore; ov: oviduct; ph: pharynx; pv: prostatic vesicle; sv: seminal vesicle; te: tentacles; ten: tentacular eyespots; v: vagina; vd: vas deferens.
Taxonomy 05 00051 g007
Figure 17. Notocomplana sp. (A) Photograph of live specimen; (B) Detail of the eyespot organization from whole mount (CBUMAG:PLA:00453); (C) Detail of the ventral view; (D,E) sagittal sections of reproductive structures (CBUMAG:PLA:00406). af: female atrium; ce: cerebral eyespots; ed: ejaculatory duct; fp: female pore; lv: Lang’s vesicle; mp: male pore; ov: oviduct; ph: pharynx; pp: penis papilla; pv: prostatic vesicle; sv: seminal vesicle; ten: tentacular eyespots; u: uterus; v: vagina; vd: vas deferens.
Figure 17. Notocomplana sp. (A) Photograph of live specimen; (B) Detail of the eyespot organization from whole mount (CBUMAG:PLA:00453); (C) Detail of the ventral view; (D,E) sagittal sections of reproductive structures (CBUMAG:PLA:00406). af: female atrium; ce: cerebral eyespots; ed: ejaculatory duct; fp: female pore; lv: Lang’s vesicle; mp: male pore; ov: oviduct; ph: pharynx; pp: penis papilla; pv: prostatic vesicle; sv: seminal vesicle; ten: tentacular eyespots; u: uterus; v: vagina; vd: vas deferens.
Taxonomy 05 00051 g017
Figure 19. Armatoplana colombiana Bolaños, Quiroga and Litvaitis, 2006. (A) Photograph of live specimen. (BE) CBUMAG:PLA:00531. (B) Detail of the eyespot organization from whole mount; (C) Detail of the ventral view; (D,E) sagittal sections of reproductive structures. b: brain; ce: cerebral eyespots; fp: female pore; lv: Lang’s vesicle; mp: male pore; ph: pharynx; pv: prostatic vesicle; sv: seminal vesicle; st: stylet; te: tentacle; ten: tentacular eyespots; v: vagina.
Figure 19. Armatoplana colombiana Bolaños, Quiroga and Litvaitis, 2006. (A) Photograph of live specimen. (BE) CBUMAG:PLA:00531. (B) Detail of the eyespot organization from whole mount; (C) Detail of the ventral view; (D,E) sagittal sections of reproductive structures. b: brain; ce: cerebral eyespots; fp: female pore; lv: Lang’s vesicle; mp: male pore; ph: pharynx; pv: prostatic vesicle; sv: seminal vesicle; st: stylet; te: tentacle; ten: tentacular eyespots; v: vagina.
Taxonomy 05 00051 g019
Figure 23. Phaenocelis medvedica Marcus, 1952. (A) Photograph of live specimen; (B) Detail of the eyespot organization from whole mount (CBUMAG:PLA:00261); (C) Detail of the ventral view; (D,E) sagittal sections of reproductive structures (CBUMAG:PLA:00169). am: male atrium; b: brain; ce: cerebral eyespots; fp: female pore; lv: Lang’s vesicle; mp: male pore; ov: oviduct; p: penis; ph: pharynx; pv: prostatic vesicle; sv: seminal vesicle; ten: tentacular eyespots; v: vagina.
Figure 23. Phaenocelis medvedica Marcus, 1952. (A) Photograph of live specimen; (B) Detail of the eyespot organization from whole mount (CBUMAG:PLA:00261); (C) Detail of the ventral view; (D,E) sagittal sections of reproductive structures (CBUMAG:PLA:00169). am: male atrium; b: brain; ce: cerebral eyespots; fp: female pore; lv: Lang’s vesicle; mp: male pore; ov: oviduct; p: penis; ph: pharynx; pv: prostatic vesicle; sv: seminal vesicle; ten: tentacular eyespots; v: vagina.
Taxonomy 05 00051 g023
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Merchán-Mayorga, J.I.; Bolaños, D.M.; Castro, L.R.; Quiroga, S. A Revised Checklist and Identification Key for Acotylean Flatworms (Rhabditophora: Polycladida: Acotylea) from the Caribbean Coast of Colombia. Taxonomy 2025, 5, 51. https://doi.org/10.3390/taxonomy5030051

AMA Style

Merchán-Mayorga JI, Bolaños DM, Castro LR, Quiroga S. A Revised Checklist and Identification Key for Acotylean Flatworms (Rhabditophora: Polycladida: Acotylea) from the Caribbean Coast of Colombia. Taxonomy. 2025; 5(3):51. https://doi.org/10.3390/taxonomy5030051

Chicago/Turabian Style

Merchán-Mayorga, Jorge I., D. Marcela Bolaños, Lyda R. Castro, and Sigmer Quiroga. 2025. "A Revised Checklist and Identification Key for Acotylean Flatworms (Rhabditophora: Polycladida: Acotylea) from the Caribbean Coast of Colombia" Taxonomy 5, no. 3: 51. https://doi.org/10.3390/taxonomy5030051

APA Style

Merchán-Mayorga, J. I., Bolaños, D. M., Castro, L. R., & Quiroga, S. (2025). A Revised Checklist and Identification Key for Acotylean Flatworms (Rhabditophora: Polycladida: Acotylea) from the Caribbean Coast of Colombia. Taxonomy, 5(3), 51. https://doi.org/10.3390/taxonomy5030051

Article Metrics

Back to TopTop